Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABE6846.3                           66 END     1           2        1                Hypothetical protein MGC146691 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAJ20045.3.5                        19 END     1           2        5                protocadherin 1 isoform 2 precursor; protocadherin 42; cadherin-like protein 1[Homo sapiens]
     3   2.0    0Xt7.1-CABI13928.3                           3 END     1           2       33                (no blast hit)

 This cluster: approximate FL confidence score = 86%

 1012076232 Xt7.1-CAAL7360.3 - 34 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL7360.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATGAGCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGAAAGAAAAGAAAAAATAGAGGAAATAATGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATACTTCGTCCCCTCATGACTTGAGTGATACAGAGCACTTCCTCCCTACACACTTGCACTCCCGCAGGCACCTCTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCCTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGTGGCTTCTGTGGTTCCGTTCCCTATACCAACCAATAAAG
                                                  Xt7.1-CHK-1008227584                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGAAAGAAAAGAAAAAATAGAGGAAATAATGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATACTTCGTCCCCTCATGACTTGAGTGATACAGAGCACTTCCTCCCTACACACTTGCACTCCCGCAGGCACCTCTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCCTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGTGGCTTCTGTGGTTCCGTTCCCTATACCAACCAATAAAGGGGTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     5     6     6     6     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    12    12    13    13    14    14    14    14    14    14    14    14    13    13    12    13    12    12    12    12    13    13    13    13    14    15    12    12    13    13    12    12    13    13    14    14    14    14    15    15    15    15    15    15    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    16    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    17    18    17    18    18    19    18    19    18    18    17    17    17    17    17    17    17    17    17    17    18    18    17    18    18    18    17    17    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    15    15     7     8     6     6     5     6     5     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     5     6     5     6     4     5     4     5     3     5     3     4     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                               BLH ATG       2     371                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 1e-010     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sp ---- 3e-034     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 1e-039     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] --------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 1e-039     NP_523742.2 CG10119-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Br ---- 2e-065     CAA45827.1 cytoplasmic intermediate filament protein [Branchiostoma lanceolatum] --------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 8e-068     CAA11447.1 intermediate filament protein B1 [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 4e-071     CAC24550.1 intermediate filament protein IF-A [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 2e-116     AAI35569.1 Unknown (protein for IMAGE:7605582) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 4e-160     XP_694384.1 PREDICTED: similar to Neurofilament triplet L protein (68 kDa neurofilament protein) (Neurofilament light polypeptide) (NF-L) [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_035040.1 neurofilament, light polypeptide [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_006149.2 neurofilament, light polypeptide 68kDa [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 0          XP_417679.1 PREDICTED: similar to neurofilament-L [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAA83018.1 neurofilament protein [Xenopus laevis]  ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001081414.1 neurofilament protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL7360.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAA---------------TAG---------------------------------------------TGA------TGA------------------------------------------------------------------ATG---------------------------------------------------------------------TAA---------------------TGA---------TGA------------------------------------------------------------------------TGA------------------------------------------------------ATG------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Gas  5g                        TGas049m12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGGGGCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCANGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACT
  5   1   2       bld Brn2      in                        CAAJ17310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATGAGCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTGCGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTCTGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGAT
  5   1   2       bld Brn4      in                         CAAL7360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATGAGCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTGCGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTCTGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAGAACATGCAGTCCGC
  5   1   2       bld Gas7 PIPE in                         XZG35229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATGAGCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCCACACGGACGCAGT
  5   1   2       bld Brn4      in                        CAAL21959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGAGCTCCTACAGTTACGACCCGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCNGGATATAAGGGCCCAGTACGAGAAGCTGGCAG
  5   1   2       bld Brn4      in                         CAAL8333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACAGTTACGACCCNNGTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTGCGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTCTGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCANAGCGCAGCCCGCAACACGGACGCAGTCAG
  5   1   2       bld Tad5      in                         XZT24313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTGCGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTCTGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGC
  5   1   2       bld Te5       in                         CAAO5602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTACACTTCCTACAAGCGCCGGGTGGTGGAGAGCAGCCCCAGGGTGCACATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCANAGCGCAGCCCGCAACACGGACGCAGTCAG
  5   1   2       bld Brn4      in                        CAAL19475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCAGGAGCAGCTATGTCTCTCCCAGCAGAACCACTTACTCCCCGGTGGTTTCCAGCACTATGCGCCGGAGTTACGCCGCCTCTTCTTCTTCCTCCTCTTCCCTCCTGCACGGCGTGGACACCATGGACCTGTCGCAGGTAGCGGCGATCAGCAGCGACTTGAAAATCGTGCGAACCCAGGAGAAGGCGCAGCTGCAGGACCTGAACGATCGCTTCGCCAACTTTATCGAGCGCGTCCACGAACTGGAGCAGCGCAACAAGGTGTTGGAGGCAGAGCTGCTCCTATTGCGCCAAAAACACAACGAACCCTCCAGGCTGCGGGATCTGTACGAGCAGGAGGTACGGGAGCTGCGTCTGGCGCAGGAGGAGGCTACGGGGGACCGGCAGACTATGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCANAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGT
  5   1   2       bld Brn4      in                        CAAL12273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCAGGAGGAGGCTACGGGGGACCGGCAGACTCTGCGCAACGAGCGCGAACGTTTAGAGGATGCGCTGCGCCTGCTGCAGGGGCGCTATGAGGAAGAAGCGCTGAGCCGGGAAGACGCGGAGGCCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCANAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAA
  5   1   2       bld Tad5      in                         XZT24766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGGCTGTTGGATGTGAGGAAAGAAGCCGACATGGCAGCCCTAGCCCGGGTAGAACTGGAGAAGCGCATGGATAGCCTTCTAGACGAAATCGCTTTCCTGAAGAAAGTACATGAGGAAGAACTGGCGCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAG
  5   1   2       bld Tad5      in                          XZT8558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCTTCAGTCGCAGGTGCAATACGCTCAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAA
  3   1   2       bld Tad5      in                         XZT24766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGATCTCCCTAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCG
  3   1   2       bld Brn4      in                        CAAL19475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAAGTCGAAGTGGCTAAGCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCCCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAG
  3   1   2       bld Brn4      in                         CAAL8333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCGATCTCAGCTCTGCCCTGCGGGATATAAGGGCNCAGTACGAGAAGCTGGCAGCCAAGAACATGCAGTCCGCGGAGGACTGGTTCAAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGG
  3   1   2       bld Brn4      in                         CAAL7360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGTCGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAG
  3   1   2      seed Tad5      in                         XZT24313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCGATTCACTGTCCTGACGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGT
  3   1   2       bld Brn4      in                        CAAL21959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCAAAGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCCAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGT
  5   1   2       bld Brn4      in                         CAAL9158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGCAGCCCGCAACACGGACGCAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGA
  3   1   2       bld Brn4      out                        CAAL5566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACCGCAACACGGACGCAGTCAGAGCTGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGATCTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGTATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGTAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGTGTTGGTGCCATCACTAGTGGCTACACGCAGAGTGCCCCGGTCTTTGGTCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCCAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGTAAG
  3   1   2       bld Te5       in                         CAAO5602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGTCAGAGCCGCCAAGGATGAGGTGTCCGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGT
  3   1   2       bld Brn2      in                        CAAJ17310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGT
  5   1   2       bld Tad5      in                         XZT27496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGGATGCTCAGCGCCAAGGGTCTGGAGATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGANAGTAAAAAGAAAGAAAAGAAAAAATAGAGGAAATAATGGTTTCCCAGCTACTAGATCCGCCCTTTGCATTCCCACCAATCTCCATACTTCGTCCCCTCATGACCTGAGTGATACAGAGCACTTCCTCCTACACACTTGCACTCCCG
  5   1   2       bld Brn4      out                       CAAL10897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGAGGCTTGTAGGGGGGTGAACGACGCTCTAGAGAGGCAAATCCAGGAACTGGAGGAAAAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGA
  3   1   2       bld Brn4      in                        CAAL12273.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCAGAGCGGGGAAATCGCAGGGATGCAGGATGCTATAAACAAATTAGAGGAAGAGCTGAGGAACACCAAGAGTGAAATGGCGAGGTATCTGAAGGAATATCAAGACCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATTGCTGCCTACAGGAAGTTACTTGAGGGGGAGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGT
  3   1   2       bld Gas7 PIPE in                         XZG35229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGAGTGAAATGGCGAGGTTTTTGAAGGAATATCAAGCCCTGCTCAATGTGAAGATGGCTTTGGATATAGAAATAGCTGCCTCCAGGAAGTTACTTGAGGGGGGGGAGACCCGACTGAGTTTTTCCGGCGTTGGTGCCATCACTAGGGGCTACACGCAGAGTGCCCCGGTTTTTGGCCGTTCCGCATACAGTTTGCAGAGCAGTTTTTTTATGATTTCCCGGGCATTCCCTACATATTACTCCAGCCATGTCCAAGGGGGGCAACTTGACATAGGGGGGACTATAGATTTTTTTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAACCAAAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGTTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGGGAAGAAAAAAAAGAGGAAGAGGAGGGAGAGGGTGAACCAGAGGGTGAACCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGA
  5   1   2       bld Brn4      in                         CAAL7351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAGACCCGACTGAGTTTCTCCGGCGTTGGTGCCATCACTAGCGGCTACACGCAGAGTGCCCCGGTCTTTGGCCGTTCCGCATACAGTCTGCAGAGCAGCTCTTATATGACTTCCCGGGCATTCCCTACATACTACTCCAGCCATGTCCAAGAGGAGCAACTTGACATAGAGGAGACTATAGAGTCTTCTAGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGAAAGAAAAGAAAAAATAGAGGGAATAATGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATACTTCGTCCCCTCATGACTTGAGTGATACAGAGCACTTCCTCCCTACACACTTGCACTCCCGCAGGCACCTCTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGGTTGGCGGCACATGGTGACTG
  3   1   2       bld Brn4      out                        CAAL6147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGTGGGGAAATGGGAATGGCATGTCAACTAGCAGGGAGGGAGAATAAGCAAGCAGGCATATCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCCAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGAAAGAAAAGAAAAAATAGAGGAAATAATGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATACTTCGTCCCCTCATGACTTGAGTGATACAGAGCACTTCCTCCCTACACACTTGCACTCCCGCAGGCACCTCTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCTAATGGCGCCCCTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGTGGCTTCTGTGGTTCCGTTCCCTATACCAACCAATAAAGGGGTAAACCGCATTCCAC
  3   1   2       bld Tad5      in                         XZT27496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGCAGAAGAAGCCAAGGCAGAAGCCCCAGAGGAGGAAGAAGAAGAGGCTGGAGAGGAAGAAGCAGAAGGTGGAGAGGGGGATGAAGGAGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGAAAGAAAAGAAAAAATAGAGGAAATAATGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATACTTCGTCCCCTCATGACTTGAGTGATACAGAGCACTTCCTCCCTACACACTTGCACTCCCGCAGGCACCTCTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCAGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCCTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGTGGCTTCTGTGGTTCCGTTCCCTATACCAACCAATAAAGGGGTAAACCGC
  3   1   2       bld Brn4      in                         CAAL7351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAGGTGAAGAAGGGGAAGAAGCTAAGGAAGAGGAAGCTGAAGAAGAGGGCGAAGGAGAAGAAAAAGAAGAGGAAGAGGAGGGAGAGGGTGAAGCAGAGGGTGAAGCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGGCAAAGGAGAAGAACCTGCAGAAGAGGAAAGTAAAAAGAAAGAAAAGAAAAAATAGAGGGAATAATGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATACTTCGTCCCCTCATGACTTGAGTGATACAGAGCACTTCCTCCCTACACACTTGCACTCCCGCAGGCACCTCTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCCTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGTGGCTTCTGTGGTTCCGTTCCCTATACCAACCAATAAAGGGGTAAACCGCATTCC
  3   1   2       bld Brn4      in                         CAAL9158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCAGAGGGTGAACCAGAGGGAGAAGGAGAGGCAGAAGGAGAAGGTGAGGAGGAAGAAGAAGCCAAAGGAGAAGACCCTGCGGAGGGGGAAGGTAAAAAGAAGGAAAGGAAAAATTGGGGGGAATATTGGTTTCCCAGCTACTAGATCCGCCTTTGCAATTCCAACCAATCTCCATATTTGGTCCCCTCATGACTTGAGTGATACAGAGCATTTCCTCCCTACACATTTGCATTCCCGCAGGCACCTTTATGGTTAGATCACCCCCTCATGTTGAGCATTTGGACACCAGTTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCGGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCGGCCCATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATTTTTTCCGCTGTTCCCCTCTCCTAAGGGGGCCCCTAAATCCTTCATACTGCTCAAGACGG
  3   1   2       bld Tad5      in                          XZT8558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAGATCAGCCCCTCATGTGGAGCATTTGGACACCAGCTTCACGCAAACCAGCCCTGGCCCTGTCACCCCTCCCAGGGTTTGCATGGTAAAATAAGAGGGAGTTTAGAACCTGAAGTTTTCGATGATTTCATCCTCAGCGAAGGGTACATGTGCCGCAGTTTCAGCCTTTGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCCTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTA
  3   1   2       bld BrSp      in                     EC2BBA27DE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCGTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGGGCTTCATGGGTTCCG
  5   1   2       bld BrSp      in                     EC2BBA27DE02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCCACAAGGGTTGGCGGCACATGGTGACTGAGAACCAATAAGCTGGCAGTGTTGTTTGAATGTTCTCCGCTGTTCCCCTCTCCTAATGGCGCCCGTAAATCCTTCATACTGCTCAAGACTGGCACTGCAGGGCAATAGAGAGCAGCTTATGAATGTATTGGTGGCTTCTGTGGTTCCGTTCCCTATACCAACCAATAAAGGGGTAAACCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)