Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT59318.5                            5 END     1           2       20                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012076196 Xt7.1-TEgg038f17.3.5 - 39 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg038f17.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGACTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAA
                                                  Xt7.1-CHK-1008226850                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTxCCxxCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     4     2     4     2     4     2     5     2     7     2     7     3     8     5    10     5    10     5    10     6    11     6    11     6    11     6    12     7    14     7    14     9    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    13    13    13    13    13    12    14    12    14    12    14    12    14    12    14    12    14    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    12    10    13    10    13    10    13    10    13    10    12    10    12    10    12     9    11     9    11     9    10    10    11    10    11    10    11     8     9     8     9     8     9     7     8     7     8     6     7     8    10     8     9     9     9     9     9     9     9     9     9    11    11    15    15    15    15    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    19    19    19    19    19    19    19    19    18    18    18    18    15    16    16    16    16    17    16    17    16    17    16    17    16    17    17    18    17    18    17    18    17    18    15    17    15    17    16    17    16    17    16    17    16    17    16    19    16    19    16    18    16    19    16    19    16    19    16    19    15    18    16    18    16    18    16    18    15    18    16    18    16    18    16    18    16    18    18    18    16    18    16    18    16    18    16    18    13    16    12    15    12    15     2     2
  5   1   2  SIG                                    Xt7.1-TEgg032c03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGAGTTGCTACGCAGAAGCGGCTATGGCTGCAGAGACTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGCTACGTACAAGATCCAGAGAACTAGACTATCTTCACGACACAGTTGCAGAAACAGTAGCTTGCAGGTTTCTGATATCGCACCACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATAAGTGTTTTAAGAAATGGATAAAGACAGAAGTCAGAGCATTGNGAAAAGGGGTTC------------ATTGATCCTGAATATAGNACCCAAAACCTGATACAANGGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGA
  5   1   2  SIG                                    Xt7.1-TEgg038f17.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAAACAATTTCTCGCTCTTTAGCTTCCCAGCCTCCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTT
                                               BLH ATG     306    2032                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     306     230                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     306    1402                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     306     114                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sc ---- 1e-017     NP_014331.1 Fork Head homolog two; Fkh2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Cs ---- 4e-019     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 2e-020     BAD97361.1 forkhead protein FoxQ1 [Branchiostoma belcheri] ------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bf ---- 1e-022     AAC18392.1 transcription factor BF-1 [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 3e-021     NP_508644.1 ForKHead transcription factor family member (30.4 kD) (fkh-2) [Caenorhabditiselegans] ------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 1e-026     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] -------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-037     NP_511071.3 CG12690-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 4e-050     BAE06449.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 3e-059     XP_795496.2 PREDICTED: similar to forkhead transcription factor N2/3 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 3e-121     NP_001038728.1 hypothetical protein LOC692291 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_899009.2 checkpoint suppressor 1 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_005188.2 checkpoint suppressor 1 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 0          XP_421312.2 PREDICTED: similar to Checkpoint suppressor 1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001090178.1 forkhead box protein FoxN3a [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          CAJ38820.1 forkhead box protein FoxN3b [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          CAJ83827.1 checkpoint suppressor 1, foxn3 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg038f17.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAA------------------------ATG------------------------------TAG---------------------TGA------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------TAAATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------TAATGA---------------------------------------------------------------TGA------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2  SIG                                    Xt7.1-TEgg032c03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGAGTTGCTACGCAGAAGCGGCTATGGCTGCAGAGACTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGCTACGTACAAGATCCAGAGAACTAGACTATCTTCACGACACAGTTGCAGAAACAGTAGCTTGCAGGTTTCTGATATCGCACCACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATAAGTGTTTTAAGAAATGGATAAAGACAGAAGTCAGAGCATTGNGAAAAGGGGTTC------------ATTGATCCTGAATATAGNACCCAAAACCTGATACAANGGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGA
                                                  Xt7.1-CHK-1008291156                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCTACGCAGAAGCGGCTATGGCTGCAGAGACTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGCTACGTACAAGATCCAGAGAACTAGACTATCTTCACGACACAGTTGCAGAAACAGTAGCTTGCAGGTTTCTGATATCGCACCACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATCCTTAATAAGTGTTTTAAGAAATGGATAAAGACAGAAGTCAGAGCATTGNGAAAAGGGGTTCTCTATG------------CCTGAATATAGNACCCAAAACCTGATACAANGGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATT
  5   1   2       ext Egg  5g                        TEgg097k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGAGTTGCTACGCAGAAGCGGCTATGGCTGCAGAGACTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGCTACGTACAAGATCCAGAGAACTAGACTATCTTCACGACACAGTTGCAGAAACAGTAGCTTGCAGGTTTCTGATATCGCACCACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACAT
  5   1   4      seed Egg  5x3  in                   TEgg032c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGACTCGGCAGAGGTCTTTACCAGCAGGCAGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGCTACGTACAAGATCCAGAGAACTAGACTATCTTCACGACACAGTTGCAGAAACAGTAGCTTGCAGGTTTCTGATATCGCACCACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCCTCTTCACCTGCTCAGT
  5   1   2       ext Neu                            TNeu009i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCTATCCTTAATAAGTGTTTTAAGAAATGGATAAAGACAGAAGTCAGAGCATTGNGAAAAGGGGTTCTCTATGGTGCNNATTGATCCTGAATATAGNACCCAAAACCTGATACAANGGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAG
  3   1   4      seed Egg  5x3  in                    TEgg032c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TEgg038f17.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAAACAATTTCTCGCTCTTTAGCTTCCCAGCCTCCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAA
                                                  Xt7.1-CHK-1008291158                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATTTCTCGCTCTTTAGCTTCCCAGCCTCCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGAC
  0   1   1           Spl1 FL                          CABK9590.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGATCCCGACATTGATGCTGCTTCTGCCATGATGCTATTGAATTCTGCCCATGAGTTACAAGCAGGTTTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas136a14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAAAAA
  3  -1   2       add Int1      in                        CAAP11704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCTTGCACCCCTACCTTGTCGCCCAGCCCGGATCTACTTGCTTGGACCTGGCCTTTTCTCAAAGGGATCAGCAGGAGGACTTCAAGTCTCAGTGGAGCGTTTGAAATCTTTAATCTGTGCGGAAGGGAGTTGTGCCACATAGGAATATACCTTTCCCGGAGGAGTCTCAGGAATTGGCTACCACTTCCGGGATTCTTGTCTTAGCGCAAATGCCCAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCCTTAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCA
  5   1   4      seed Egg  5g3  in                   TEgg038f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTCCCCTCTGGGCATGTGTGGCTTTTTGTTTGCAGTGGAAACAATTTCTCGCTCTTTAGCTTCCCAGCCTCCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACT
  5   1   2   14  ext Brn4 5g3  in                        CAAL10663.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGAAACAATTTCTCGCTCTTTAGCTTCCCAGCCTCCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATC
  5   1   2       add Spl1 FL   in                         CABK9590.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTTTAGGATGGCACGAATAACTGTGGGGATATAGGCAGCAGCTTATGCCCGAGAGAGGGTGGCACAGAAAGAAACAGTAGGGTATACCTAGGAGTGCTTGGTGACCTTCTTCAAGTTCTGAAATAAGTCCCAGCCTGCAAGTTTAAAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATAT
  5   1   2   12  add Gas7 5g3  in                         XZG46050.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTTCGAATTCGTCGACCCACGCGTCCGGGAAGTCATCCGATCCACCCTGGGATCGTTTTGGGAAGGGTTAATGGGCAAGTGATCGTCCGTGATCTGCTAACTGATCGCCGACTGACAACTCTAAACTTCATAGGTTTATCCAGCTGGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCAC
  5   1   3   12   nb Gas7 PIPE in                         XZG40857.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCCTCCCCCCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCCTGATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTTCACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCT
  5   1   3   12   nb Gas7 5g3  in                         XZG29994.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTAATCCTTAAAATAAGTGTTTTAAGAAAGTGGATAAGGACAGAAGTCAGAGCATTGGAAAAG
  5   1   3   10   nb Spl2 5g3  in                        CBSS1231.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCCTCCCTCTCCCCTCCCCACTGCGCTCCGGGCTGGCACAAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTC
  3  -1   3        nb Int1      in                         CAAP2124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCCACGTGTCCGGTGCCCGCGGGCTGGCAAACTTTGTCGGATCATGACGGCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTC
  5   1   2       add Gas  5g                        TGas027e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAGGAATTGGCTACCACTTCCGGGATTCTTGTCTTAGCGCAAATGCCCAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTG
  5   1   2   14  add Brn4 5g3  in                        CAAL22653.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGCACCACTGGACAGGCAGCACCCACTGTACTGAGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCACGAGAGCAAGAATTTGCTTAAAAGTTTTGGGGACACTGTCTTACGAAGTGTCAGTCCAGTTCAGGACATTGATGATGACACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGGAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTNCAAGTG
  5   1   3        nb Gas  FL   in                   TGas136a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGGGGAAGGGCTGAACTTTCCACTGCAGGAGTCTTTGCCTAAATGGGTCCAATCATGCCTCCTAGTAAGAAGCCAGAGAGCACAGGAATAAGTGTTTCTAGCCAGTGTTACAGGAGTAGCACTTTATCCAACCCACTCCACGATGATGATGACTTAGACTTTCCACCACCTGCTGTGAAAATCAATAAAGAGAAGGGGGAATGGAAGATGAGGAACTAACAAATTTGAACTGGTTGCA
  5   1   2       add Gas7      in                         XZG49162.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCCCTCCTTCACCTGCTCAGTCAGACATGCCCTATGACGCTAAGCAGAACCCAAACTGCAAACCCCCATATTCTTTCAGTTGTCTCATATTTATGGCCATCGAGGACTCTCCCACCAAGAGACTGCCAGTAAAGGATATTTACAACTGGATCCTAGAACACTTTCCTTACTTTGCCAATGCTCCAACGGGTTGGAAGAACTCTGTCAGGCATAATCTATCCTTAAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGATCCCGACATTGATGCTGCTTCTGCCATGATGCTATTGAATTCTGCCCATGAGTTACAAGCAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTC
  5   1   3        nb Neu                            TNeu022j17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATCCTTAATAAGTGTTTTAAGAAAGTGGATAAAGACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGAC
  5   1   2       ext Gas7      in                         XZG50426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACAGAAGTCAGAGCATTGGAAAAGGTTCTCTATGGTGCATTGATCCTGAATATAGACAAAACCTGATACAAGCCTTGAAAAAGACCCCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGTTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGG
  5   1   3        nb Te1       in                        CBWN12513.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTATCACCCCTACTCACATGTTTTCAACACCCCACCCACATCTCCTCAGGCATATCAAAGCACATCAGTCCCACCCCTCTGGCCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACTGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACATAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTTCCTCTGAAAAAGAGACGCACAGAAGAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCG
  3   1   4      seed Egg  5g3  in                    TEgg038f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGGAAGCACCTTCTTTAAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTCCGACGAAAAAAAAAAAAAAAAA
  5  -1   3        nb Int1      in                         CAAP2124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGAAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTGNAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATA
  3   1   3        nb Gas  FL   in                    TGas136a14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAAGAATGGAGCCTTGCTCCAAGTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTCCGAC
  3   1   3        nb Gas7 5g3  in                         XZG29994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCCATGAGTTACAAGCAGGTTTGCCTCCTGGTGTGATACAAAATGGAGCCAGAGTGTTGAACAGAGGAATCTTCTCTGGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAAAAAAAAAAAGG
  3   1   2       add Spl1 FL   in                         CABK9590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGGATTGAAGCCATAGAACTCAGCTAACATTTTCCGAC
  3   1   2       ext Gas7      in                         XZG50426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGTTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAAGG
  3   1   2       ext Brn4 5g3  in                        CAAL10663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACG
  3   1   0       chi Gas7      in                         XZG49162.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTCCGACCTTTGCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAAGG
  3   1   2       add Brn4 5g3  in                        CAAL22653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGACCTTTGCCCAATTAATCCTATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACG
  5  -1   2       add Int1      in                        CAAP11704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACCTTGCCAATTAATCCTATTGGAGCAATGGCTGCNTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATT
  3   1   3        nb Spl2 5g3  in                        CBSS1231.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGGAGCAATGGCTGCCTCAGTCAGAAATGGCATTGCAAATTGCCGAACGCGGATGGAGAGTGAGCCGTCGTGTGGATCCCCCTTAGTTAGCAGTGACCCCAAAGATGACCACAATTACAGCAGCGCCAAATCTGCTAACAAGAGGAGCTCATCGCCCAGTGACTCCATATCGTCCTCCTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGAC
  3   1   3        nb Gas7 PIPE in                         XZG40857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCCTCCTTTGCCGAGGATCCCTATGAATTTGCAGCCAAAGTTTGCCGGGAAGGCAGGGATATTAGCTTCCAGAGCCATGAGAGTTTCCGTGGGCCCGGGGAAGGGGGCCAGAAACCGATAAAGAAGGGGTTGGAGGGTTCCCTGGTTGAAAGGGGGTACTCCTCCCCACCCAAGAAAAAGCAGCCTTTTCTAAAACTTTGGGGGGTCCCCAGGGATGCCCTTCCTTTGAAAAAGGGACGCCCAGAAAAACCCCCTTAGAGTGATGATGAAGAGATGAAAGAGGCCCCTGGGTTTTTTTTGCATTTGGCAGGAATCCGCTTTTGTTTGAATAACATCCCCAATCGGGCGGGTAAGGGGCAGAAAGAGCAAAAGGACAAAGAAACCCCAAAAAATTAGGGCAAATCAAATATATGTTTGGGTTTTAAAACCATTTTTTTCAGCCCGTCAGGGGAATTTTAAAGATTTTGGGGCAAAATCAACAATTTTTTCCCCTTTATTTTTATTTTGGGGTTTTTTTTGGACCCCTGAAAAGTTTTTTTTTTAAAGGGGAT
  3   1   3        nb Te1       in                        CBWN12513.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCTGCCGATGATCACTATGAATTTGCAGCCAAAGTCTGCCGAGAAGGCAGTGATATCAGCTTCCAGAGCCATGAGAGCTTCAGTGAGACAGAGGAAGAGGACAAGAAACAGATAAAGAAGGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCAACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu039j23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAGACAGAAACGATAAAGAAGAGTTGAAGGATTCCCTGGTTGAAAGCGGCTACTCCTCCCANACACAAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAANAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACG
  5  -1   3        nb Gas                            TGas113f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAAAAAGCAGCATTTACTAAAACTTCGGAGGATCCCCAGTGATGCCCTTCCTCTGAAAAAGAGACGCACAGAAAAACCACCTGAGAGTGATGATGAAGAGATGAAAGAGGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAA
  5  -1   2       ext TpA       in                   TTpA053n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCGCTGGGTCTCTCTTGCATTTGGCAGGAATCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAAACCCGGG
  3  -1   2       ext TpA       in                    TTpA053n22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTCTTGCATTTGGCAGGAATNNCCGCTCTTGTTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACG
  5   1   2       ext Gas7      out                        XZG19702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGAATAACATCACCAATCGGACGGCTAAGGGACAGAAAGAGCAAAAGGACAAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCGACGAAAAAAAAAAAAAAAACCTAAAAAATTTCAAAAGCCAAAATCACCTTCACTCTCAACTGCTCTCCAGGAAGGAATACATGGTTTATCTTGTCTCAGTGACAACAACCTGTTTAAGAAGGGAATTGGCACGTTCTAGGATGGGGGGGGGGCATACCTCAGATATTTCCTGGCTGTCATATCCTGTGTAACATTGTGCACACCACAGATAGCAGTCGGCCACCATCACTTACATAAAAACAAATGAAGCCCTGTGCCAAATGTGTGCTGAATAAGCCCAGAAAATGATCACTTTTGCCACTGTATGATACATATTTTTGTGTAGAACTGAAAATCTTGC
  3   1   2       add Gas7 5g3  in                         XZG46050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACAGAAAGAGCAAAAGGACAAGAAACCACAAAAAATTAGTGCAAATCATATATATGTTTGGATTTTAAAACCATTTCTTTCAGCACGTCAGGTGAATTCTAATGATTTTGTGGCAATATCAACAATTTTTTCCCCTTTATTTTTATTTTGGTGTTTCTTTTGGACCCTTGAAATGTTTATTTTTTAAAGGAGATTGAAGCCATAGAACTCAGCTAACATTTTCCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)