Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012076276 Xt7.1-CABD6884.5 - 39 ESTs
                                                                       ..-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD6884.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGTCCACTCCTGCTGCTGCTTACAGCTAAGCGATCTCTTACTTTCTCCTGACAGGTCACGGATTCCCCATTCATCCTCCTCCCTGCGACTTCATACATGCCCCAGAATCGTTTATCCTCCGCCAGCCCTGCGGTTTGCAAGGTGTAGTAGGAGGGCGACATTGCAGGAAACCTATGAGATGAGCGATCAGGGGGAATGGAGGAGGGAAGGTTCTGTAGCCCATAAGAATGATGGAGGAAGGTTGCATGACATCACCGGAAGGAGGGTGATTGGAGGAAGCCGGGACCTGTCAGGAAAAAGATAGAGGGAATGGTCGAACTGTTACAGCAGTAGTGGGGGTTGTAAATAGATTTCTTAGCAGCGGTGAGACTTTAGGTGGCGAAGAGAGGAGGAGGTACTATAGATTTTTAGACACGTTCTAAAATGGAACTGTAAATGTAATCCTAACTGCGACTGGGCTAAACACTTCCCTATATGGCGTCATGTTCCTCCGCCCACTTCTTGGTCACATGGCTGTGACGTCACCACCCCCCAAAACCTGCTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAA
                                                  Xt7.1-CHK-1008226846                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACTCCTGCTGCTGCTTACAGCTAAGCGATCTCTTACTTTCTCCTGACAGGTCACGGATTCCCCATTCATCCTCCTCCCTGCGACTTCATACATGCCCCAGAATCGTTTATCCTCCGCCAGCCCTGCGGTTTGCAAGGTGTAGTAGGAGGGCGACATTGCAGGAAACCTATGAGATGAGCGATCAGGGGGAATGGAGGAGGGAAGGTTCTGTAGCCCATAAGAATGATGGAGGAAGGTTGCATGACATCACCGGAAGGAGGGTGATTGGAGGAAGCCGGGACCTGTCAGGAAAAAGATAGAGGGAATGGTCGAACTGTTACAGCAGTAGTGGGGGTTGTAAATAGATTTCTTAGCAGCGGTGAGACTTTAGGTGGCGAAGAGAGGAGGAGGTACTATAGATTTTTAGACACGTTCTAAAATGGAACTGTAAATGTAATCCTAACTGCGACTGGGCTAAACACTTCCCTATATGGCGTCATGTTCCTCCGCCCACTTCTTGGTCACATGGCTGTGACGTCACCACCCCCCAAAACCTGCTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     9    11    17    18    17    18    16    18    17    18    19    20    19    20    19    20    19    20    18    20    17    18    17    18    18    19    18    19    18    19    19    19    19    19    19    19    18    20    20    20    20    20    20    20    17    19    18    19    19    19    19    19    19    19    19    19    19    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    17    19    18    19    18    18    17    18    18    18    18    18    17    18    18    18    18    19    19    20    20    20    20    20    18    20    19    20    15    16    17    18    16    17    15    15    15    15    15    15     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8    10    15    10    15    12    16    10    16    10    16    11    15    11    15    11    15    11    15    11    15    11    15    11    15    10    14    10    14    12    14    12    14    12    14    13    14    13    14    12    14    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13     9    10     9    10     9     9     8     9     8     9     8     9     8     9     8     9     8     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------T
                                               BLH ATG     588    1181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN     588     141                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR     588     976                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI    1177      66                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG     588      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 2e-015     CAB96573.1 AmphiZic protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 8e-017     NP_012479.1 Zinc-regulated DNA binding protein involved in zinc ion homeostasis; Zap1p[Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 8e-018     NP_492723.1 Drosophila ODD-skipped-like ODD-3 (odd-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 9e-020     BAE06329.1 Ci-BCL6-like C2H2 Zinc finger [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-020     XP_784091.1 PREDICTED: similar to zinc finger protein 569 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 1e-020     NP_787978.1 CG11924-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xl ==== 9e-044     AAH72114.1 MGC79103 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Dr ==== 6e-089     XP_684224.1 PREDICTED: similar to maturation-inducing protein isoform 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 3e-157     NP_666365.1 RIKEN cDNA A830092L04 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 1e-160     NP_006617.1 zinc finger protein with interaction domain [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Gg ==== 3e-170     XP_415393.1 PREDICTED: similar to Zinc finger protein 482 (Zinc finger and BTB domain containing protein 6) (Zinc finger protein with interaction domain) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          AAI35186.1 Unknown (protein for MGC:121271) [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = ?? ==== 0          NP_001090792.1 hypothetical protein LOC100037884 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD6884.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TAG------TAG------TGA---------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TGA------------------------------ATG------------TAA------------------TGA---------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAA------TAA---------TAA------------ATGTAA------------------------ATG---------------------------------------TAG------------------------------TAA---------TAA---------------------------------------------------------------------------------------------------TGA------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  0   1   1           Tad5 FL                          XZT23390.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg054d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTACGGCACGTCCACTCCTGCTGCTGCTTACAGCTAAGCGATCTCTTACTTTCTCCTGACAGGTCACGGATTCCCCATTCATCCTCCTCCCTGCGACTTCATACATGCCCCAGAATCGTTTATCCTCCGCCAGCCCTGCGGTTTGCAAGGTGTAGTAGGAGGGCGACATTGCAGGAAACCTATGAGATGAGCGATCAGGGGGAATGGAGGAGGGAAGGTTCTGTAGCCCATAAGAATGATGGAGGAAGGTTGCATGACATCACCGGAAGGAGGGTGATTGGAGGAAGCCGGGACCTGTCAGGAAAAAGATAGAGGGAATGGTCGAACTGTTACAGCAGTAGTGGGGGTTGTAAATAGATTTCTTAGCAGCGGTGAGACTTTAGGTGGCGAAGAGAGGAGGAGGTACTATAGATTTTTAGACACGTTCTAAAATGGAACTGTAAATGTAATCCTAACTGCGACTGGGCTAAACACTTCCCTATATGGCGTCATGTTCCTCCGCCCACTTCTTGGTCACATGGCTGTGACGTCACCACCCCCCAAAACCTGCTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGT
  5   1   2       bld Gas  5g                        TGas042l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGTCCACTCCTGCTGCTGCTTACAGCTAAGCGATCTCTTACTTTCTCCTGACAGGTCACGGATTCCCCATTCATCCTCCTCCCTGCGACTTCATACATGCCCCAGAATCGTTTATCCTCCGCCAGCCCTGCGGTTTGCAAGGTGTAGTAGGAGGGCGACATTGCAGGAAACCTATGAGATGAGCGATCAGGGGGAATGGAGGAGGGAAGGTTCTGTAGCCCATAAGAATGATGGAGGAAGGTTGCATGACATCACCGGAAGGAGGGTGATTGGAGGAAGCCGGGACCTGTCAGGAAAAAGATAGAGGGAATGGTCGAACTGTTACAGCAGTAGTGGGGGTTGTAAATAGATTTCTTAGCAGCGGTGAGACTTTAGGTGGCGAAGAGAGGAGGAGGTACTATAGATTTTTAGACACGTTCTAAAATGGAACTGTAAATGTAATCCTAACTGCGACTGGGCTAAACACTTCCCTATATGGCGTCATGTTCCTCCGCCCACTTCTTGGTCACATGGCTGTGACGTCACCACCCCCCAAAACCTGCTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCNGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTA
  5   1   2       bld Tad5 FL   in                         XZT23390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCGTTCTAGCTGTTGATGGCCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGANAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCAAATCAAACATGTTTTTC
  5   1   2       bld TpA  5g   ?                    TTpA035f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGGCATAAAGTTGTCTTTGCTGCTTGTTCTACCTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCATAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAGAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGTACAAAAACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAACGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCACGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAGACATGTTTTTCTC
  5   1   2       bld TbA  5g                        TTbA046e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGGATCCGGGAGAGCCATCACCATGTCTGATTCTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAANGACAATGACATTTGT
  5   1   2       bld Lun1      in                        CABD14807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACATCTTGCACTTTCGGTTTGAGCAGCAAGGAGATGGTGTCCTGCACAAGATGAATATTTTGAGGGAACAGAATTTGTTTTGTGATGTTTCCATCTACATCAATGATGCTGAGTTTCATGGCCATAAAGTTGTCTTTGCTGCTTGTTCTACGTTCATGAGGGACCAGTTCTTGCTGAATCAGTCTAGGCAAGTGCATATAACTATACTGCAGAATGCGGAGGTAGGGCAAAAGCTACTGTTATCCTGCTACACGGGAGTCCTGGAGGTGAAAAAGAAAGAGCTTTTAAAATATTTGACTGCAGCTAGCTATTTGCAAATGGTGCACATAGTTGAGAAATGTACAGATGCACTTTCTCAGTACTTAAAAAATGAGCCAGAAACTCAGCCCTTATCAAAGGATCCTTCTGGTCTTGCTGAGATTGAGACTGCAGACAGCCTGGACAAAGACTGTGAGATTATTGAACTGTCTGAGGACAGCCCCTTAAACCTAGATTTCCAGGTCAAGAAGGAAGATAACGAACAGGGGCGAATACACAGCCCCATATCTGAAAAAAATGATATCTCATCTGTGGAAATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCAT
  5   1   2       bld Gas                            TGas044c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTGAGAAAACCGCATGGTTGACGTGCCGTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTNTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCA
  5   1   2       bld Gas                            TGas044b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGC
  5   1   2       bld Gas                            TGas044e22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCAT
  5   1   2       bld Gas                            TGas044f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATT
  5   1   2       bld Gas                            TGas044f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGGACAATGACATTTGTATTTTCAGGGTGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCA
  5   1   2      seed Gas                            TGas044f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATT
  5   1   2       bld Gas                            TGas044o19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGACTACAAGNACAATGACATTTGTATTTTCAGGATGGGCTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCATGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGGTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGC
  5   1   2       bld Gas       in                   TGas070g23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCA
  5   1   2       bld Gas       in                   TGas070m21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTG
  5   1   2       bld Gas       in                   TGas070n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACT
  5   1   2       bld Gas       in                   TGas070n21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTT
  5   1   2       bld Gas       in                   TGas070n22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTT
  5   1   2       bld Gas       in                   TGas070o21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCA
  5   1   2       bld Gas       in                   TGas070p22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGACTACAAGGACAATGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCACGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATGCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTT
  5   1   2       bld Gas                            TGas044a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACATTTGTATTTTCAGGATGGACTCTCTTCCCGAGAGTGCTAGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCA
  5   1   2       bld Gas                            TGas044g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAGCAATGCAGACACTGAACAGTGCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTGCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTGAAACCTTCCAAGAATGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTGTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCGGTGCGGAAAAACATTCACTGATAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAAGCCCTTTCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAATAGCACTCTCCAAGATCACCTGAACATCCACAGAGGCGATCGGCCATACAAGTGCGATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCT
  3   1   2       bld Egg  5g3  in                    TEgg054d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAATGCAGACACTGAACAGTTCCCCCAGCCGTGCACCTCTTCCAAATCAAACATGTTTTTCTCCGAAACCCAGCACAGTTCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATTTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTTTCCTCATGGGGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTTTGTGTTTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGGGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTTTCCAAGATCACCTGAACATCCACAGTGGGGATTGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTTTAAAAAAGCATTTCAGTTTTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTTTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTTTTTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAAGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Lun1      in                         CABD6884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAATCAACTCAACTGTAGAAAACCGCATGGTTGACGTGCCTGAAAATCAGTTTCAAACCTTCCAAGAAGGAGGGGATCCAGGATCTGGGATGGTGCATTGCCTACAGACAGTGACTGAAGGAGTCTCCTCATGGCGGCACCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCATAAACTGTTTCTGTGTCTGCAGTGCGGAAAAACATTCACTCAGAAGAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCAGGCCCTTCCAATGCTCCGTTTGCTTAAAAACTTTTACCGCTAAGAGCACTCTCCAAGATCACCTGAACATCCACAGTGGCGATCGGCCATACAAGTGCAATTGCTGTGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCAAACCATCATAGCTG
  5   1   2       bld Gas                            TGas044b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATCCAAGATCTGGGATGGTGCATTGCCTACATACAGTGACTGAACGAGTCTTCTCATGGCGGCGCCAGTGCCCCAAGTGCCCTCGGGGTTTTTTACACTTGGAGAACTACATGCGCCACCTAAAGATGCGTAAACTGTGATTGTGTCTGCAGTGCGTGCAAAACATTCACTCAGAACAAGAACCTAAACCGGCACATCCGCGGCCACATGGGTATCATGCCCTTACGATGCTCCGTTTG
  3   1   2       bld Lun1      in                        CABD14807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCATACAAGTGCAATTGCTGTGATATGGATTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTTTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATGAAAATGGAC
  3   1   2       bld Tad5 FL   in                         XZT23390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATATGGATTTTAAACACAAATCGGCTCTAAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCNCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACGG
  3   1   2       bld Lun1      in                         CABD6884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAGCATCTCAGTTCTGTTCATGGTAGAGTTGGAGGTGAAAGTCAAATTGGACTCGATACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCNCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGGTAAAAAAACCTCTCG
  5  -1   2       bld Ova1      in                         CABE1337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGAAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATGAAAATGGACAGCCTCGTGCCGAATTGAATCGAG
  3  -1   2       bld Ova1      in                         CABE1337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGAAAGTCAAATTTGGACTCGATTACCAAAATCACCATAGACTATGATTAGAGTGTGTGTGTGACTGCATTTATATCTTGGATTATAGATCCCAATGTAGCACAAACAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAATTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAG
  3   1   2       bld Gas       in                    TGas070n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAATATGTCTGATCAACCGTTTTAATATTTAGAAAGTTGGTCATGCCGTGTTTTCTCTAAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGATTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAANGGAAACCCACTGCTCAAAAATGGGGAAAGTGCCAAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATCTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070m21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAANAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas                             TGas070d20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTGCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACA
  3   1   2       bld Gas       in                    TGas070n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCANAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070n22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGCGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas070o21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATGGAAAGATACAGCATGAAAGCTTTCTTTTTTTTTTTTATTAAAAGGAAACCACTGCTCAAAATGGGGAAAGTGCAAAGATGTCCAGAGGGTTATATTGGCCAATAATACTGAGCAAAACTTTTAGATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCATCATTCTGTGTTTATATTCCTTGACAGTTTGCACACTACAAGGCACTGTTGCATTACTGTCTGGCTCATAGCCATCATAGCTGCTCCCTTACGCATGCAAATATCCATAAATGTGGCTCCTTATGCTTAATCATTCAAACGCATTTTGCTAAAACTCTCAAACACACATTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACGGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCGGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGTAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Egg       ?                     TEgg034d05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTTATTAAAGGAAACCACTGCTCAAAATGGCGGAAAGTGCAAAGATGTCCTGAAGGTTATATTGGCCAATAATACCTGAGCAAAATTTTTTCATCGGTGAGTGGATTACACTTCCTGAAGAAAAACCCCCCTTCTGTGTTTATATTCCTTGAAAGTTTGCACACCACAAAGGACTGTTGGATTAATGTCTGGCTCATAGCCATCACTAGCTGCTCCCTTACGCATGCAAATATCCATAAATGGGGCTCCTTATGCTTAATCTTTCAAACGCATTTTGCTAAAACTCTCAGAACACACTTTTTAAACATTTTAATTACTATAAAGTACTGTGTAACTTTTTGCTACTATGTAACTAGATGATCATGGTTACAGTTTGATGAAAGACCTAGGGGCCAATTTATTAAGCTATCTTTTTACCTGAGAGGTGCTTACTGCTCTGTTTCTATAGATGTTAATGGGAATTATAACAAGCAACTTTATTTATTCATTTCCCCACTTTATTAAAATATTTTGGGGTTTTCCGCCTCATTGAAAATGGACAGAACAATGTGATTTTGGATGGTGTGTGACTTTTCTTCCTCGCCAAAATGCGACCACCACTATTCGGTTTGAGTTTTTTCATAAATAAGCTTCAGGGGAAAAAAAGATTGTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)