Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA033l21.3                         33 END     1           1        3                Unknown (protein for MGC:76034) [Silurana tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012076168 Xt7.1-TEgg045k21.3 - 59 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg045k21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACAACTTTATTGATACGCCGGCGAACAGACAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAGGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTCTGATATTTTGTTTAAAATAAAAAAAACCCTGGAGATCCATAGAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTTGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAACCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAA
                                                  Xt7.1-CHK-1008225022                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTTATTGATACGCCGGCGAACAGACAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAGGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTCTGATATTTTGTTTAAAATAAAAAAAACCCTGGAGATCCATAGAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTTGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAACCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     3     4     4     4     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     9     9     9     9    10     9    10     9    11     9    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    13    11    13    12    13    10    11    10    11    10    11    10    11    11    12    10    11    10    11    10    11    10    11     9    10     9    10     8     9     7     8     7     9     6     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     6     7     7     8     7     8     7     8     7     8     7     9     6     8     5     6     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     5     5     5     5     5     5     5     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     7     7     7     8     7     8     8     9     8     9     7     8     7     8     7     8     7     8     7     8     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    11    11    12    12    12    12    12    12    12    12    11    12    12    12    12    12    12    12    11    11    11    11    11    11     9    10     9    10     9    10     9    10     7     9     8     9     8     9     7     9     8     9     7     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     9    10     9    10     9     9     9     9     7     7     7     7     7     7     7     7     7     7     7     7     5     5     5     5     5     5     4     5     4     5     4     4     4     4     3     4     4     4     4     4     4     4     4     4     5     5     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9    10    10    11    11    11    11    11    11    11    11    11    11    14    14    16    16    16    16    16    17    16    18    15    17    16    17    17    18    17    19    17    19    17    19    15    17    15    16    15    17    17    18    17    18    17    18    17    18    18    20    18    20    21    22    23    24    23    24    24    25    24    25    24    25    24    25    23    25    23    25    23    25    23    25    22    25    22    25    22    25    22    25    22    25    22    23    22    23    21    23    21    22    20    22    20    21    19    20    19    20    19    20    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18     8    18     8    18     8    17     8    17     8    17     6    16     6    16     6    16     5    13     4     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --G---------
                                               BLH ATG     252     303                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     252     152                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     252     351                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     252     119                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sc ---- 4e-026     NP_015305.1 Ubl (ubiquitin-like protein)-specific protease 1; initially processes Smt3; alsoacts as a deconjugating enzyme for Smt3; Ulp1p [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-051     NP_573362.1 CG12359-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-059     NP_498095.3 Ubiquitin-Like Protease family member (ulp-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 2e-073     XP_797423.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 1e-135     XP_692189.1 PREDICTED: similar to SUMO1/sentrin specific protease 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 5e-170     NP_055369.1 sentrin/SUMO-specific protease 1 [Homo sapiens] --------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 3e-170     XP_423848.2 PREDICTED: similar to sentrin/SUMO-specific protease [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Mm ---- 2e-171     NP_659100.1 RIKEN cDNA E330036L07 [Mus musculus] -------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAO33759.1 SUMO-specific protease U1p1 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001082507.1 SUMO-specific protease U1p1 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg045k21.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGA------------------ATG------------------------------------------------------------------------------------------------------------TAG------------TAA---------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------ATG---------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG------------------ATG------------------------------TGA---TAA---------------TGA---------------------------------------------------------------------------------------------------TAA------------------ATG---------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGATG---------------TGATAG---------TGA------------------------------TAA---------------------------------------------------------ATG---------ATG------TGA---------------------------------------------------------------------------------------TAA------TAG---------------------------------------------------------------------------------------ATGTAA------------TAA---TAA---TAA------TGAATG---------TAA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAA------------------------------------ATG---------------------------------------------------------TAA---------TAA------------------------TAGTGA------TAA------------------------------------------------------------TAA---------------------------------------------------------------------TGATAA------------------TGA------------------------------TAA---------------------ATG------------ATG---------------------------------------------------------------------------------TGA---------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           Egg  FLsh                   TEgg015h07.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAGGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTCTGATATTTTGTTTAAAATAAAAAAAACCCTGGAGATCCATAGAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTGGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAATCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCAGTGAATAAC
  5   1   2       bld Egg  5g3  in                   TEgg045f04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTACGACTCTCTTTACCACAGCCCTACGAGAACTCCCGCGGAAAAGGAACTCTCCCGAACCGTTTCAACAAAAACAACTTTATTGATACGCCGGCGAACAGACAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTACTTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCA
  5   1   2       bld TbA  5g3  in                   TTbA071k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGTTTCAACAAAAACAACTTTATTGATACGCCGGCGAACAGACAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACA
  5   1   2   12  bld Gas7 5g3  in                         XZG43575.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTCGTCGACCCACGCGGTCCGACAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGATTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTG
  5   1   2       bld Te5       in                         CAAO9526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGCCGGCGAGCAGACAGCACAGACAATTTCGGACGATCAATGTTGTGACGCTTTGCTGGTGTGCGTGTGTCTCCGTTGCCCTCGTTGTATGGCGTGAGTGGGTTGGGGTGTGTTCTCTCTGGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCGGGGGCAGTGTTTGGCGGGCCGAGTGGCGAGGGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGA
  5   1   2       bld Gas  5g                        TGas005a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCCAATTTCGGACGATCAATATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGG
  5   1   2       bld Egg  5g                        TEgg128i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGC
  5   1   2       bld Egg  5g                        TEgg128j01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTATGACACTTTGCTGATGTGCGTATGTCTCCGTTGCCCTCGTTGTATGGCGTGAATAAGTTGGGGTATATTCTCTCTAGTGGTGCTCTTTTCTTCCATTGGTTTTGTCGCAAAGGCAGTGTTTGGCAAGCCGAGTAGCGAGAGAGGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTT
  5   1   2       bld Egg  FLsh in                   TEgg015h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACACAGACAATTTCGGACGATCAATATTATGACACTTTGCTGATGAGCTAATTATTGCTGGAGAATACTAGTAATGCAACAGACTTTAATATGGATGATGATGTTAAAGAAATGATATGGGAGAGTGAAAACAACTCTACATTGAAAGCACATTGTAAAGAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGC
  5   1   2       bld Tad5      in                         XZT53801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCCTGCACAAAATTCTTCTTATAACTACAATTTTCAGTTTCCTGCTTTGCATCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAG
  5   1   2       bld Hrt1      in                         CAAQ3536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCGTGCCGAATTCGGCACGAGGCATAAGCATTTTGAGATTTCTTCGATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGA
  5   1   2      shim Int1      in                          CAAP608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACAGTCTCAAGGTAAAACAAATATAATTTTCTTACTATATGACTATATGTCATATTCTGACTAAATGTCAGAAACCTTTATCAGGGGTGTTCCAATTAACACTTACTTCAGCTCTATATACTGATCAAAAGTACCTGTATTTTGATTTTACAACTAGAGCCAAGTTTGAAGTTGCATACGATCCTTGGGGAATTTGGTATCCTGTGCTTTTTGCACATTAGAAAAGGGCCTTGTATCCTGGCTGGCTTTATTATAGTTGCATACTCATGTCTTAGTGCACTTTCTCCTCTGTGCAGTGTATCTGGAAAGTGCATGGACATTTACCTGCTGCTTATGACTTCAAATAGTTACTTATACATGAATGTACAGTCGCTATAGGGCATCATCTTGTGCTAGTTGGCTGTCTATTTAGGGAATTTGGCAAACGGTGTAATTGCTACCATTTGCTGCCCTCATGATTTCCAAGCTGGGGGAGTGGGTAGCAAAATGCTTATAGTTGCCTCTCCGTAGTTTTTGATTCTAGGCACTCTGTTATAGTGGCACTCTCTCTGCCCTGTACACTGACTGCACCAGCAGTTCAGGGCAATATTAATATCGGGGCATATCTGTAGTGGGGCAATTGCAACTGTTCTGCTGCCTTCCTACCCACTGAGCTAGAAATTATGTGAGTGGCANAACTATTCCAACCAGGCCCTGCACTATTGCCCTTAGACTGGTTCAGTATATACTGTGTTTTGTTTATTTACAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCCAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGA
  5   1   2       bld Neu                            TNeu003n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAACTCTATTCATAAACCGAATTACGTCTCAGAAAAATTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCA
  5   1   2       chi Te4       in                          CAAN717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAAAGAAAAATTTGAGAGAACCATGCCTCCAGGAGACAAAATGATAATACATCAGTCCTCTGAATTAATAAAAGGAAAGCAAAATGGGAATGGGTACGCTATGCTTCCTGCAAAGGGAATATTTTTTCAGAAACCAAGAGTGCCCAGGTCTTCCCACATGGAAGCACGAAAGCCGAGTGGAGCTTTAAATGCTGTTTCTGTAAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTATAATCGGATCATTTGGGAGGTGCAACCCCTTTCTGAATCCAGACTGGCAAACAAAGTTAATCATGCTCAAAGTGATAGAACTGAGCAAAGAAGTGTCAAGAGATGCTTACTTCAGAAACTTTACCCTTTGATGTGTAGGACCCAGCCCAGACATTGAGAAATGTCCCTGTTACACATTTATGACAAAATCACTGTAAATACTGCTAAAATCATGAAATTGAAAAAGTGGTCAGTAGAGAACTCTAAATTTAAAATTTTGTTATGTGAGTATAGTTCCCTTTAAATATTGAACGTATTTTTTTCAGGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCA
  5   1   2       bld TpA                            TTpA004c06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGTGGAGCTTTAATGCTGTTTCTGTAAACCGAATCATACTGTCACATCAGCTTATGAAAAGTCCTTTCCATTTAAGAACATTTCATGTTCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAGGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAA
  5   1   2       bld Gas       in                   TGas132e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGCTTCGTTGGCTGGTCCTTGTCGTCGAAGCCCTAAAAAAATACAGAGGCGCCTTCCCAGTACAGTTGAAGAAACAGTACGTGAAGAAGAAAAGGAAATATACAGGCAACTACTACAGGTGGTGACAGGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACT
  5   1   2       bld Gas                            TGas010p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACTACTACAGGTGGTGACAGNGAAAATCCTTCTTAGCCACCAAATCCACATCTGTTCTGCCTCCACAGGTGTCTAGATTAAGTTCAGATAACAGTATTTGCGGCCAGCCTATTGCTTCAAGTTTGAGTTCTCTAGAGCCAAGTAGTTTGGATACAGAATCTTCGTGTCGAACATCATTTAGCTACTTGCAGCCATCCGGTCAAATTTCAGAACCACTTCTAAGCAACTCAACAAATTACAAAGTAACTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGTTTGTTCCTACATCACAACAGTCTCAAGGTTCAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAGGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCA
  5   1   2       bld Te1       in                        CBWN16293.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATTCAGTCATTGTTTTAGATCCCGTTGTCAAACCTCAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAAGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGAC
  5   1   2       bld TpA       out                  TTpA044e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTACCAGGTCAAGTACCCACTAGTCAACCTTTTTTCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGAGCACGAGAAAGGAGGCGTCAAATTGAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCANATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCANCACANATGAATGGCAGTGATTGTGGAATGTTTGCCCTGCAGTATGCAGATTATATCACCNAAGATAAGTCTATTACCTTTACACAGCGTCATATG
  5   1   2       bld Gas       in                   TGas123j14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGAACAGAAGGCAGTTGCCTTAAAACTTCAGAAGCAGAGGCTTCAAGAATGTTCTGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAG
  5   1   2       bld Gas7      in                         XZG36743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAAGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGNNCATTTTGTTGGTGCAGCTTTGG
  5   1   2       bld Egg                            TEgg121l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCAAAAGCAAGAGGATGAATCCACCCAGTCTGAAGAGATTGAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAAT
  3   1   2       bld Te5       in                         CAAO9526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAGATGAAATTTCCTGAACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATG
  3   1   2       bld Egg  5g3  in                    TEgg045f04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTACAGAGGCTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTCTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTATTAAACACTATTTGCCAAATTTTTCTGATATTTTGTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                          CAAN717.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAGATTAAACGTGCTCTATTTGGTGGCAGCCAAGATCAAACTTTAAGTGAAGGGTACCGGTTAACAATTACACGGAAAGACATCATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATG
  5   1   2       bld Egg                            TEgg105e15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACA
  5   1   2       bld Egg                            TEgg105e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCATAGTTTAAACTGGCTAAATGATGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTACTGGTACCTATTCACCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCAATGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACAC
  3   1   2       bld Te1       in                        CBWN16293.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGATCATAAATTTCTATATGAATCTAATAATGGAACGAAGTAAACGGAAAGGCTTGCCAAAAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTAAAATTTGCTGGATATCAAGCAGTGAAAAGATGGACAAA
  3   1   2       bld Tad5      in                         XZT53801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCATCCTGTACTTTGATTCATGGGGCGGATTAAACAATGAAGCATGCAAAATACTGTTACAATACCTGAAACAGGAAAGCATTGATAAAAAAGGCGTAAGTTTTGACTCAAATGGTTGGACCCTTACCAGCAAGACAAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCTATTACCTTTACACAGCGTCATATGCCGTATTTCAGAAAGAAAATGGTTTGGGAGATCCTTCATCAAAAACTGCTTTGACATTAATATGGAGGGACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTCTGATATTTTGTTTAAAATAAAAAAAACCCTGGAGATCCATAGAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTTGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAACCTTTATATT
  3   1   2       bld Gas7 5g3  in                         XZG43575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGTGTTTAGCAGTTGTAGACTTTAGAAAAAAGTCCCTCCTGTACTTTGGTTCAATGGGGGGGTTAAACAATGAAGCCTGCAAAATACTGTTTCAATCCCTGAAACCGGAAAGCCTTGATAAAAAAGGGGTAAGTTTTGACTCAAATGGTTGGGCCCTTTCCCGCAAGACAAGGGGGGAAATCCCCCCACAAATGAATGGCCGGGATTGTGGAATGTTTGCCCGCAAGTATGCAGATTTTTTCCCCAAAGATAAGTTTTTTTCCTTTACCCAGCGTCATATGCCGTTTTTCAGAAAGAAAATGGTTTGGGGGATCCTTCCTCAAAAACTGCTTTGGCCTTAATATGGGGGGGCTTTTTGAAGCTTGGCAATTTTTTTGGTTGCAGCTTTGGCAAGTTTTTCAGGGCAGAACCCGGGCCCAGAACTTTTTGATTTTTCTCCCCTCGCGGGTTTACAACTGTAAAATAAAGCTTGGACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTTTGATATTTTGTTTAAAATAAAAAAAACCCCGGGGGTCCCTGGG
  5   1   2       bld Eye       in                         CCAX2510.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTCTGATATTTTGTTTAAAATAAAAAAAACCCTGGAGATCCATAGAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTTGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAACCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTC
  5   1   2       bld Gas7      in                         XZG59568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTTTGAAGCTTGGCAATTTTGTTGGTTGCAGCTTTGGCAAGTTTCTCAGAGCAGAACACGGACCAAGAACTATTTGATTTCTCTCCACTCGCAGGTTTACAACTGTAAAATAAAGCTTGTACTGTTATGAATTACTACTCTACTTATTTTTAAACATATTTGCCAAATTTTTCTGATATTTTGTTTAAAATAAAAAAAACCCTGGAGATCCATAGAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTTGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAACCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTTAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGNGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCCAGAGGCCCCCACATGGATGCACAGAAAAGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCT
  5   1   2       bld Egg                            TEgg125k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAAAACTATTTTATTTATATAACTGACAGGGCTCAGAAGCAAAAGAGCATTTTGTTCATTTTTGATATAAACTGTTTGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAACCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTG
  3   1   2       bld Egg       ?                     TEgg049i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAAAAGAGCATTTTGTTCATTTNTGATATAAACTGTNGGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAATCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGAACTGCCTAAAAATGGAAACTGCTTCCAGTATCTAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg045k21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGATATAAACTGTTGGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAATCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCG
  5   1   2       bld Egg                            TEgg080o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGATATAAACTGTTGGCATTGGACAGTTTACATTTGTTTTCTTAAGAGGCAAGCCTTCTGGCTCGATATTATAACAAAGGCATTGCCTTTTAAATAGATGTACCATTTGCAGCACTGATAGCTCTGTTCATGAGCTCTCATTTTGTACTTTGTAAAAACAAACTAAAATAAATCTTTATATTTACAAGAATGTAAACTTTTTTTAAACATATTATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTG
  5   1   2       bld TbA                            TTbA062n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGATTCCCCGGGATACTCACCTATGACACCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTT
  5   1   2       bld TbA       in                   TTbA071l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCGGGCCACAAATGGCTTGTTGAAGTTTTGTACAGCCTAAAAAAATATATATTATTTCTGGGATTTTGTATGTACTTCATTTTTCTTTTACAGATTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCANATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCA
  5   1   2       bld Gas       in                   TGas095g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTATTTTCAGCTGTGTAAAAGTTGTAGTTTAATAAGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGGTCACTTTAATGTTCACTTTGAACATTTGTAAAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCC
  3   1   2       bld Gas0                                 dad23c09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTGAGTTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTATCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATATGAAACTGTTCCCAGGTATCTAAAAAAAA
  5   1   2       bld Neu       in                   TNeu121l10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATATTTGTAGAATTTGTTTTCCCTGTAATTCAGTAGTGCATCTTCCAGGCTACCTCAATTTGTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGA
  3   1   2       bld Hrt1      in                         CAAQ3536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCTAAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATGCAGTTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAA
  3   1   2      seed Egg       in                    TEgg045k21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu                             TNeu116k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGAATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTAGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas123j14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGTAACTGGGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTGATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas132e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGACAAAATAAGGGTAATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA044c22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGACAAAATAAGGGTATCTTAACAGAGATGAATGTATTGCAGTTAAAAGTGCCTCCCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATATGAAACTGCTTCCAGGTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      in                          CAAP608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATGAATGTATTGCAGTTAAAAGTGCCTCNCAAGAGGCCCCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTC
  3   1   2       bld Gas7      in                         XZG59568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCACATGGATGCACAGAAAGGCAGCTTCTCTCTACGTTTGGCTTTATTTCATGATCTCTGGTTCCTTCTCTGGCGAAGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAAT
  3   1   2       bld Neu       in                    TNeu121l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGATGCACAGAAAGCAGCTCTCTCTACGTTGGCTTTATTCAGATCTCTGTTCCCTCTCTGGCGAAGGCTTGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCANTGTGTTTATATTGACTTTTTATATTTAAATAAACCGTCGACGC
  3   1   2       bld Gas7      in                         XZG36743.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGCTCGTGTCTGCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTNTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGCGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATGTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCAGTGAAT
  3   1   2       bld Gas       in                    TGas095g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAAATGCCTAGTGACAGAGAAGGCTAACAGAGGCAGCTTTACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FLsh in                    TEgg015h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTTACTTTCTCAAATAACACTTTGTTATATAGGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg009j21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTTCTCAAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCAGT
  3   1   2       bld Egg       in                    TEgg009j21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATAACACTTTGTTATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCCAGTGAATAACAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Egg                            TEgg095m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGAATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTAGTTGAAAAATTTATTTTATTTTATATCTTTCAGTGTGTTTATATTGACTTTTTATATTTAAATAAA
  5  -1   2       bld Egg                            TEgg095m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATATAGTGATCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAACCCCCCCCC
  3   1   2       bld TbA  5g3  in                    TTbA071k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTTATATCTTTTCTTCTAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACTTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATATCTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCAGTGAATAACAAAAAAGAAAAAAAAAAAGC
  3   1   2       bld TbA       in                    TTbA071l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTTATATCTTTTATTATAGCATAATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAACCCTCAAAATGTATCTTTGGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTTTCTCTATCCAATATTTTTCT
  3   1   2       bld Eye       in                         CCAX2510.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTATTAAAGTGATGTCACAAAAACCTTATGCACATTGTCTCTGTTATTATAGGTTTAGGGGGAAGAAATCTTAATCTATACATGTAACGGAGTATATCGTGTTCACTTTAATGTTCACGTTAAACATTTGTAGAGCACTTCCTAAAAATGTGAAACTGCTTCCAGTTATCTAAACAATTAAATAAAAAAGCCAAACCGAATTTGTCTTATAGTGAAGAGTCTAAACCCCCAAAAATTGTCTTTATTATAACCAGAGTGAGTATTGTATTGGATTCCCCAAATCATAAGCTGCCATTAGATCTTTAGAAACAGCATGGCCCACAGGAAGACAACTGCTTTTTGGTGGAGCAAATTCATGATAAACATCAGTTCAACAAACATGAGTTCATTCATTAAAAAATAGTTCTGTTCAGTAACTTGGACTAATAGATCAGGGAATGGAAACCCTCAAAATGTATCTTTGGATTTTTCTTATTGTATGGTTTTGTCTTTTTTTTTTTCTCTATCCATATTTTCTTACAGTGATGACTGTGGTTGAAAAATTTATTTTATTTTATTTTTTTCATGTGTTTATATTGACTTTTTATATTTAAATAAACCAGTGAATAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)