Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 98%

 1012076276 Xt7.1-CABD6884.5 - 39 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     9    11    17    18    17    18    16    18    17    18    19    20    19    20    19    20    19    20    18    20    17    18    17    18    18    19    18    19    18    19    19    19    19    19    19    19    18    20    20    20    20    20    20    20    17    19    18    19    19    19    19    19    19    19    19    19    19    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    17    19    18    19    18    18    17    18    18    18    18    18    17    18    18    18    18    19    19    20    20    20    20    20    18    20    19    20    15    16    17    18    16    17    15    15    15    15    15    15     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8    10    15    10    15    12    16    10    16    10    16    11    15    11    15    11    15    11    15    11    15    11    15    11    15    10    14    10    14    12    14    12    14    12    14    13    14    13    14    12    14    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13     9    10     9    10     9     9     8     9     8     9     8     9     8     9     8     9     8     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------T
                                               BLH ATG     588    1181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN     588     141                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR     588     976                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI    1177      66                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG     588      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 2e-015     CAB96573.1 AmphiZic protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 8e-017     NP_012479.1 Zinc-regulated DNA binding protein involved in zinc ion homeostasis; Zap1p[Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 8e-018     NP_492723.1 Drosophila ODD-skipped-like ODD-3 (odd-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 9e-020     BAE06329.1 Ci-BCL6-like C2H2 Zinc finger [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-020     XP_784091.1 PREDICTED: similar to zinc finger protein 569 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 1e-020     NP_787978.1 CG11924-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xl ==== 9e-044     AAH72114.1 MGC79103 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Dr ==== 6e-089     XP_684224.1 PREDICTED: similar to maturation-inducing protein isoform 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 3e-157     NP_666365.1 RIKEN cDNA A830092L04 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 1e-160     NP_006617.1 zinc finger protein with interaction domain [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Gg ==== 3e-170     XP_415393.1 PREDICTED: similar to Zinc finger protein 482 (Zinc finger and BTB domain containing protein 6) (Zinc finger protein with interaction domain) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          AAI35186.1 Unknown (protein for MGC:121271) [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = ?? ==== 0          NP_001090792.1 hypothetical protein LOC100037884 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD6884.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TAG------TAG------TGA---------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TGA------------------------------ATG------------TAA------------------TGA---------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAA------TAA---------TAA------------ATGTAA------------------------ATG---------------------------------------TAG------------------------------TAA---------TAA---------------------------------------------------------------------------------------------------TGA------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Egg  5g3  in                   TEgg054d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTACGGCACGTCCACTCCTGCTGCTGCTTACAGCTAAGCGATCTCTTACTTTCTCCTGACAGGTCACGGATTCCCCATTCATCCTCCTCCCTGCGACTTCATACATGCCCCAGAATCGTTTATCCTCCGCCAGCCCTGCGGTTTGCAAGGTGTAGTAGGAGGGCGACATTGCAGGAAACCTATGAGATGAGCGATCAGGGGGAATGGAGGAGGGAAGGTTCTGTAGCCCATAAGAATGATGGAGGAAGGTTGCATGACATCACCGGAAGGAGGGTGATTGGAGGAAGCCGGGACCTGTCAGGAAAAAGATAGAGGGAATGGTCGAACTGTTACAGCAGTAGTGGGGGTTGTAAATAGATTTCTTAGCAGCGGTGAGACTTTAGGTGGCGAAGAGAGGAGGAGGTACTATAGATTTTTAGACACGTTCTAAAATGGAACTGTAAATGTAATCCTAACTGCGACTGGGCTAAACACTTCCCTATATGGCGTCATGTTCCTCCGCCCACTTCTTGGTCACATGGCTGTGACGTCACCACCCCCCAAAACCTGCTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGT
  5   1   2       bld Gas  5g                        TGas042l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGTCCACTCCTGCTGCTGCTTACAGCTAAGCGATCTCTTACTTTCTCCTGACAGGTCACGGATTCCCCATTCATCCTCCTCCCTGCGACTTCATACATGCCCCAGAATCGTTTATCCTCCGCCAGCCCTGCGGTTTGCAAGGTGTAGTAGGAGGGCGACATTGCAGGAAACCTATGAGATGAGCGATCAGGGGGAATGGAGGAGGGAAGGTTCTGTAGCCCATAAGAATGATGGAGGAAGGTTGCATGACATCACCGGAAGGAGGGTGATTGGAGGAAGCCGGGACCTGTCAGGAAAAAGATAGAGGGAATGGTCGAACTGTTACAGCAGTAGTGGGGGTTGTAAATAGATTTCTTAGCAGCGGTGAGACTTTAGGTGGCGAAGAGAGGAGGAGGTACTATAGATTTTTAGACACGTTCTAAAATGGAACTGTAAATGTAATCCTAACTGCGACTGGGCTAAACACTTCCCTATATGGCGTCATGTTCCTCCGCCCACTTCTTGGTCACATGGCTGTGACGTCACCACCCCCCAAAACCTGCTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCNGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTA
  5   1   2       bld Tad5 FL   in                         XZT23390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGANAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCAAATCAAACATGTTTTTC
  5   1   2       bld TpA  5g   ?                    TTpA035f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGGCATAAAGTTGTCTTTGCTGCTTGTTCTACCTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCATAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAGAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGTACAAAAACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAACGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCACGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAGACATGTTTTTCTC
  5   1   2       bld TbA  5g                        TTbA046e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAANGACAATGACATTTGT
  5   1   2       bld Lun1      in                        CABD14807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCAT
  5   1   2       bld Gas                            TGas044c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTGAGAAAACCGCATGGTTGACGTGCCGTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTNTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCA
  5   1   2       bld Gas                            TGas044b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGC
  5   1   2       bld Gas                            TGas044e22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCAT
  5   1   2       bld Gas                            TGas044f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATT
  5   1   2       bld Gas                            TGas044f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGGACAATGACATTTGTATTTTCAGGGTGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCA
  5   1   2      seed Gas                            TGas044f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATT
  5   1   2       bld Gas                            TGas044o19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGGCTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCATGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGGTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGC
  5   1   2       bld Gas       in                   TGas070g23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCA
  5   1   2       bld Gas       in                   TGas070m21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTG
  5   1   2       bld Gas       in                   TGas070n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACT
  5   1   2       bld Gas       in                   TGas070n21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTT
  5   1   2       bld Gas       in                   TGas070n22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTT
  5   1   2       bld Gas       in                   TGas070o21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCA
  5   1   2       bld Gas       in                   TGas070p22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCACGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATGCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTT
  5   1   2       bld Gas                            TGas044a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCA
  5   1   2       bld Gas                            TGas044g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAGCAATGCAGACACTGAACAGTGCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTGCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTGAAACCTTCCAAGAATGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTGTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCGGTGCGGAAAAACATTCACTGATAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAAGCCCTTTCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAATAGCACTCTCCAAGATCACCTGAACATCCACAGAGGCGATCGGCCATACAAGTGCGATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCT
  3   1   2       bld Egg  5g3  in                    TEgg054d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATTTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTTTCCTCATGGGGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTTTGTGTTTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGGGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTTTCCAAGATCACCTGAACATCCACAGTGGGGATTGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTTTAAAAAAGCATTTCAGTTTTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTTTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTTTTTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAAGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Lun1      in                         CABD6884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCAAACCATCATAGCTG
  5   1   2       bld Gas                            TGas044b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATCCAAGATCTGGGATGGTGCATTGCCTACATACAGTGACTGAACGAGTCTTCTCATGGCGGCGCCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCGTAAACTGTGATTGTGTCTGCAGTGCGTGCAAAACATTCACTCAGAACAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCATGCCCTTACGATGCTCCGTTTG
  3   1   2       bld Lun1      in                        CABD14807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCATACAAGTGCAATTGCTGTGATATGGATTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTTTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATGAAAATGGAC
  3   1   2       bld Tad5 FL   in                         XZT23390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCNCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACGG
  3   1   2       bld Lun1      in                         CABD6884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAGTCAAATTGGACTCGATACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCNCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGGTAAAAAAACCTCTCG
  5  -1   2       bld Ova1      in                         CABE1337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATGAAAATGGACAGCCTCGTGCCGAATTGAATCGAG
  3  -1   2       bld Ova1      in                         CABE1337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAG
  3   1   2       bld Gas       in                    TGas070n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGATTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAANGGAAACCCACTGCTCAAAAATGGGGAAAGTGCCAAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATCTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070m21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAANAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas                             TGas070d20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTGCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACA
  3   1   2       bld Gas       in                    TGas070n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCANAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070n22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGCGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070o21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Egg       ?                     TEgg034d05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTATTAAAGGAAACCACTGCTCAAAATGGCGGAAAGTGCAAAGATGTCCTGAAGGTTATATTGGCCAATAATACCTGAGCAAAATTTTTTCATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCCCCCTTCTGTGTTTATATTCCTTGAAAGTTTGCACACCACAAAGGACTGTTGGATTAATGTCTGGCTCATAGCCATCACTAGCTGCTCCCTTACGCATGCAAATATCCATAAATGGGGCTCCTTATGCTTAATCTTTCAAACGCATTTTGCTAAAACTCTCAGAACACACTTTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACAGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTGAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCCGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGT

In case of problems mail me! (