Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012076149 Xt7.1-CAAP2396.3 - 36 ESTs
                                                                       ...-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP2396.3                                                                          GCAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAAAAA
                                                  Xt7.1-CHK-1008227315                                                                                ACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAAxAAAAAAAA
                                                      consensus depths                                                                               3     3     5     5     5     5     5     8     7    10     7    10     7    10     7    11     7    12     7    12    11    12    11    12    11    12    11    12    11    12    11    12    10    12    10    12    10    12    11    13    11    13    11    13    12    13    13    14    13    14    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    14    15    14    15    15    15    13    15    12    15    10    14    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    11    15    12    15    11    15    11    14    11    14    10    14    10    14     9    14     7    14     7    14     6    13     6    11     5    11     6    11     5    10     5    10     5    10     6    11     6     9     5     8     7     9     6     9     6     9     6     8    10    12    10    12    11    13    14    18    15    19    15    19    14    18    15    19    15    19    15    18    15    18    16    19    16    19    15    17    15    17    15    17    16    18    16    18    16    18    16    18    16    18    16    18    16    18    16    18    17    19    17    19    17    19    15    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    17    19    18    19    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    14    15    14    15    13    15    13    15    12    13    11    12    11    12    10    12     9    11     3     6
                                                                   VAR                                                                                                                                                                                      AGTTACAGAGAA
                                                                   SNP                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                          -T-----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                               BLH ATG      26     352                                                                          
                                               BLH MIN      26     238                                                                          
                                               BLH OVR      26     356                                                                          
                                               EST CLI       1       1                                                                          
                                               ORF LNG      26     104                                                                          
                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-029     NP_498854.1 leucine aminopeptidase (52.4 kD) (lap-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 4e-063     XP_786205.2 PREDICTED: similar to leucine aminopeptidase 3, partial [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Dm ---- 4e-108     NP_729394.1 CG32351-PA [Drosophila melanogaster] ----------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                             PREDICTED - Dr ---- 0          XP_691313.1 PREDICTED: similar to leucine aminopeptidase [Danio rerio] ------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN === Mm ==== 0          NP_077754.2 leucine aminopeptidase 3 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN === Hs ==== 0          NP_056991.2 leucine aminopeptidase [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Gg ---- 0          NP_001026507.1 leucine aminopeptidase [Gallus gallus] -----------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Xl ---= 0          AAH68707.1 MGC81140 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED - ?? ---= 0          NP_001084691.1 hypothetical protein LOC414652 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED = Xt ==== 0          AAH84523.1 Hypothetical LOC496537 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP2396.3                                                                                     TGA------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------TAATGA------------------TGA------------------------------------------------------TAATGA------ATG---------------------------ATG---------------------------------------------------------------------TAA
                                                                   ORF                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Gas  FL                     TGas037b10.FL-Sanger                                                                AATCCCCGGGGCAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAAAAAAAAAAAAAAAAAA
  5   1   1                FL                     IMAGE:7028380.FL-MGC                                                                         CCCAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG50045.5p CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGGGCAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTCGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTACTGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTG
  5   1   2       bld Te5       in                         CAAO5583.5p                                                  AGTGGCTGCACATGTTGTTAGAGGGCAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCANAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAAGAGCCCC
  5   1   2   12  bld Gas7 5g3  in                          XZG4256.5p ...............................................................TTGTTAGAGGGCAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTCGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTACTGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAAACACAAATGGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTCCCTGGAAATCATTACAGCGGCAGCTCTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG53161.5p ..........................................................................CAGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGT
  5   1   2       bld      FL                         IMAGE:7028380.5p                                                                            AGAGACAGCTGAATAGCAGGCGTGATGCTGCCTTTCAGAACTTTGCTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGGCAATTACATTACACCTACAAAATTTGCAGAAACATTTGAACAGAAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTTACCAGATCAAAAACAGTGGAAAAGAGAAACCAACAAATGGGGGGCATTCCCTTAAGTGGTGGCCAAAGGGTTCTGAAAAAAACCCCCGGGTCTTCCCTGGAAAATTTTTTTAAAGCGGGCAGCCTCTTTAATGCAAAGCCACGCCCTCCCCTCCTAGTAATTTGT
  5   1   2       bld Gas  FL                        TGas037b10.p1kSP6                                                                                                   AGCGTGAAGCTGCCTTTCAGAATTTGCTCAAAGNGACGTTAATAGGAACTGCTGCAGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCNAGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTC
  5   1   2       bld Mus1      in                        CABH12258.5p                                                                                                     TCGATTCAATTCGGCACGAGGCTCAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGGATTTCTC
  5   1   2       bld In60                            IMAGE:8952148.5p                                                                                                        ATTCGGTTAATTTTTAAAGATACCAATAAAAATAAAAACGTCCCGTTCTGTGAAACACCCAGTTTATAATGGACCTCCAGTTACAGAGAAAAGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCTGGACCGTCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTCGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTACTGTTAAGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGGCATTCCTAAGTGTGCCAAAGGGTCTGAAGAGCCCCGGTCTTCCTGGAAATCATTACAGCGCAGCTCTGATGCAAGCAGCTCCTCTAGTATTGTGGAAAGAGTGACATTGACAGTGGTGAAGTTTCCTCTGAAACCTTCTTCAGCCATGCAG
  5   1   2       bld In66                            IMAGE:8966064.5p                                                                                                               GTTTTTTATTTAAAAATTATCAAAAAAATAAAAAAACTCCCTGTGAAACACCCAGTTTATAATGGACCTCCAGTTACAGAGAAAAGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCTGGACCGTCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTCCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGAGGGTGTCGCTGAGGGCAAACCTGCTTCGCATTGAGGAAGCGCCGCCATACTTACACCTACAAATCCCAAAATTTGACAAAGTTGGCAATGGGCAGCTGGTAGGGGTAACAATCAACGTG
  5   1   2       bld Lun1      in                         CABD8496.5p                                                                                                                         CTCAAATGGAGCGTTAATAGGAACTGCTGCAGGGGGTTCGCTGTGTCACAACAGAACTACAATAGTGTGAAAAAGGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCAGGACCATCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAATTCATTACAGCGGCAGCTCTGATGNCAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGT
  5   1   2       bld In62                            IMAGE:8955019.5p                                                                                                                                                        GAAAACCACCCCAGTTTATAATGGACCTCTAGTTACAGAGAAAAGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCTGGACCGTCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTCGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTACTGTTAAGGTGTTTACCAGATCAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAGAGCCCCGGTCTTCCTGGAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTGAAAAGGAGTGACATTTGACAGTGGTGATTTCTCTGAAACTTCTTCAGCATGATGCATGAAGCGATATGGGGGGGCTGCTACAGTTGTTCTGCATCCGACTGCTGCAAGCTAAGTACTATCAATTATCAGTCTAGTCATGGGTGAAAATGCAATGACGACATAGCGGTGATGGTCAGCAGATGAATCAGTGAATCTGATGCAGAGCTTTTACTAGTCTCGTCCACGTTATCTCGGAACGTATGTCCACATACAG
  5   1   2       bld In66                            IMAGE:8962495.5p                                                                                                                                                                    CATTTCGGATCCTTTTTATGTTACAGAGAAAAGGTCTTGTCCTTGGAGTGTATGAGAAAGAAAAGGAAGAAGAATCGCTCACTCTGACAAATGCAGGAGATGCTGTTGATAATGCTGTTTTAGGAAAGCTGCGTGACCAGTTGGCCAGATCTGGACCGTCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTCGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTACTGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAATGGGGGCATTCCTAAGTGTGCCAAGGGTCTGAGAGCCCCGGTCTTCTGAAATTCATTACAGCGGCAGCTCTGATGCAGCAGCTCCTCTAGTATTGTGAAAGATGACTTTGACAGTGTGAATTCCTTGATCTCTCAGGCATGATGCAATGAAGCGATATGGGGGACTGCTACAGGTTGTTCTGCCATCCGAAC
  5   1   2       bld Limb      in                        CBSU2046.fwd                                                                                                                                                                                                                                                                                                    CTGCGTGACCAGTTGGCCAGATCTGGACCGTCTCTCAAAAAAGGCAAATCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCANAACAGTGGATAGAAGAACAACAATGGGGGCATTCCTAGTGTGGCCAAAGGGTCTGAAGAGCCCCGGTCTTCCTG
  5   1   2       bld Bone      in                        CBTC4362.fwd                                                                                                                                                                                                                                                                                                                                                    TCACGAATATTTTATGGGTTGCATGAGGATTTTCCAAGCATTGTTGTGGTTGGCCTTGGCAAGAAATCTGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCNAAGCTAAAGTTACCCTATCATATTATCAGTCTAGCTTCATTGTGTG
  5   1   2       bld Gas7      in                          XZG6158.5p                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGGAGTCAATCAACATGAACTCTGGAATGAAGCCAAGGAGAATATTAGAGCAGCAGTGTCAGTGGGCTGCAGGCAGATGCAAGATATGGAGATTGTGCAGGTAGAAGTGGACCCATGTGGAGATGCCCAGGCTGCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTCGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTACTGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCA
  3  -1   2       bld Int1      in                        CAAP10227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCTGAAGGGGCTGTCCTTGGACTGTTTGAATACAATGAGATGAAGAAGAAAAAAAAGAAAGCAGTTACCACTCATCTTCATGGAAGCGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCA
  5   1   2       bld Neu       in                   TNeu102c06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGATCACTGCCTGGGAGAAGGGAGTGCTGTACGCTGAGGGGCAAAACCTGGCTCGCCATTTGATGGAAGCGCCGGCCAATTACATTACACCTACAAAATTTGCAGAGACATTTGAACAGAGGTTGGCGAATATGGGCAGTAATGTTAAGGTGTTTACCAGATCAAAACAGTGGATAGAAGAACAACAAATGGGGGCATTCCTAAGTGTGGCCAAAGGGTCTGAAGAGCCCCCGGTCTTCCTGGAAATTCATTACAGCGGCAGCTCTGATGCAAGCCAGCCTCCTCTAGTATTTGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACC
  5   1   2       bld Tbd1      in                         CBXT8705.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTTGGAAAAGGAGTGACATTTGACAGTGGTGGAATTTCTCTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACCGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACTGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCTCGTCTCAGTGAAGACAAACAA
  5   1   2       chi Kid1      in                         CABA4943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGTTGGTGATATTTTTTAACACGTTATAACATAAACTAGAAAAGCAGGGCTTGTTAAATAGGATACTTATCTTAGAATTACATTTTTAGTATAAGGAAGATGTAGATATTCTGAGGGAATATAAGGTTGGTCCTACTTGTCCTAGCAGCTAAGATGAATTTACTCATTAAGTCACTTACAGTAAGAAGCATGAAAAATCCCTAGGCAACCTAAGTTATGGCCCAGTAGATGCACTATTTGTGTATTAGTTTACGCACAGATTGGGTGGGTTTAGACCCCTACAGCCTTCCCTTTCTTGTCCCAACTCACTTCTGTGACCGACAAAACCAAGTGGCTCTCTTATTTATACACGCATGCCTACTCCCTTCGGTTATGTCTAAGGTGGGCATGTTGGACACAGATACTGTATATATCATCAGTATTATCACACCAGTCCAGGT
  3   1   2       bld Te5       in                         CAAO5583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAACCTTCTTCAGGCATGGATGCAATGAGAGGCGATATGGGGGGAGCTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATG
  3   1   2      seed Int1      in                         CAAP2396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAA
  5   1   2       bld Int1      in                         CAAP2396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGANAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGA
  3   1   2       bld Lun1      in                         CABD8496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCTACAGTTGTTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCT
  3   1   2       bld Mus1      in                        CABH12258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTACAGTTTGTTCTGCCATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAAC
  3   1   2       bld Gas7 5g3  in                         XZG50045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCACGACTGCTGCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTTCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAAAAAAT
  5  -1   2       chi Int1      in                        CAAP10227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTCCCAAACTCACTTCTGTGACCGACAAAACCAAGTGGCTCTCTTATTTATACACGCATGCCTACTCCCTTCGGTTATGTCTAAGGTGGGCATGTTGGACACAGATACTGTATATATCATCAGTATTATCACACCAGTCCAGGTTGGGTAAGGGCGAGTATAGGGTTGATAGGAGTCGAAAATGTTTCGACCCGCACATCACTAGCATGTACAGCACTATGAAATTAAGCAACTGTCTTCGTGTAACAGCTTAGGATCAAAGAAAAAAACCTAGGATACATAATGACGTCTTATATGTTCAAGGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTCCTCGGCCGAATTGAATCGATGGATCCG
  3   1   2       bld Kid1      in                         CABA4943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTCCCAACTCACTTCTGTGACCGACAAAACCAAGTGGCTCTCTTATTTATACACGCATGCCTACTCCCTTCGGTTATGTCTAAGGTGGGCATGTTGGACACAGATACTGTATATATCATCAGTATTATCACACCAGTCCAGGTTGGGTAAGGGCGAGTATAGGGTTGATAGGAGTCGAAAATGTTTCGACCCGCACATCACTAGCATGTACAGCACTATGAAATTAAGCAACTGTCTTCGTGTAACAGCTTAGGATCAAAGAAAAAAACCTAGGATACATAATGACGTCTTATATGTTCAAGGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAAC
  3   1   2       bld Limb      in                        CBSU2046.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAAGCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGAAAGCCAGCGTTGTTACTGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCAC
  5   1   2       bld Tbd1      in                        CBXT17723.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACCGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACTGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCTCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd1      in                        CBXT17723.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTAAAGTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACCGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACTGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCTCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                          XZG6158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTACCTATCAATATTATCAGTCTAGCTCCATTGTGTGAAAATATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAATGAAAACAAGAAAATGATAAAAAAAAAAAAAAGG
  3   1   2       bld Bone      in                        CBTC4362.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCCAAATGGACGAGCAAATAAACCCGGTGATGTGGTCAAGGCCAAGAATGGAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGAAAGCCAGCGTTGTTACTGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCT
  3   1   2       bld Neu       in                    TNeu102c06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGGCCAAGAATGAAAAAACAATTCAGGTTGATAATACTGATGCAGAAGGAAGGCTTCTTTTAGCTGATGCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAGAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                          XZG4256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTCTCTGCTACGCACACAGTTTTAATCCTCGGGCAATCGTTAATGCTGCAACATTAACAGGTGCAATGGATGTCGCATTAGGATCTGCTGCAGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACCGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCCCGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCCCACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGGGTACTAAAATTAACAAACAAAATAAGCTAAAAAAGGGaaaaaaaaaaaaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld Tbd1      in                         CBXT8705.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTGGAGTATTCACAAACTCTTCCTGGCTTTGGACTCACCTTCAGGAAGCCAGCGTTGTTACTGGAGACCGTGTATGGAGAATGCCACTGTTTGAGCACTACAGCAAACAAGTGACTGAATCAGCTCTTGCTGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCTCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAACAAAAAAAAAAAAAAAGGGCGGCGCTGCCAGCTTCAGCCAAATGCGCATCAGCTCCACTCGCTCCTCCAGCGGAGGCGCAGGGCTCGGCCGGGCAGGGGGAAGCTTCAGCAGCTCCAGTCTGTCCAACATCGGTGGCGGCGTCAGAAAGAGCGTCTCTTACGGCGTTAGCA
  3   1   2       bld Gas7 5g3  in                         XZG53161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACCTGAACAATATTGGAAAATACAGCAGATCGGGAGGAGCCTGCACAGCTGCCGCCTTCCTGAAAGAGTTTGTAACTGCACCTCACTGGGCTCATCTGGACATTGCCGGCGTGATGTCAAATAAGGATGAGGTGCCGTACCTTCGCAAAGGCATGTCCGGCCGCCCCACGAGGACATTAATAGAGTTTGCTGCCCGTCTCAGTGAAGACAAACAAACTATTTAATGAAACATCTCTGTTTTATCTTGAAACCACACAGAATTATTTCTATTATTAAATTTGCCAGAAAACCTGAAAGAAGCATAATGAATATTAATGTTAAGACTTTTTTTGTAGAGTTGCTTGTATGTATCATGGAACAAATTTTCACATACTGTATCTCTTATTTTGTGTACTAAAATTAACAAACAAAATAAGCTAAAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)