Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012076283 Xt7.1-TTpA003e03.5 - 65 ESTs
                                                                       .........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA003e03.5                    AACTGGGGCACAGTCCTGAGCAGGATCTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAGGAA
                                                  Xt7.1-CHK-1008224670                          GGCACAGTCCTGAGCAGGATCTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAGGAAATAATT
                                                      consensus depths                         2     2     2     2     3     3     5     5     7     7     7     7     9     9     9    10     9    10     9    10    10    10    10    10    10    11    10    11    10    11    11    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    14    13    14    13    14    15    15    15    15    15    15    15    15    16    16    16    16    17    17    17    17    16    18    16    18    16    18    18    19    19    20    19    20    19    21    19    21    19    21    19    21    20    22    20    22    20    22    21    22    21    22    20    22    20    23    21    23    21    24    22    24    23    25    24    26    24    26    24    26    24    26    24    26    24    26    24    27    24    27    24    26    23    24    23    24    23    25    23    25    18    24    18    24    16    21    17    22    17    21    17    21    17    21    17    21    15    20    16    22    15    23    16    26    16    26    19    26    20    26    22    26    23    27    23    26    23    28    21    27    21    27    25    28    25    28    23    28    24    29    26    30    26    30    25    30    25    30    25    31    24    30    24    30    25    30    22    29    23    29    22    29    23    30    23    30    24    30    24    29    24    28    24    28    22    28    22    28    22    28    22    27    21    27    21    27    21    27    21    27    21    26    21    25    20    24    20    24    20    24    20    24    20    23    18    23    19    23    18    22    18    22    18    22    18    22    16    20    14    20    15    19    15    20    16    22    15    22    15    22    14    22    15    22    15    22    15    23    16    23    16    25    17    26    17    29    18    29    17    30    17    29    20    31    20    31    20    31    18    31    20    31    20    30    17    29    17    29    17    27    17    27    17    27    17    26    17    25    17    25    16    24    15    24    16    23    16    22    17    21    18    20    18    20    18    20    18    19    17    18    17    18    15    18    16    18    16    18    15    17    15    17    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    17    14    17    15    17    16    17    16    17    16    17    15    17    16    17    15    17    15    17    15    17    14    17    14    16    13    16     7    11     6     9     5     7     5     7     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGTACATTGC
                                                                   SNP                                                                                                                                                                                                                                                                                                        ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                               BLH ATG     118     543                    
                                               BLH MIN     118     306                    
                                               BLH MPR      16     306                    
                                               BLH OVR     118     608                    
                                               CDS MIN     118     306                    
                                               ORF LNG     118     179                    
                                                                                                                                                          PROTEIN --- Sc ---- 6e-083     NP_010931.1 acyl-CoA synthetase (long-chain fatty acid CoA ligase) (fatty acid activator 2),activates endogenous but not imported fatty acids and provides substrates forN-myristoylation; Faa2p [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 3e-174     XP_779941.1 PREDICTED: similar to acyl-CoA synthetase long-chain family member 1 isoform 1 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                              PROTEIN --- Dm ---- 0          NP_730369.1 CG3961-PA [Drosophila melanogaster] --------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                          PREDICTED - Ce ---- 0          NP_490744.1 long chain fatty acid Coenzyme A ligase and a putative endoplasmic reticulummembrane protein, the two genes overlaping between their 3' and 5' UTRs (79.0kD) (1A982Co) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PREDICTED - Xl ---- 0          AAH46740.1 similar to fatty acid Coenzyme A ligase [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PROTEIN --- ?? ---- 0          NP_001079665.1 similar to fatty acid Coenzyme A ligase [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PROTEIN === Mm ==== 0          NP_082252.1 acyl-CoA synthetase long-chain family member 5 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PROTEIN === Hs ==== 0          NP_976313.1 acyl-CoA synthetase long-chain family member 5 isoform b; long-chain acyl-CoAsynthetase 5; long-chain fatty acid coenzyme A ligase 5; fatty-acid-Coenzyme Aligase, long-chain 5 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PROTEIN --- Dr ---= 0          NP_001004599.1 zgc:92083 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PROTEIN === Gg ==== 0          NP_001026408.1 acyl-CoA synthetase long-chain family member 5 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                PREDICTED = Xt ==== 0          AAH84450.1 Hypothetical LOC496479 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA003e03.5                                    TGA---------------------------------------TGA---------TAG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------ATG------ATG------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------TAA---------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA------------------------------ATG------------TAA---------ATG---------------------------------ATG------------------------------TAA---TAATAA
                                                                   ORF                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   1           AbdN FL                     IMAGE:7004438.FL-MGC                                         AGGATCTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGAAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAGGAAATAATTGACTGAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Tad5 5g3  in                         XZT56194.5p AATAGAGCAGCTGGGGGAGAACTGGGGCACAGTCCTGAGCAGGATCTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGACGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGACTTC
  5   1   2   12  bld Tad5 5g3  in                         XZT29865.5p ...................AACTGGGGCACAGTCCTGAGCAGGATCTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAAG
  5   1   2       bld AbdN FL                            IMAGE:7004438                                          GGATCTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGAAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTAGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAAATTCTCTCCATGGAAGGAAATTGAGTACCCTGGGGGAAAAGAGAACTTTCAAGGAAGCCCAGTGGCC
  3  -1   2       chi Abd0      in                       IMAGE:6999235                                              CTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGAAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAAAAGCAGTTATTGCAAAGCTGGCTTGTTTCCCCTACTCTTAGGTCCGTGGTCCCCTCCATGATCACCTCGAACCGAAACCATTTGGTTAATTGAAAAAAAACCGATCCCCCCTGGTTTTTGCCAAAACCGAAAAGGCCTTAATTTTTAAAAATTGTAAAAAGGGAAACCCCGGCTCAAACCCCTTTTTTTGGAATTTTGTCCCCCTAAAAAAGGAAAAATGGGGTTATTTTN
  5   1   2       chi Tad5 5x3  in                         XZT45362.5p                                              CTGTCCTAGAGATCAGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGNGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTC
  5   1   2   12  bld Tad5 5g3  in                         XZT51248.5p ...........................................................AGCCTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTT
  5   1   2   10  bld Ovi1 5g3  in                        CABI10667.5p ..............................................................CTCTTCTGCAGGGTCTGAGCGGCCCAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGAAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGA
  5   1   2   10 seed Liv1 5g3  in                        CAAR12654.5p ......................................................................................CAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTG
  5   1   2   10  bld Liv1 5g3  in                         CAAR6930.5p ......................................................................................CAATAGTTTGTAGGATCCACCACCCCGAGCCGGGACACTGAGATCGCCCCAATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGA
  5   1   2       bld In66 5g                         IMAGE:8964327.5p                                                                                               GTATGTATTTTTAACCTTCTTTAATTCAGTATTTTTATACACCATGTTCTGCTGCCTGAGCTTCCTCTTCACCCCCCTCCCCACTCCATTGATCGTTAGTCTCATTACTGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAGAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTGTTTCACCAGCGGCACCCACAGTGACCCCAGGGGGCGATGCTGACCATGAAATATAGTTGCAGACGCAACGTTTTATAAGATTACGAGAGCACTCCATGCCCTGACTTCGAATGTTTGCATATCTTTACCTGG
  5   1   0       chi Int1      in                        CAAP13891.5p                                                                                                                  AGGATCACAGCATCCTGATTGGCTATTCTTTCTGAATAACAATTATAACTTAGGGAGAGAAATACTAGTATAGGATTCTACAAGGGAACCATGAGTAATCACTATCCAGCAGCAGGAGAGGAGCACAGCATCCAGATTGGGTACTCTTTGTGAATAATAATAATGAAAATAACTTAGGGAGAGAAATACTAGTATTGGGTTCTACAGGGGGAACCATGAGTAATTGTTGTCCCATAAGTATAGGAAGGCACAAGCAGACAAGCAGAAGATAGGTTCTAGGTAGATGTTACAGCAGATAGCAGGAGAGGAGCATACATACTGATTGGGTACTCTTTGTGAATAATAATAATGAAAATAACTTAGGGAGAGAAATACTAGTATTGGGTTCTACAGGGGAACCATGAGTAATTGTTGTCCCATAGGTATAGGAAGGCACAAGCAGACAAGCAGAAGATAGGTTCTAGGTAGATGTTACAGCAGATAGCAGGCATCCTGATTGGGTACTCTTTGTGAATAATAATTAGCACAATGAGATGGAAACACAAGCAGTTATTACGGGTTCAAATTGGGATTGACACAAAGGGTGGGAGTTTCTTAGGAACACAGGGACAACATGGGATAATATTAGGAGACCAGGAATATTTCAAAGGGCAGAGACTTCAGTATGAGGGTTCAGGGGTACAATCAGTTTGGGGGTACAGTGATATCACAATAACAGCTTCTCTTTTCTTGCAGTACCTGGGGAAAGAGAAACTTCAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCCAGGGGGCGATGCTGACCCCATGAAATATAGTTGCAGA
  5   1   2       bld In66                            IMAGE:8963022.5p                                                                                                                                                                    CTTTTTTTTGAGGGATCCAATTAAAATTAAAATTCGTCCCGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCTCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACACAGTGACTCTCAAGGGGCGATGCTGACTCATGAAAATATAGTTGCAGACGCTCACCGGTTTATTAGAATACGAGAGCACTCATGCTCCTGACCTCGATGTGCCATATCTAACCTGGCATGCACCATGTTTGAGAGAGTGGTGCAGAACGTGATGTACCATTCCGGCGGCCAAGGTCG
  5   1   2       bld In63                            IMAGE:8959792.5p                                                                                                                                                                                               TGCTACATTACTAGTTGGGATCTCTGCTTTCATCTATGTGCTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAATGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAATTGAGTACCTGGGGAAAGAGACTTCAGAGCCAGTGCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACAGCGGCACACAGGTGACCCAGGGGCGATGCTGACCATGAAAATATAGTTGCAGACGCATCGGTTTATAAGATACGAGAGCACTTCATGCCTGAACTCGATGTTGCTATCTAACTGCCCATGCACCATGTTTTGAAAGAAGTGGTGCAAAAC
  5   1   2       bld In62                            IMAGE:8954776.5p                                                                                                                                                                                                ATCTTGTGGGATACTTACTTGCTTTTCATTCTATGTTGCTTAACGAAGCCTAAACCAGTCTACCCCCCCATAGATCTCAACCGACAGTCTATTGGCACCGAGGGCGGAGCCAGGAGATGCGCGTTGCTGAAGGATGACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAATTGAGTACCTGGGGAAAGAGAACTTCAGAGCCAGTGCCCCCCAGCCCAGTGATCTGAGTGTGGTTTGTTTCACAGCGCACACAGTGACCCCAGGGGCGATGCTGACCATGAAATATAGTGCGACGCACGCTATAGATACGAAGCACTTCATGCCTGAACTCGATGTGCAATCTTACTGCATGCAACATGTTGGAAAGAAGTGGGTGCA
  5   1   2       bld In63                            IMAGE:8959579.5p                                                                                                                                                                                                                                                                                             ATTTTTATATTTTTGTACTATTTCAATAAATTAAAAATAAATTCTAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTGAGAGAGTGTGCAGATAGTGATGTACCATTCCGCGCAAAGTCGGCTTCTTCAAGTGATGTCGATTACTGACTGACGATATGAAAGACTGAGCGACTCTTTTCCCCCACGGTACGGAGGGCTGCCTCA
  5   1   2       bld In54                            IMAGE:8946684.5p                                                                                                                                                                                                                                                                                                                                        ACAGACTCATGTCGTATTATTTCGATGACGCCAAGACCCTGTATGAAGTGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGCTTCTTCACGGTGATGTCGATACTGACTGACGAATATGAAGAGCTGAGCGACTCTTTTCCCCACGGTACCGAGCTGCTCAACAGGAAT
  5   1   2       bld TpA       in                  TTpA045j11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                        TGTTTATGAGGGGGCTCCATGTCTCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTNCACAGGATTTATGAACAGATACAAAGTGGAGCTC
  5   1   2       bld In62                            IMAGE:8954987.5p                                                                                                                                                                                                                                                                                                                                                                                                          GTACTGCAGGGAATGGAGATTGTTTGGGCTACAGGAAGCCAAACAGGCCATATCAATGGCTGACTTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGTGATGTCGATTACTGACTGACGATATGAAAGAGCTGAGCCGACTCTTTTCCCACGTACGAGCTGCTCACAGGATTTATGACAAGAACAAGTGAGCTCAGACGCATCAGACGCTACTGATCGCCGTGCAGAGTTTCGGGTGAACGATCACCACGACTTCATTGAAGTACTATTAGAGTCAGACCTGGGGACGTGCAGATGACGCTGTCATCGAGTCTCCTTTCAGCATGGCATAGCTAGACAGAGGCTGGACCTCACGGATACGAGTGGCTCGTAGAGCGTGGCGCGTATCAGTAACCGCGCGTTCCAGGCTAGCTACCCAATC
  5   1   2       bld In60                            IMAGE:8947770.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAAAAATATTTCGCTAAGGTATCCCTTTCGTATTCGTCCCCAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCCGGCGGCAAAGTCGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGCCGACTCTTTCCCCACGGTACGAAGGCTGCTCAACGGATTTATGACAGATACAAGTGGAGCTCAGACCCACTCAGAGCGCTACTGATTCGCCGTTGCAGGAGTTTCCGAGTGAACAGGATCTACCACATCTCTTGGGACA
  5   1   2       bld Liv1      in                        CAAR10019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTACAAACAGGTGGCTGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTG
  5   1   2       bld In60                            IMAGE:8951992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCGGCTCGACAGAGCAGAGTTACTTGGATCTGGGCTTATTCACAAAGGGTGCAGACCATCCACGGATCAGTTCATTGGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGAGCTCAGACGCATCAGAGCGCTACTGATCGCGTGCAGAGTTTTCGAGTGAACAGCATCATACGCACGACTCATTGGGACAGTACATA
  5   1   2       bld In66                            IMAGE:8967099.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTTTAAAGTCAACAAAAAAAAAAATTTATAAAAACACCATGGGATCTTTTCACAGAACCGACCAGACCGTTTGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCTGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCACAGGATTTATGACAGATACAAGTGAGCTCAGACGCCACTCAGAAGCGCTACTGATCGCGTGCAGAGTTTTCCGAGGTGAACAGGATCTACGCACGATCCATTGGGACAGTACTATTTAGAGTCAGATCCATGGGGGGACGGGTGCATGGATGGTGACGGCGCTGCTCCCATTCG
  5   1   2       bld In66                            IMAGE:8966396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATCTTTTCACAGAACCGACCAGAGGCAGTTATTGCAGAGCTGGCTTGTTTCACCTACTCTATGGTCGTGGTTCCACTCTATGATACACTCGGACCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTCTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAGATACAAAGTGAGCTCAGACGCCACTCAGAAGCGCTACTGATTTCGCGTTGCCAGGAGTTTTCCGAGTGAACAGCATCATACGCACGACTCATTGGACAGTACTATTAGAGTCAGACCCATGGGGGACGTGCAGTGATGGTGACGCGCTGCTCCATCGGACTACTCTCCTTCTCGAGCGCATGATGCGATTAGCATGGACACGATGCTTGTACTCCTAACTCCG
  5   1   2       bld In66                            IMAGE:8965054.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACACTCGATATATACGATCCCAACGATACGAATTCGTCCGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGAAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAGATGTCCAGGACACCATGGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGAAATGTCCTCTCCTTCTCAGAGCAGCATGGGGTGCAGATATTGAGCTATGACGACGATGCGCCGCTGGGTGCACCTTCTCCTACCCCGGGGAATTTCCAAGCAG
  5   1   2       bld In66                            IMAGE:8966681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCGGAAGCCATTGTGTATATTGTAAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGACGGTCCAGGACACCATGGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGGAAATGTCCTCTCTCCTCAGAGCAGCATGGGGGTGCAGATATTGAGGCTATGGAACGACGGATGCGCGCTGGGTGCACTCTCTACCTCGGGGAATTCCAGCAGGTCATGTGGTCCGTTGCGTGTATAGTGACTGATGACTGCTGATGACTACTTTCCTCATGGAGAGGGAGGGGTTATCCATGAC
  5   1   2       bld Abd0      in                       IMAGE:7000191                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGTAATAGAGCTGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTAAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGANCAGTACATATTTAAGAAAGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACNGCGGCTGCTCCATTTCCGGAATGTCTCTCCTTCTCAGAGCACATGGGGTGCAGATATTGAGGCTATGGACGACGATG
  5   1   2       bld In66                            IMAGE:8965616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCGATCTCTCCTTGGTTTTCTGCGACAAACCGGACAAGGCGCTGACTTTGCTGAACAACTGTGAGAAAGGGCAGATGCCGGTGCTGAAAGCCATCGTTGTAATGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGTGACGGCGGCTGCTCCCATTTCGAAATGTCTCTCTCTCAGAGCAGCATGGGGTGCAGATATTGAGCTATGACGACGATGCGCCGCTGGTGCACTTCCTACCCGGGATTCAGCAGTCATGTGGGCCCGTGCTGATCTGACTGTGACGTGCTGATGACTACTTTCTCATGAGAGTGTACAGACAGGTCAGGTACTGAACCGAGACGGAGCTGAATCAAGGGTCCTGGACTGGCAGGTTCTA
  5   1   2       bld In63                            IMAGE:8958236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAGAATGCCATTCGTTGTAATTGGAGCAGTTTGGTACCGAGCTGAAGGAGAGGGGAGCAAAGTGCGGAGTTGAGATTCTCTCCATGGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCTCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCTATGGACAGACGGAATGCGCCGCTGGGTTGCATCTTCTCTACTCCCGGGGATTTCACAGCAAGTCATGTTGGGGTCCTCGTGCTGTGTATACAGTGAACTGCTTGACGTGGCTGAATTGGACTACCTTTCTCAATGAGACGAAGTGTGTATCAGAATCAACGTGATCCAGTACTGAGATCTGGAAGACTGCAAGCCTGATCGATAGTGTCACTGAGTACAT
  5   1   2       bld TpA       in                   TTpA069b06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGCTGCTGGAGCTTGCAGATTCTCGTCCATGTGAGGAAATTGAGTACCTGGGGAAAGAGAACTTCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACACGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCTGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCACATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCAGCTTCTTCCACGGTGATGTCCGATTACTGACTGACGATATGAAAGAACTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCATACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACTGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAAATATTTGAGGCCTATGGACAGACCGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCACGTCATGTTGGGGCCCCGTTGCCGAGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCC
  5   1   2       bld In60                            IMAGE:8949864.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTAGGAAGGGTCCTCTCCTTATTCAAATTCGTCCCCAAGAAGCCAGTGCCCCCCAAGCCCAGTGATCTGAGTGTGGTTTGTTTCACCAGCGGCACCACAGGTGACCCCAAGGGGGCGATGCTGACCCATGAAAATATAGTTGCAGACGCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGAGACGAGAGGTGTGTATCAAAGGACCAACTGTTCCAGGTACTTGAAGACCCGAAAGACGCGGAGCGCTTGATTCGATGGTGGCTCCACACTGTGACATTGCCAGTGCTACTTATCGGAATCCTGTAATCCTGACTGAATAGAACTATTTTATTGCGCTAAGGGGAGATATCTGGC
  5   1   2       bld In60                            IMAGE:8948939.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTTTCAAATAAAGTATCCCAACTGATATCTTAAATCGTCCCACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGTGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTTCTCTACCCTCGGGGATTTCACAGCCAGTCTTGTTGGGGCCCCTTTGCCAT
  5   1   2       bld In54                            IMAGE:8944069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTTTTAATTAAGGCAGGTGCCCAAAAAATAAAAATCGTCCCGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCACGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAATCGTGGACAGGAGAGACATATTTAAGTGGCGCAGGGGGAGTACATGCTTCGAAAGATAAGACGTGTATGTGAGGAGCGCACTGTACGCAGTGTTTGTTGCACGGCGACGCCCTCAGTCGGTCTGTTG
  5   1   2       bld In66                            IMAGE:8963007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTAGACCCCTTGAAAATATAGTTGCAGACTGCTTACCGGTTTTATTAAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGAGAAGGAGAGGTGTGTATCAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGCGCTGGATTCCGATGGGTGCTCACACTGGGGACATTGCAGTGCTACTACGACCCTGAAATCGTGAACGAGAGACTATAGTTGCGCAAGGGGAGTACATGCTCGAAAGATAGAGAACGTGTTATGTAGGA
  5   1   2       bld In66                            IMAGE:8963202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTTTATGAGGTATTTTTATTAATAATATTTCGTCCAGAATACAGAGAGCACCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCATAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGCTACCTAACGGAACCCTGAAATCGTTGACAGGAGAGAACATATTTAGTTGGCGCAGGGGGAGTACATGCTCGGAGAGATGAGAACGTGTATGTGAGGACGCACTGTAGCGCAAGTGTTTGTGCACGCGAACGCTCAGTCTGTCTTGTGGAATCATCATTTCCGGAACCTCGAAGTCTCCTCC
  5   1   2       bld In54                            IMAGE:8944075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCGAGAACATATTGGGCTGGATTTTTATAAATATAAAAAATTCGTCCCCCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGACCCTGAATCGTGGACAGGAGAGACATTATTTAGTGGCGCAGGGGAGTACTTGCTCCGGAAAGATTGAGACGTGTATGTGAGAACGCACTGTAACGCAGGTGTTTGTTGCACGGCGACGCCTCAGTCTGTGTCTTGTTGGGAAATCACTA
  5   1   2       bld In54                            IMAGE:8841116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGAAGTTTAAAGGGTGAACATATGTTTCAAATTCGTCCCCCTTCATGCCCCTGACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTTCCTCCAATGGAGAAGAGAGGTGTGTATCAAGGAACCAACGTGTTCCAGGGTTACCTGAAGACCCGGAGAGGACGGCGGAGCGCTGGATCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTTACCTAACGGAACCCTGAAATCGTGGACAGGAGAAGAACATATTTAAGTTTGCGCAGGGGAGTACTTGCTCGAAAGAATAAGACGTGTATGTGAGACGCCACTGTAACGCAAGTGTTGTGCACGGCACGCCTCAAGTCTGTCTGTTCATCATCATCGGACCCGAGTCTCAGACTTGACCTAACTGCCTTGAAGCTTCGTCATTGACTGATCTCCGTCG
  5   1   2       bld In63                            IMAGE:8958391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCTGAACCTCAGATGTTGCCATATCTTACCTGCCCATGGCACACATGTTTGAGAGAGTGGTGCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAATCGTGGACAGGAGGAGGACATATTTAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAGATAGAGACGTGTATGGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACGCTTCAGGTCGTGTCCTGATGATCATCAATCGGACTCGAGTCCTTCCGGACTTTGCAGCTAACTTGGCTTGGAGGCACTCGTATAATG
  5   1   2       bld In54                            IMAGE:8943857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAGCGGTGACTTCTGAAACGCTATGCTCCCCCCAACTAAATTCGTCCCCAGACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTAAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGACATATTTAAGTTGGCGCAGGGGAGTACATTGCTCCGGAGAGATAGAGAACGTGTATGTGAGAGCGCACCTGTAGCGCAGTGTTTGTGCACGCGACAGCCTCAGTCGTGTCTGTGATCATCATCCGACCCGGAGTCCTCCCAGAACTTGCAGCTACCTGGCTGAAGGCATCGTAATGAATGAAACTCGT
  5   1   2       bld In66                            IMAGE:8966264.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTTTTTTTTAGCTTTTTTATCATTTTTCAAATTTCGTCCCCAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGAGTACATTGCTCCGGAGAGATAGAGAACGTGTATGTGAGGAGCGCCACCTGTAGCGCAGTGTTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTGTGATCATCATTCCGGACCCGAAGTCCTCCCAGACTTTGCAGCTAGCTTGCTTGAGGCATCGTATGAATGATCTGGTGTGCATAGACATGAGAGCCTACTGAAGAACCTGGTTTAACCTCATCGTGGC
  5   1   2       bld In60                            IMAGE:8952201.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAACTATATTACAATGATTACAAATAAATCAAAAACGCCGAACGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAGACATATTTAAGTTGGCGCAGGGGAGTACATTGCTCCGGAGAGATAGAGACGTGTATGTGAGAGCGCACTGTAGCGCAGTGTTTGTGCACGCCGACGGCTCAGGTCGTGTCTTGTGATCATCATCGGACCCCGGAAGTCTCCAGAACGTG
  5   1   2       bld TpA       in                   TTpA003e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGTGATGTACCATTCCGGCGGCAAAGTCGGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCNATAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCT
  5   1   2       bld In60                            IMAGE:8950477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTAAAATAAGGATTAAAATAATAAAAATTCGTCCCGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGCGCTGGATTCCGATGGGTGGCTCCCCCTGGGGACATTGGCAAGTGGCTACCCTAACGAAACCCTGAAAATCGTGGACAGGAAAACAACATATTTAAGTTGGCGCAGGGGAGTACATTGCTCCGGAGAAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGGCAAGGAGTTTGTGCACGGCGACAGCCTCAATTCTTGTCTTGTAGAATCATCATACAGCACCCCGAGTACCACCAGACTTATGCACCTTATCTTGGCTTGAAGGCAACCGTAATATTGTACTGGTGTGCCCTATA
  5   1   2       bld In66                            IMAGE:8963094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTTCTTCCAGGGTGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTCAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGGAGAAGACATATTTAAAGTTGGCGCAGGGGAGTACATTGCTTCTGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGTGTTTTGTGCACGGCGACAGCCTCAAGTCGTGTTCTTGTTGATCATCATTTCCGGACCTCGAGTCCTTCCTGGACTTGCAGCTAAACTTTGCTTGAGCCATCGAATGATGATCTGTGGTGCCATTATGCATGTGAGGAGGCCATACCTAGAAGGACTTGGGTTTA
  5   1   2       bld In66                            IMAGE:8965549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGATGTCCGATTACTGACTGACGATATGAAAGAGCTGAGGCCGACTCTTTTCCCCACGGTACCGAGGCTGCTAAACAGGATTTATGACAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGATAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGAGTACATTGCTCCTGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGATCATCATTCCGGACTCTCGAAGTCCTCCCAGACTTGCAGCTAAACTGCTTGAGGCATCGATGATGATCTGTGTGTCCAATACGCAGTGAGAAGTCATACCTAAGACTGTAACTGGCCAAGCAGCTGGGCCTGAGTCATTTTTGAGACAGGTGTGAGGA
  5   1   2       bld In54                            IMAGE:8943081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCTCATGATGCAATACTAGGTGTCGACTCGAATTCGTCCCAAGATACAAAGTGGAGCTCAGACGCCACTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCACGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTGGAATCATCATTCCCGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCATTAGGCAGTGAAGAGCATACTAGAGGACTTGTAACCTGGGCAGCAGCTGCTGAGTCATTGGCAGGGAAGATATCCACTTCACTCGGAAATGATGACGGTCGAAAACGGTTTCTCTTG
  5   1   2       bld In66                            IMAGE:8964924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATAACCTTTCTTTTTCAAAGAACCAAATTTAAAAAACGTCCGACGCCCTCAAGAAGCGCCTACTGGAATTCGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTGAAGCATCGTATGATGATCTGTGTGCATAGCAGTGAAGAGCATACTAAGACTGCAACTGGGCAGCAGCTGCTGAGTCATGACAGTGAGATTCACGTGCACTCGAATGATGACGTTCGAAACCGTTCTGATCGAGC
  5   1   2       bld In66                            IMAGE:8964750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTCCCGATGTCATAGGACTAGCCCAATATTAAAGCCTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAAGCAGTGAAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCACGTGCACTCGGAAATGATGACGTCGAAACGTTCTTGACACGACGCTGAAAGCAGCGAGCGAGGTGGCAAGCACTTCAGAGCCACATAGAACGTCTGTATATGCGGAGCC
  5   1   2       bld Tad5                                 XZT61728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCCGTTGCCAGGAAGTTTTCCGAGGTGAAACAGGGAATCATACGCAACGACTCCATTTGGGACAAGTACATATTTAAGAAGGTCCAGGACACCATGGGGGGACGGGTGCGAGTGATGGTGACGGCGGCTGCTCCCATTTCCGGAAATGTCCTCTCCTTCCTCAGAGCAGCATTGGGGTGCCAGATATTTGAGGCCTATGGACAGACGGAATGCGCCGCTGGGTGCACCTTCTCTACCCCCGGGGATTTCACAGCAGGTCATGTTGGGGCCCCGTTGCCGTGTAATACAGTGAAACTGGTTGACGTTGCTGATATGAACTACTTTTCCTCCAATGGAGAAGGAGAGGTGTGTATCAAAGGAACCAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCACGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGGCAAGCAC
  3   1   2       bld Liv1      in                        CAAR10019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGGAACAAACGTGTTCCAGGGTTACCTGAAAGACCCGGAGAGGACGGCGGAGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTG
  3   1   2       bld Abd0      in                       IMAGE:7000191                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTCNAAGAACAACGGTTCCAGGTACTGAAAGACCNGAGAGACGGCGAGGCGCTGATTCGATGGGTGGCTCCACACTGGGACATNNGGCAAGTGGCTACCTAACGGACCCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAGAAAAAGAATAAATATAAAAGG
  3   1   2       bld Liv1 5g3  in                        CAAR12654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTGTCCCAGGGTTACCTGAAAGACCCCGAGAGGACGGCGGAGGCGCTGATTTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGACCCCTGAAAATCGTGGACAGGAAGAAGAACATATNTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAAAAAA
  3   1   2       bld Liv1 5g3  in                         CAAR6930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGCGCTGGATTCCGATGGGTGGCTCCACACTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAAAAAA
  3   1   2       bld Tad5 5x3  in                         XZT45362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGGACATTGGCAAGTGGCTACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCACGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATC
  3   1   2       bld Int1      in                        CAAP13891.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTAACGGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAGG
  3   1   2       bld Tad5 5g3  in                         XZT56194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTTCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAGGAAATAATTGACTGAAAAAAAAAAAAAAAGG
  5   1   2       bld Liv1      in                         CAAR2089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCTGAAAATCGTGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATANATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCNNGATAGAAATAAAAATAA
  3   1   2       bld Ovi1 5g3  in                        CABI10667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGACAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAG
  3   1   2       bld TpA       in                    TTpA045j11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGAAGAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCACGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGGGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT51248.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAACATATTTAAGTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCACGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATC
  5  -1   2       bld Abd0      in                       IMAGE:6999235                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCCAATTGGGGGGGGAAGATTTTTTATGGCCGGGGGAAAATTTCTCGGGAAAAATAAATAATTTTTTTGGGGGCCCCCTTGGCCAGGGTTTTTTACAGGGGACACCCAATATGGTTTTTTTGGAAATTTCTTTCCGGCCCCGAAATCCTCCCAAATTTGAGGATAAAATGGCTTAAAGCCTTTCTAAGGTAATTTTGTGGCCAATAAGGCCTGAAGGAGGCCATACTGGAGGAATTGTTAAAATGGGCAAGCAAGCTGGCCGGAATCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGAAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGTTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTA
  3   1   2       bld Liv1      in                         CAAR2089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGGCGCAGGGGGAGTACATTGCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAATAAGGAAATAATTGACTGAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT29865.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTCCGGAGAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCACGGCGACAGCCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCCGAAGTCCTCCCAGACTTTGCAGCTAAACTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCACGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAACGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAATCAATGAACTGTACATATTGTTTTCCAGATAAGAAATAAAAATAATAAAT
  3   1   2       bld TpA       in                   TTpA069b06.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGATAGAGAACGTGTATGTGAGGAGCGCACCTGTAGCGCAGGTGTTTGTGCAAGGCGACAACCTCAAGTCGTGTCTTGTTGGAATCATCATTCCGGACCCGGAAGTCTTCCCAGACTTTGCAGTTAAACTTGGCTTGAAGGCATCGTATGATGATTTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGACTTGGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTTAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTTTTGACACCGACGCTGAAATCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTATCGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAATGTTTAACCCCCCCGGGATGTTCCACTGAGTCCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAATTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTCTATAAACACCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTAATGTGAATCAATGAACTGTACATATTGTTTTCCAGCTCTAGTAGGGTAATATAAATACGGCAATAATTACTGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA003e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGCTTGAAGGCATCGTATGATGATCTGTGTGCCAATAAGGCAGTGAAGGAGGCCATACTAGAGGGGACTTGTTAAACTGGGCAAGCAAGCTGGCCTGAAGTCATTTGAGCAGGTGAAAGATATCCATGTGCACTCGGAAATGATGACGGTCGAAAACGGTTTCTTGACACCGACGCTTGAAAGCCAAGCGAGCCGAGGTGGCAAAGCACTTCAAGAGCCACATAGACAGCCTGTATGCGAGCCTCAATGAGTAACGCTGCCCCCTGCTGGCTGGGCTATGGCTTCCCATGGAAGCCCCCCCTGTGCAAGTTTAACCCCCCCGGGATGTTCCACTGAGACCATTTGGACCGCGTTCAGTTACACTCAGAACCTCTCAGGACATTTGGGTAACTATGGTGGCAGGATGAATGGGTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTCTTTATAAACACCTAGAGGGGAGGAAGAGGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGTGACTTTTTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA003a03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACATTTGGGTAACTATGGTGGGAGGATGAATGGGTTATCCCAGGCAAAACAGGAGGCCTAGGGGCCAATCCTTTCTATAAACCCCTAGAGGGGAGGAAGAGCCACATGTAATGTACAAAACTGGCTAAAGAAAAAGAATGAAAGTAATAAATATTGCACTTTTTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)