Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012076225 Xt7.1-CABE11524.3 - 41 ESTs
                                                                       .-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE11524.3                                                                                                                                                        CTCCATTCTAACATCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCCTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACTATCGAGAATGCTTGGGATCTTGGGGTTTTCCAGATAAGGGGTCTTTCCGTAATTTGGATCTACATAACTTAAATCTAATAAATATCATTTAGGGCGAAGATAGATGGGGTGATTAGTGATTTTTTTAAAACCCGTTCACAGCGCTGGAACAGCAACTAATCTCTGTGCACAAGTACAGTGGGGAATTAGTCATCACGACTAGATATTAAGAATTGCACCGACTAATCACCCTGCCTTCGAACTTAAACATTAAAGAAACCCAATAGGATTGTTTTGCAACCAGTAAGGATAAATTATGTCTTGGTCGGGATCAAGTACAAGGTACTGTTTAATAATCACAGTGAAAAAGGAAATCATTTTTAAATATGATTTCATTAAAATTATACAGGTTTTCCAGATAACCGATCCTATACCTGTATTTTTTTAGTGTAAAATGTGCTGATTTTCTGTATCTGATATATTTGTAAACAATATTGACATTGATATTTAATTGAAGAATCACACAAGATAAAACCTG
                                                  Xt7.1-CHK-1008226703                                                                                                                                                              TCTAACATCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCCTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACTATCGAGAATGCTTGGGATCTTGGGGTTTTCCAGATAAGGGGTCTTTCCGTAATTTGGATCTACATAACTTAAATCTAATAAATATCATTTAGGGCGAAGATAGATGGGGTGATTAGTGATTTTTTTAAAACCCGTTCACAGCGCTGGAACAGCAACTAATCTCTGTGCACAAGTACAGTGGGGAATTAGTCATCACGACTAGATATTAAGAATTGCACCGACTAATCACCCTGCCTTCGAACTTAAACATTAAAGAAACCCAATAGGATTGTTTTGCAACCAGTAAGGATAAATTATGTCTTGGTCGGGATCAAGTACAAGGTACTGTTTAATAATCACAGTGAAAAAGGAAATCATTTTTAAATATGATTTCATTAAAATTATACAGGTTTTCCAGATAACCGATCCTATACCTGTATTTTTTTAGTGTAAAATGTGCTGATTTTCTGTATCTGATATATTTGTAAACAATATTGACATTGATATTTAATTGAAGAATCACACAAGATAAAACCTGTTGATG
                                                      consensus depths                                                                                                                                                             2     2     2     3     3     5     5     6     6     8     7     9     8    10    11    11    11    11    11    12    11    12    11    12    11    12    11    12    12    12    12    12    13    13    13    13    13    13    13    13    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    15    17    15    17    15    17    15    17    15    17    16    18    16    18    17    19    17    19    16    18    16    18    16    18    16    18    16    20    15    19    15    19    13    17    13    17    13    17    14    17    14    17    14    17    15    20    16    20    18    21    19    22    18    22    18    22    18    22    18    21    18    21    18    21    18    20    16    18    16    18    16    18    16    18    15    19    15    19    15    19    13    17    12    15    13    15    15    17    16    18    17    19    17    19    17    19    19    21    18    20    19    21    18    21    17    21    19    20    19    20    19    20    19    20    19    20    18    19    18    19    18    19    18    19    17    19    18    19    18    19    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    19    17    18    17    17    17    17    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    11    14    10    12     8    10     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     8     8     8     8    10    10    10    10     9     9     9     9     7     7     7     7     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --AT--------
                                               BLH ATG      41    1234                                                                                                                                                        
                                               BLH MIN      29     207                                                                                                                                                        
                                               BLH OVR      41     204                                                                                                                                                        
                                               EST CLI      19       1                                                                                                                                                        
                                               ORF LNG      41      21                                                                                                                                                        
                                                                                                                                                                                                                                                                                         PROTEIN -== Ce ==== 5e-009     NP_001022134.1 F32A5.1b [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Sc ---- 7e-055     NP_010736.1 transcription factor, member of ADA and SAGA, two transcriptional adaptor/HAT(histone acetyltransferase)complexes; Ada2p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-061     NP_001014637.1 CG33520-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                  PREDICTED - Sp ---- 2e-116     XP_781190.2 PREDICTED: similar to transcriptional adaptor 2 (ADA2 homolog, yeast)-like [Strongylocentrotus purpuratus] ---------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 2e-129     AAH79985.1 MGC81519 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 2e-129     NP_001087477.1 MGC81519 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED = Dr ==== 0          NP_001070609.1 hypothetical protein LOC555494 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 0          NP_001012825.1 similar to Transcriptional adapter 2-like (ADA2-like protein) (KL04P) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_766150.1 transcriptional adaptor 2 (ADA2 homolog, yeast)-like [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_001479.3 transcriptional adaptor 2-like isoform a [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          AAH80357.1 Transcriptional adaptor 2 (ADA2 homolog, yeast)-like [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE11524.3                                                                                                                                                                TAA------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------ATG------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TAA---------TGA---------------------------------------------------------------------------------TGAATG---ATG---------------------------------------------------------------TAA---TAG---------------------------------TAA------------------------------------------------------TGA------------------------------------------TGA---------------------------------------------------------------------------TGA------------------------------------------------ATG---------------TAA------------------TAG------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAATAG---------------------------------------------------------------------------TAA---TAATAA---------------------------------------------------------------------------TAA---------------------------TAG---------------------------------TAA------------------TAA------------------------------------------------------------------------------------------------------------------TAA---TGA------TAA---------------------------------------------------TAA---------------------TGA------------------TGA---TGA
                                                                   ORF                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           Tad0 FL                     IMAGE:6982123.FL-MGC                                                                                                                                                        CTCCATTCTAACATCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu046e21.FL-Sanger                                                                                                                                                                    CCCGGGGAATCCCCGGGGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCGCCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCTTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACTATCGAGAATGCTTGGGATCTTGGGGTTTTCCAGATAAGGGGTCTTTCCGTAATTTGGATCTACATAACTTAAATCTAATAAATATCATTTAGGGCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g3  in                   TGas074c17.p1kSP6                                                                                                                                              TCAGAGCCGCCTCCATTCTAACATCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATG
  5   1   2       bld Tad0 FL   in                       IMAGE:6982123                                                                                                                                                        CTCCATTCTAACATCTACCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTANGAAATTTTCAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAAATGAGGAGATTTGCCAAGGATATTTGGGGCCATATGAACACNGACAAATTTCATTGAAAAGTCATTGCACTGN
  5   1   2       chi Spl1 5x3  in                         CABK1551.5p                                                                                                                                                              CATCGATTCGCCAGCGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCTCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCGTATGTAAACCAAATAATGATACTCCCACAAACAAAAGTAGTAGGCTTTTTTTACCTTGTATAGCATATTCTACTGTCAATACCATACTTTTTGCTTCTCTTTTATTATGTTTGATGAAGTAATCTTAGACTGTTTTCCAGCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAG
  5   1   2       bld Neu  FL                        TNeu046e21.p1kSP6                                                                                                                                                                           AATCCCCGGGGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCA
  5   1   2   12  bld Gas7 5g3  in                         XZG49423.5p ............................................................................................................................................................................CGTGGAAAGAAAGGAAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGNAGTATGAACTC
  5   1   2       bld TbA  5g3  in                   TTbA033h20.p1kSP6                                                                                                                                                                                           AAAGCAATGGACCGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACT
  5   1   2   23  bld Gas7 5g                              XZG13823.5p .............................................................................................................................................................................................GCATGGACCGGCTAGCACCATATGGGAGTGATCCNCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGANAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCANATTTTAGAACGACGGTATCCCAAGCATGTCCNAGAGCTTTATGAANGCATGAGGAGATTTGCCCAGGAT
  5   1   2       bld Egg                            TEgg133f20.p1kSP6                                                                                                                                                                                                       CGGCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTG
  5   1   2       bld Ova1      in                        CABE11524.5p                                                                                                                                                                                                         GCTAGCACCATATGGGAGTGATCCCTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGNGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGA
  5   1   2       bld Ova1      in                        CABE11438.5p                                                                                                                                                                                                                              ATCCCTTTGACAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGNAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAACATTTTGCAGTGCAAAATATATGACCATCTAAAAAAGACTCGTGA
  5   1   2       bld Ova1      in                         CABE2637.5p                                                                                                                                                                                                                                 CTTTGACAAACCACCCTGCAAAGGGTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTACAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAGACTCGTGA
  5   1   2       bld TbA       in                   TTbA079c24.p1kSP6                                                                                                                                                                                                                                                          GTGTTCATCATATCTCATGGAACCATACATTAAATGTGCTGAATGTGGACCTCCTGAATTTCTTCTGTGTTTAAGTGCTTCTCAAGAGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATTCAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAA
  5   1   2       bld Ova1      in                        CABE11356.5p                                                                                                                                                                                                                                                                                                                                                AGGATTTGAATATAAAAAGCACCAAAGTGATCATAGCTATGAGATCCTGACTTCAGATTTTCCCATCCTAGATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAAATCAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGA
  5   1   2       bld HdA       in                   THdA046e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                              CTGACTTCACATTTTCCCATCCTAGATCCTAGCTGGACAGCTCAAGAAGAAATGTCGCTTATTGAAGCAGAAATGGATTGTGAATTGGAAAACTGGCAAGATGTACCCGATCAAATGCGGACAAAGACGAACGACGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACAATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCATAGGACGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGATATATGGCACGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACG
  5   1   2       chi Gas7                                  XZG8754.5p                                                                                                                                                                                                                                                                                                                                                                                                                      GATCCGAGCTGGACAGCTCAAGAAGAAATGTCACTTCTTGAAGCAGTAATGGATTGTGGATTTGGAAACTGGCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGGTAAATACATTGTAACATCATTAATATGTTTTTTGTCATAATTAATTTGTTATAGGAGTATGGGTAATGTGTTAGAGGATTGAGAGTAATACCACACACACAATAGTTTGTTGTCTGTAGTAAATCTATGCTACCACAGGCAACAAGACATCCCTATTCTATCTCATTGTCGGTAGTGCAGATTTGCCGTGAGCAACATAACATCCCATGTACCATTGTCCTAATTAAACTGATCAGATAAGTGTCAATAGACTCTTACAGCTTTGGTGAAATTAGCTTTTGCCATTCTCCCTGGGGCTACCAGTAGGTAGCGCTCAGGTCTCGCTTCATGACAATAGTAGTTTAAGAACTGCACATATGANATTGAAGAAGCAGANAGAGCTCTCTGAGCAGTTTAGTATAATGTTTTACTTGGGCTTTATGTCCCTTTTAAGCACCACACATACATCCATATTATATTGCCTTTTACCCAGCAGTAAAT
  5   1   2       bld Ova1      in                        CABE13797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAGATGTAGCCAATCAGATGCGGACAAAGACAAAGGAGGACTGTGAAAAACACTACATGAAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAAATGAT
  5   1   2       bld Ova1      in                        CABE11986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATACTTTATCAACAACCCACTATTTGCAAGCACCTTGCTGAATCTGAAGCAAGCAGAGGAGGAAATGAATATGGACACAGCTGTTCCATTTCATCCTGCAGAAGACCCACCAAGACCAACTTTTGACTCTCTCTTGTCCAGAGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCTCAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAAATACAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGA
  3   1   2       chi Spl1 5x3  in                         CABK1551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATATGGCAGGATATATGCCTGCTCGTGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGGTATGTGTGTATCCTTTGTTATAGGGTAAAATGAGACCTATAAAATCAAATATAAATATATATAGTTTTTTTTACCGTGAGATTTTGTCAGTACAGGTATGGAATCAGTTATCCTAAAAGCTCTAAATTACAGGAAGGCCGTCTAAAAAAAATTTTAAAAAATGATTCCCTTTTTAATCCTTATCCTTTTTAATCCTTATTAGAGGCAAAACAAAATTGAGTTTGAACTCTCAAATATAAATATGGATATCCAGGTATGGAGTATTCATTCTGGGGGTATAGTTTTCCTTTAAAGGACAAGGACAGTGCAACAAAGAGTTAATCTCCATAAAGAGAGACAGTGGAtttcaatcggattcagatctgggctctggctgtgccattccaaaactttaatcttcttccggtgaagccattcctttgttgatttggatgtatgctttgggtccttgtcatgctgaaagatgaagttcctcctcatgttcagctttctagcagaagcctaaaggttttgtgccaatattgactggtatttggaactgttcataattccctctatcttaactaaggccccagttccagctgaagaaaaacagcTAAATATATACAAAGTTCATTTTGGTGCCTTTAGCATTAAAATATAACTTTTAATTCATACCATTAAAAAGAGAATCAATGTCTCATTAAAACNGGGGCCCACTAG
  5   1   2       bld Lun1      in                         CABD8371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGGATTTCATTGAGGAGTTTGATAACTATGCTGAATGGGACTTAAGAGATATCGATTTTGTTGAGGATGATTCTGATATTTTGCATGCTCTGAAAATCTCTGTTGTAGATATATATCATTCACGGTTAAAGGAAAGGCAGAGAAGGAAAAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCANAATAGATGTTAATAAGACTCGTANAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCCATATGGAGACCATGAACAAATTCTGANNCACTTCACATTGTGGCATCAATAATATTTATTTCTG
  5   1   2       bld Tad5      in                         XZT22040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGTCAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATANAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGT
  5   1   2       bld Tad5      in                         XZT22131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGTCAGAATTATAAGAGAGCATGGCCTTATAAATCTTAGGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCA
  3   1   2       bld Gas  5g3  in                    TGas074c17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGAAATTTCAAATTTTAGAACGACGGTATCNCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTGGACAATTAAAGTTAAAAAAAAAAAAAAAAA
  3   1   2      seed Ova1      in                        CABE11524.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGAAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACT
  3   1   2       bld HdA       in                    THdA046e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAATTTCAAATTTTAGAACGACGGTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTGGACAATTAAAGTTTAACTTAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Lun1      in                         CABD8371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTATCCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTGGACAATTAAAAGTTTAAACTT
  3   1   2       bld Ova1      in                        CABE11438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAAGCATGTCCAAGAGCTTTATGAAGCAATGAGGAGATTTGCCAGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTAC
  3   1   2       bld Gas7 5g3  in                         XZG49423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGATATTGGGGCCATATGAACACGACAAATTCATTGAAAGTCATGCACTGGAGTATGAACTCCGCAGAGAGATCAAGCGATTACAGGAGTACAGAAATACAGGAATCAAAACATTTTGCAGTGCAAAAATATATGACCATCTAAAAAAGACTCGTGAAGAGGAGAGGTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad0 FL   in                       IMAGE:6982123                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAAAACATTTTTGCAAGTGCAAAAAATATATGACCCATCTAAAAAAGACTCTGAAAGAGGAGAGGTTTGAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCNCCCTCTGGTTCTAGTTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTGCACTCT
  5   1   2       bld Tbd1      in                        CBXT19911.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGCGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCAT
  5   1   2       bld Neu       in                   TNeu066p20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAACAATGCTGTCTGAAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTC
  3   1   2       bld Ova1      in                        CABE13797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTGCTTAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATGATTTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCT
  3   1   2       bld Neu       in                    TNeu066p20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATTGTATCCATGATGGGAATGCCTGCCACCAGTGGCTTAAACGACAAGCTGCCATTGATTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTTTACCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT22040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACGACAAGCTGCCATGATTTCAGGAGTACATCATGTCCCCCCTCTGGTTCTAGTTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAG
  3   1   2       bld Ova1      in                         CABE2637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACGACAAGCTGCCATGATTTCAGGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATT
  3   1   2       bld Tad5      in                         XZT22131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGTACATCATGTCCCCCCTCTGGTTTCTAGTTCAGGTCGCCGTAGTGCCCCACCCCTAGACTTAACAGGACTCCCTGGCACTGAGAAGCTGAATGATAAAGAAAAGGAGTTATGCCAAGTGGTGAGGTTGGTTCCAGGTGCCTATCTAGAATACAAAGCAGCCTTAATGCATGAGTGTACCAAGCAAGGAAGCCTTCGCCTGGCACAGGCTCGAGCACTTATCAAAATAGATGTTAATAAGACTCGTAAAATTTATGATTTTCTTATACGCGAAGGATATATCATAAAACCTCAGCCATAATGGAGACCATGAACAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAG
  3   1   2       bld Tbd1      in                        CBXT19911.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAATTCTGACAACTTCAACATTGTGGCATCAATAATATTTATTTCTGGAACCGTCAGTAGAACAAATAGTTTGCCTGGATGAATGGTGATGTCTTGTCAGTGTGTACTGTGTTTGCATTGTACCATTCCAGCTTCAGACAACTTCTGTGTGTTGTAACCTTAGTCAGCTGCAAAACTGTTTGGACAATTAAAAGTTTAAACTTACCTTTGCTGTCCAACAGTTGTTTGGAGACCCACTACGTTTATAAAATATTGATACAACACTACTATTTTTCAAAGGCTTAACCAGAACAGAAGATGAACACTTAAACCAAGTCTCACCCTAGGCCATCAGTTTGGAGCCACCCTCTACCAGTGCGTAACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCCTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACTATCGAGAATGCTTGGGATCTTGGGGTTTTCCAGATAAGGGGTCTTTCCGTAATTTGGATCTACATAACTTAAATCTAATAAATATCATTTAGGGCGAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE11986.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCCCAATGAGCAATGAAATTATGGGCCATTTCAACATTGTCTTACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCCTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACtatcgagaatgcttgggatcttggggttttccagataaggggtctttccgtaatttggatctacataacttaaatctaataaatatcatttaGGGCGAAGATAGATGGGGTGATTAGTGATTTTTTTAAAACCCGTTCACAGCGCTGGAACAGCAACTAATCTCTGTGCACAAGTACAGTGGGGAATTAGTCATCACGACTAGATATTAAGAATTGCACCGACTAATCACCCTGCCTTCGAACttaaacattaaagaaacccaataggattgttttgcaaccaatgaggataaattgtatcttggtcgggatcaagtacaaggtactgtttggtaatcgcagtgaaaaaggaaatcatttttaaaTATGATTTCATTAAAATTATACAGGTTTTCCAGATAACCGATCCTATACCTGTATTTTTTTAGTGTAAAATGTGCTGATTTTCTGTATCTGATATATTTGTAAACAATATTGACATTGATATTTAATTGAAGAATCACACAAGATAAAACCTGTTGATGG
  3   1   2       bld Ova1      in                        CABE11356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCCTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACtatcgagaatgcttgggatcttggggttttccagatggggggtctttccgtgatttggatctACATAACTTAAATCTAATAAATATCATTTAGGGCGAAGATAGATGGGGTGATTAGTGATTTTTTTAAAACCCGTTCACAGCGCTGGAACAGCAACTAATCTCTGTGCACAAGTACAGTGGGGAATTAGTCATCACGACTAGATATTAAGAATTGCACCGACTAATCACCCTGCCTTCGAACttaaacattaaagaaacccaataggattgttttgcaaccagtaaggataaattatgtcttggtcgggatcaagtacaaggtactgtttaataatcacagtgaaaaaggaaatcatttttaaatatgATTTCATTAAAATTATACAGGTTTTCCAGATAACCGATCCTATACCTGTATTTTTTTAGTGTAAAATGTGCTGATTTTCTGTATCTGATATATTTGTAAACAATATTGACATTGATATTTAATTGAAGAATCACACAAGATAAAACCTGTTGATGG
  3   1   2       bld TbA       in                    TTbA079c24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCAGTCCACCTGCATTTCATGTATTTTGCACTCTCATAATACATTTTTAGAAATAAATAGGTGTATGTTATTACCTACATGTTCAAACACATCACTTCTCCTCAGAGACCTAGATCTAGTAACGGCAGGAGCTTATTTCCATGCAGCTATTGTCTCCACAAGTTGTATTACTGCTTTCAAATGCTATCTGTCTGGTCAGTACTGAAATCTGTTACATCTTCTAAGTGCACTCCTAAATATTATGCCTTGCTATGGTACTACTAATAGACTACtatcgagaatgcttgggatcttggggttttccagataaggggtctttccgtaatttggatctacataacttaaatttaataaaTATCATTTAGGGCGAAGATAGATGGGGTGATTAGTGATTTTTTTAAAACCCGTTCACAGCGCTGGAACAGCAACTAATTTTTGTGCACAAGTACAGTGGGGAATTAGTCATCACGACTAGATATTAAGAATTGCACCGACTAATCACCCTGCCTTCGAACTTAAACATTAAAAAAAAcccaataggattgttttgcaaccaataaggataaattatattttagtcgggatcaagtacaaggtactgtttaataatcacagtgaaaaaggaaatcatttttaAATATGATTTCATTAAAATTATACAGGTTTTCCAGATAACCGATCCTATACCTGTATTTTTTTAGTGTAAAATGTGCTGATTTTCTGTATTTGATATATTTGTAAACAATATTGACATTGATATTTAATTGAAGAATCACACAAGATAAAACCTGTTGATGGAAAAAAAAAAAAAAAAAAAAAAAGC
  5  -1   2      shim Gas7                                 XZG49574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCgggatcaagtacaaggtactgtttaataatcacagtgaaaaaggaaatcatttttaaatatgATTTCATTAAAATTATACAGGTTTTCCAGATAACCGATCCTATACCTGTATTTTTTTAGTGTAAAATGTGCTGATTTTCTGTATCTGATATATTTGTAAACAATATTGACATTGATATTTAATTGAAGAATCACACAAGATAAAACCTGTTGATTGGATATTATTTTGCTGAAGTTATTGTTTGAGCATGTTGATAGACATTCCTCTCTTAGATTTGTACATAGCAGTATTGCTTGTACAAGCAGACCTTTGCTTATGTATTGCATTGTAATATGTAAGCATTGTTAAAAAACAAATGTAAATCCAAGCACATGCTTTCAGCAAACAAGACTACTGTAGTAAAATATCACTCTGATAGAAATATGGAAGATTTAAGTGCCAACTGGGGGTATATTATATTTTTCTGCACATTCAGCATTTACATTTTTGCTGTCAGAAACCTTATAAACTACAAAAATTTTATGGGGAGGGTTGGTGGCAACCTGCC
  3   1   0       add TbA  5g3  in                    TTbA033h20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATAGAAATATGGAAGATTTAAGTGCCAACTGGGGGTATATTATATTTTTTTGCACATTCAGCATTTACATTTTTGCTGTCAGAAACCTTATAAACTACAAAAATTTTATGGGGAGGGTTGGTGGCAACCTGCCTAAATTCAGGCTTAAAGCAAAAGTAACACTAAAATAGTGTAAAAAGTAAAAAAGctattttaccctgcaccaataaatgccctatcctgcaaaccacttagtaatagaaaatacctgctaaaacttggcttcctgtcaattgaattacggcatatttgcaaagaaaggagcagcaatcactatgcgacgaactatggatcgagcctagccttttttttgtataggaaggagtcaggctaagctcgatcaatcgatTGTCGATTTAGTGTTACATTTCCTTTAAGATTAGACCGTGGTTGACTTTGGCATGCATAAATGTAGATACAAAATATATTTGTCATTTTACACCTTTAAAATAAGACATTTTTCAATTTAGCATTTTGAAATTAACTGCCTGTCACTGCATACAAGGGATACATTTTAACCCCAAATTACATATTTGCCCATTTTTTTGTTGCCCCCATATCCAAAGTAACAAAGCAAATGGCTCCCAGCATGGACACACTAGGGTTCAGTACAGTATTTGTATTTTCATTGCCTGGGAAAAAAAAAATTAAATAAACCGGTTCTTTGGCTTTANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)