Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-XZG51492.5                         1423 END     2           2        0                HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABD12121.3                         104 END     13         19       12                (no blast hit)
     3   2.0    0Xt7.1-CABJ4431.5.5                         58 END     1           1        1                DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012076294 Xt7.1-XZG37792.5 - 68 ESTs
                                                                       .-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG37792.5                      CACCTCTTTCTCCTTATGATGGGAGCCTGTGAGCGTTAGCAGTGGGAGACAGCTGCATGTGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAATAAAAAAACTTCAAGCTATTTATATAACCGAAGGCGTAACACGAGTGGTGATATCGCTTGCATTTTCTGCTTTCCATAGGCCACTGTCAACA
                                                  Xt7.1-CHK-1008224488                            TTTCTCCTTATGATGGGAGCCTGTGAGCGTTAGCAGTGGGAGACAGCTGCATGTxxGxGxGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAATAAAAAAAxxxxAAGCTATTTATATAACCGAAGGCGTAACACGAGTGGTGATATCGCTTGCATTTTCTGCTTTCCATAGGCCACTG
                                                      consensus depths                           2     2     2     2     2     2     2     2     2     2     6    10     9    12    10    13    11    14    11    14    12    16    12    16    14    17    14    17    15    18    15    18    16    18    15    18    15    18    15    18    17    18    17    17    17    17    18    18    18    18    18    18    18    19    18    19    17    19    17    19    17    19    17    19    16    19    17    19    17    19    17    20    18    20    18    20    18    20    18    20    18    20    18    20    18    20    19    20    19    20    17    20    17    20    17    20    17    20    17    20    17    20    17    20    17    20    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    15    17    15    17    15    17    14    16    14    16    14    16    14    15    14    15    14    15     6     8     5     6     6     8     6     8     6     8     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     4     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     6     5     6     6     7     6     6     5     5     6     6     6     6     7     7     7     7     7     7     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     7     8     8     9     9     9     9     9     9    11    11     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     7     9     9    11    11    13    12    14    12    14    11    15    11    15    10    14    10    14    10    14    10    14    11    13    13    15    12    15    12    17    12    17    12    16    12    16    13    16    13    16    13    15    14    15    15    16    15    16    15    16    15    16    15    16    14    16    14    16    13    15    13    15    14    16    15    17    15    16    15    16    15    16    15    17    16    17    16    16    16    16    16    16    17    17    19    19    19    19    19    19    20    21    20    21    20    21    20    21    20    21    20    22    21    23    22    23    21    24    21    24    21    25    21    25    21    25    21    25    21    25    21    25    20    24    19    24    18    24    13    17    13    18    11    17    10    17    10    17    10    17    10    17    10    17    10    16    10    16    10    15    10    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16     9    16    10    16    10    16    12    18    12    18    11    17    11    16    11    16    11    16    11    16    11    16    11    16    11    16    11    16    11    16    11    16    11    16    10    11     6     7     6     7     6     7     6     7     6     7     5     6     2     5     2     4     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A------
                                               BLH ATG     311    1826                      
                                               BLH MIN     311     209                      
                                               BLH MPR     158     209                      
                                               BLH OVR     311      49                      
                                               CDS MIN     311     209                      
                                               EST CLI      50      24                      
                                               ORF LNG     311      11                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sc ---- 1e-008     NP_012685.1 Delayed Anaerobic Gene; Dan4p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 5e-021     XP_425145.2 PREDICTED: hypothetical protein [Gallus gallus] ============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-024     NP_509826.1 dystroglycan (65.6 kD) (dgn-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 2e-037     NP_725523.3 CG18250-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 5e-115     XP_786589.1 PREDICTED: similar to dystroglycan 1 [Strongylocentrotus purpuratus] -----------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 0          NP_775381.1 dystroglycan 1; dystrophin-associated glycoprote [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 0          NP_004384.1 dystroglycan 1 precursor; 156DAG; Dystrophin-associated glycoprotein-1;alpha-dystroglycan [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 0          NP_034147.1 dystroglycan 1; dystrophin associated glycoprotein 1 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAH73500.1 LOC398500 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 0          NP_001082480.1 dystroglycan [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          NP_001016518.1 dystroglycan 1 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG37792.5                                                   TGA------------------------ATG------TGA------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------------------------ATG------------ATG---------ATG------------------------------------ATG---------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------ATG------------------------------------ATG---------ATG---------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------TAA------------TGA---------------------TGA------------------------------------------------------TAA------------------------------TAA------------------TAGTAA---------------------------------------------------------------------------------------------ATG------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TAA---TGA---------------------------------------------------------TGA---------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------TAA------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Neu  FL                     TNeu036h01.FL-Sanger                                                                                                                                     CTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn2 5g3  out                       CAAJ16112.5p TTTAGCCGTCAGCAGGAAGAGCACCTCTTTCTCCTTATGATGGGAGCCTGTGAGCGTTAGCAGTGGGAGACAGCTGCATGTTTGGGGAAAGAGAATAATCCTTTATATGTGGCAGCTCTCAGCATCATGGCTCTTTCCTAGTAACCACTTTCCATTTTGCTGAGGACAGAAAAAAATCCCAGAAGGAGGCAGAGAGTCATGAAAGGACTGGTCTGAGCATTTCATATGTCAGAGCCTCGAGAATCCATGGGCTGAAGAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCCT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ11177.5p .....................CACCTCTTTCTCCTTATGATGGGAGCCTGTGAGCGTTAGCAGTGGGAGACAGCTGCATGTTTGGGGAAAGAGAATAATCCTTTATATGTGGCAGCTCTCAGCATCATGGCTCTTTCCTAGTAACCACTTTCCATTTTGCTGAGGACAGAAAAAAATCCCAGAAGGAGGCAGAGAGTCATGAAAGGACTGGTCTGAGCATTTCATATGTCAGAGCCTCGAGAATCCATGGGCTGAAGAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGGTCATCCTGAGGGACACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCT
  5   1   2       bld Gas  5x3  out                  TGas141f12.p1kSP6                                                                       GGGGGAGTGACGGGAATGAGCGGCGGCCTGTGACAGGAACCGGAATTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGA
  5   1   2       bld Gas                            TGas003j04.p1kSP6                                                                        GGGGAGTGACGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGTCGTAAATAAAGGGAAATACCTGGCCACAAGGATAGGACACAGAAACACACGGGAAATGTGCGTGATGAAGGAACACC
  5   1   2   14  bld Te4  5g3  in                         CAAN2976.5p ........................................................................GGGAGTGACGTGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATG
  5   1   2   14 seed Brn2 5g3  out                       CAAJ14428.5p .............................................................................TGACGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCA
  5   1   2   14  bld Brn2 5g3  out                       CAAJ16300.5p .............................................................................TGACGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGT
  5   1   2   14  bld Te3  5g3  out                       CAAM10307.5p .............................................................................TGACGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGGAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATCTGACTGTAATTTTGGATGCGGACTTGACAAAA
  5   1   2   22  bld Gas7 5g                              XZG37792.5p ..............................................................................GACGGGAGTGAGCGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAAATTTGGATGCGGACTTGACAAAAATGA
  5   1   2       bld Neu  5g                        TNeu036g11.p1kSP6                                                                                  GGAGTGAGCGGCGGCCTGTGACAGGNAGCCGGATTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGNGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAA
  5   1   2       chi Tbd0 5x3  in                       IMAGE:6977061                                                                                       GGGATGGCGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATACTGGTGCTGCTTATGGCTTCTTCATATTGGCTAGTCCGGCCTAGATACCCGATGTAAGCTGTCCTTAAATTTAACACCCACGTAGGATCCCACCTACTCGTGGGATCTTCCGTAGACATATTTTTCGTTGCCTGTCTGTTACCCGCCATACCCCACCCTACTGATTTATCTCCACCGATCTTGGTATTCTCATCACTCATGAGCCCCCGCTCTGCACCTTCCCCCTACTTACAACCCATGCGCCTTCACTCAACCCTAACTCATGACTATTTCCACCCTGATCACCCTGACGCCCTACTACAGAAGATCTCCTTGCTTTGCCTCCACCACTTTCATACTCAAGCCCGTCTCTCACTTCACTTATTCAGCTTTTTTTTCCCCTCACCTATCCTCTCCTATGGCCCTTTCTCATTCTCTCCTACATACAGGCCCATCCTCCCCAGCTCATN
  5   1   2   14  bld Te3  5g3  out                       CAAM15747.5p .............................................................................................CGGCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGCACCCGATG
  5   1   2   14  bld Brn2 5g3  out                       CAAJ14650.5p ...............................................................................................GCCTGTGACAGGAGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ24208.5p ...........................................................................................................AGCCGGAGTTACTAGCAGCTCCGGGCTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGG
  5   1   2       bld Neu  FL                        TNeu036h01.p1kSP6                                                                                                                                      CTGAGCGGCCTCTCGGGAGCGGCAGGAAAAGACGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAA
  5   1   2   14  bld Te3  5g3  out                        CAAM1767.5p .......................................................................................................................................AGCGGCCTCTCGCGAGCGGCAGGAAAAGACCGGGAGTTATATGCCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGT
  3   1   2       bld Gas  5x3  ?                     TGas141d12.q1kT7                                                                                                                                                                   AAAGACCGGGAGTTATATGCCTCTTTTCTTCGTATGTGCCTGCCGCAATAAAGGGAAATACTGGNCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGAAAAAAAAA
  5   1   2       bld Brn2 5x3  out                       CAAJ23313.5p                                                                                                                                                                                   CCTCTTTTTCTTCGTATGTTGCCTGCCGCAAATAAAGGGAAATACCTGGCCACAAGATAGGACACAGAAACACACGGCAAATGTCCGTAATGAAGGAACACCGTGACCACTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGGTTGATATGTCTGCCTTCATGGCTGGGCCCGGAAATGCCAAAAAAAGTAGTTGA
  5   1   2   22  bld Tad5 5g                              XZT18853.5p ...............................................................................................................................................................................................................................................................................................CTAAGACCAGACGAGCTGCTTCCTACGCTGAAACAGAACACCAAAATGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAANNAAAAAAAAAAAANAAA
  5   1   2   15  bld Te3  5g3  out                       CAAM15483.5p ............................................................................................................................................................................................................................................................................................................................................TGGATATTAGGTGTGCTGCACTTTCCCTTCCCATGCTGAGGACTATAATGGTGCTGCTTATGGCTTCTTCCGCTTGGTCAGTCTGGCCTAGCGATCCAATGGAAGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGATTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGACCCC
  5   1   2       bld Te3       out                        CAAM9931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTGTTCAGGACTGGGACAATCAGCTAGAGGCCTCCATGCATTCGCTGTTCCCTGAAATTAAAGAGGCAGTGGCACCAATGACAGGAATTCCAGACAGTTCTGCTGTGGTTGGCAGGCCCTTTAAAATCCACATCCCCACAGAATTTCTCGCTTCCAGTGGAGAAACAATCAAGATTTTTGAAGTTGGAAAGGAGATTTTGCCATCTTGGTTACACTGGGAAGCTAATTTTTTGCAAGGTCTTCCCCTTGATGGTGACAAAGGGGTCTATGACATTTCTGTAGCCTCCATGCGCCTGGCACCAAATGGAAGTTATGTAACCCAAACCGCAGATGTTTTCGCTGTAGAGGTTCATCCTGAGGACCACAATGAGCCTCAATCTGTGCGAGTGGCAGGACAGGAAACCGCTGAAGCAACTCCTTTTCTATAT
  5   1   2       bld Te1       in                        CBWN17434.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACAGGAAACCGCTGAAGCAACTCCTTTTCTATGTGGCACCGATGAGCCAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCACGCACATTTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAA
  5   1   2       bld Brn2                                CAAJ11542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAGTAACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAA
  5   1   2       bld Gas7      in                         XZG22045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAATTCTGACTGTAATTTTGGATGCGGACTTGACAAAAATGACACCAAAGCAGAGAGTAGATCTTCTAAACAGAATGAGGGACTTCTCTGAGGTAGAACTTTATCATATGAAATTAGTCCCAGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCCGCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACC
  5   1   2       bld Brn2      out                       CAAJ12998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        NNCGTCCGGTTGTAAACAACAGACTGTTTGATATGTCTGCCTTCATGGCTGGGCCAGGAAATGCAAAAAAAGTAGTTGAAAATGGAGCCTTGCTATCATGGAAGCTTGGGTGTGGAATGGATCAGAACACTGTTCCAAACATCAGTTCTGTAGAGGTTCCTGCTAAAGAAGGCACAATGTCTGCCCAGCTTGGTTATCCTGTTGTAGGCTGGCACATTGCAAATAAAAAACCCCAAATGCCTAAGCGAATTAGAAGGCAAATATATGCCACACCAACGCCTGTTACTGCCATTGGACCACCTACTACAGCCATTCATGAGCCTCCAGAAAGAATTGTGCCAACTCCCACTTCTCCTGCAATTGCTCCTCCAACCGACACAACAGCTCCTCCAGTTCGAGAACCTATACCTCTTCCAGGAAAACCAACAGTTACAATAAGAACAAGGGGTGCTATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTAT
  5   1   2       bld Te4       in                         CAAN4849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTATTCACACTCCCACTCTTGGTCCAATCCACCCAACTAGGATAATAGAAACTACTAGCATAGTTCGCCCAACTATCACCAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGAC
  3   1   2       bld Te1       in                        CBWN17434.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGCACATTTTTGTAGAACCAACTGCTGCAGTTACACCTCTTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACTGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGA
  5   1   2       bld Brn2      out                       CAAJ14996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCCTTCTACCACTACAAAGAGGCCAAGAACCACAATGAAGCCGCCCACACCACCAACTACTGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTTAATGTTTCTTTATCGTTCTCGGGGAGC
  5   1   2       bld TbA       in                   TTbA042k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACCACATGAAGCCGCCCACACCACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTAGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAANAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGC
  5   1   2       bld Neu                            TNeu140h08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCAACTACCGATTCTTCTACCACAACAACAAAGAAACCCACCAAAAAACCAAGGCCCAGACCCCCCAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTATAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTATAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCT
  5   1   2       bld Tad5      in                         XZT51112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGCCTCTTGCTACTACCAAAGCACCGTCCACAAAAGTTGAGACTACATCGCCAAGCCGTACACGTCCTTCTACCAGTGGAGTACCCAACACTGACCCTGAACTTAAAAATCATATTGATAAGGTTGTTGCATGGGTGGGTACCTATTTTGAAGTTAAAATTCCCCCTGACACATTTTATGATAAAGAAGATGGCACCACTGATAATCTCCAGCTCTCTTTGGCGCCAAGACAAAAGGCTGGCCTTGGAGAGAAGATGTGGGTAATGCTCAATAGCACTAGCCAGGTTATGTATGGAATGCCTGACTATACACACATTGGAGACCATGAGTATTACTTGAGAGCTGCAGACAAAGCAGGACGCACTGCGGTGGATGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAAT
  5   1   2       bld In60                            IMAGE:8951431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGGGGGTTGGATGGCTTTAGAAATCCAAGTCCGTAATCTGTTCCAAAAACAACCATCCACTGTTAAATTTCATGCAAAGTTCCACGGGGATCACAATGCTGTCATTAATGACATTAATAAGAAAATTCTGCTAGTCAAAAAGTTGGCTTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACATCCTCCTGACCAAGACAGCTTGGGGGGAGTACACACTCTTAGGATGAGACTCATGCACCTCCTATCACTCCCTCATCTCCAAGCACCTATGAGTAAAGGTCACGCCCAAAACATGACTCCATACTGGTCACCTACCTC
  5   1   2       bld In62                            IMAGE:8955552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGCTTTTAGCTTTTCGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCTCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCTCAATGCACTCCCTTATCAACCTCCCTCACCTTCACAGCACTATGGAAGGTAAGGGTCACGCTCAAAACATGACCCATACCGGTCACCACCTCCTTATGTACTCTTACGAACGTGTGCTGAGTGAAGGAAAAGGTGCTGTGAGTTCAATCATGTTGTCGAGAGATGATAGCTGCATCTGTGTCGAAACGAAACCTGCTGTCTAGCAAATAGACTGAACTTTAATGACTCAATTAACTGCTTCTTCCGATGGGAATGATATGCTTGCTAAGATTTCGATGATTCCAATGGTCGTCGAATACATGGCTAACATAGAAGTAGCTAGTTCATCGGGGCATGGTTC
  5   1   2       bld Tad5      in                         XZT42395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTGCTTTTGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATGTTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTG
  5   1   2       bld Tbd0      in                     NISC_nl06h05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTGATAGAAACAGTAGTTCTATTACTTTGCATAATATCACCAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATGTTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTT
  5   1   2       bld Hrt1      in                         CAAQ1157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTTCCAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGC
  5   1   2       bld Mus1      in                        CABH10089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGTTCTGTGGTCGTGGACTGGACAAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATATTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCANAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATG
  5   1   2       bld Egg       in                   TEgg077m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGTGGTCGTGGACTGGACAACAATACTTTCCCTGTAGAACCGTGTCCAGTAGAGCAAGTAGAAGGTGTCGGCAAAAAGATCTACGATGAACGTGGCAGTCCTCGGCAACATTTTGTTAACGCAGTGGAGCCGGAATTTAAACTTTTAAATGTTTCTTTATCGTTCTCGGGGAGCTGTAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCC
  5   1   2       bld Gas       in                   TGas116b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAGCATAAAAAATTCAGGTACATACCTATGAGAGCAGAGGAACCCATACCCACTGCAGTGGCACCAACCGTAGCTGTAGACAGAAACCTGGAGAAGAGAAGTGAGGATGATGTCTACCTTCACACTGTTATTCCTGCGGTGGTGGTGGCTGCCATTTTGTTAATTGCTGGCATCATTGCTATGATTTGTTACCGGAAGAAGAGGAAAGGCAAACTGACAATAGAGGATCAGGCAACTTTTATTAAGAAGGGTGTTCCAATTATTTTTGCTGATGAATTAGATGACTCCAAGCCTCCTCCTTCTTCCAGTATGCCACTGATTCTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTG
  3   1   2       bld TbA       in                    TTbA042k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTATGCCACTGATTNTAAAGGAGGAAAAAGCTCCCCTTCCTCCTCCCTGAGTTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCNACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Te4       in                         CAAN4849.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAATCC
  5   1   2       bld Te4       in                         CAAN1832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGAAAAAGCTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCCGTC
  3   1   2       bld Tad5      in                         XZT51112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCCCTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCNCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTT
  3   1   2       bld Te4  5g3  in                         CAAN2976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTCCTCCTCCTGAGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTACTATAAAGGACAGCTATCTATACTT
  3   1   2       bld Gas7      in                         XZG22045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTATCCTAATCAGAATGTTCCAGAGACAATCCCCCTGAAACAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTT
  5   1   2       bld Hrt1      in                         CAAQ5226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGAGACAATCCCCCTGAACCAAGACAGCTTGGGGGAGTACACACCTCTTAGGGATGAGGACCCCAATGCACCCCCTTATCAACCTCCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTT
  5   1   2       chi AbdN                               IMAGE:7020833                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATAAAATAATATATGATATATATAATAATTTTNTGTTTGGTAATTAGGTGACCTATATAACAGTTTCGGTTTCGATTCCCGGGATGTACCTCCTTAATTAACAGTGTGCTGAGTGAGAGGTAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATATCAGGAAAACTCTGCTGTTCTAGGCTAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTTATAATATAATTATTTTGTTTTTCCTTTTATTTAACGTGGGGTCTAGAGCTTCCTGGTCCTAAATAATAATGGTATTGACTAAAAGGGTATCTTTGGAAAAACCGGAAAACATCAAGAATTTTTTTTTACATTTTTTTTTACCATTTTGTAACCCCCTCTGGGGTCCTTTTCCATTTTTCCTTTGTCAATATAAAAAGGGGGGAACATAGACTCTCTTTATATCCCTTATATAGAACCTCTTTATATAAAAAGAACATTGGGACCACGATACGCTCTAATATATGCGTCGAATTTCTTTCTCCCCAATAAGCTACCCCCCCGCCGAGGGGGGGTGGTCTTTTCTTTCCTTTACCCATGTAAACCACGAACACGNGATATATTTGAGTGGACAAAAAAATATTTTCCCCCCCCCGGTTGGGGGTGTTGGGGCGACAATTTTTTATGTGTGAGGCACCTGTTTTTTTTTTATTCACCCCCTCTGGGTGCGAATTTCTTTTTATCCGAAGAAAAAAAATACTCCCCTTCTCTTATTTGTGNGTGTGGGACAAGAACTACGACCCAGCTCTACAAGAAGAGGGTATTTCTTACACACGTGCGTATGTATTTATAAAAAAAAGAGAAAACACCCCANCATCCCCTATGTTTTTATTTCCCCCTCGAGGGGGGCAAAAAAAATATTTCTCTTTGGTGTATGTCACCCCCCCCGGAGGTAAAAAACACCCCCGAGGTTGACTACACTAATATAGAAAAAAAGCNCCGTGCATTGCTCCGAACCACTCCTATGTTGCTTNTCAAAGAGAGAAATAAGTTGGGGTAAAAACAAGGCCTGTTCTATCCTTTGGGTGCCCTAAGAGAAGAGCACTTCTTGTGTGGGCACAGTTGAACAATAATACATCACTGTGTTTATATTTTTN
  3   1   2       bld Gas       in                    TGas116b15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCCACCCTTCACAGCACCTATGGAAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTTTGCTGTTTTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGAGGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGGGGCCTTTTGTTTTTTTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGGGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAATATATAAATTTaaaagaataaaaaaaaataaaaaaaaaaaaaaaagaataaaaaaaaaaaaaagaataaaaaaaaaaaaaaaa
  5  -1   2       bld Gas       out                  TGas082g16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTATATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       bld Egg       in                    TEgg077m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGTAAAGGGTCACGCCCCAAAAACATGACCCCATACCGGTCACCACCCCCTTATGTACCTCCTTAACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTGGTTCTATATANAAGGACAGCTATCTATACTTAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas       out                  TGas082i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGAACAGTGTGCTGAGTGAGAGGAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGCCGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAAAAAAAAAAAAAAAAGCGG
  5   1   2       bld Brn2                                CAAJ13525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAAAGGGGGCTGTGAGTTCCAAACCAGTGTTGTCCGAAGAGATTGATAGCCTGCAATCTGCTGTCGGGATAACAGGAAAACTCTGCTGTTCTAGGCAAAGAGTAAAGACCTGGAGACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGGTGTTTTAATTCTGTTGCCCCTGCCCCGCATTGCCAG
  3   1   2       bld Hrt1      in                         CAAQ5226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTTTTTATAGTAACTCCACATTATACATGCCTCCTTCACAGATTGTGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTT
  3   1   2       bld Mus1      in                        CABH10089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTTATAGTAACTCCACATTATACATGCTCCTTTCACAGATGTGGGAAAATATGGGACATATGTCATTTGCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTT
  3   1   2       bld Hrt1      in                         CAAQ1157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATATGGGACATATGTCATTTGCCCTAACGATTTTTTTCGTATTGGTATTCATACAGATGTGTGCTCCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTT
  3   1   2       bld Tad5      in                         XZT42395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGTTCTAGATATTTAACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTAT
  3   1   2       bld Tad5      in                         XZT19045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTT
  5   1   2       bld Tad5      in                         XZT19045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGATTGCAGGCTTTAAAGACACTAAAGAGGAAAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAAAAAGG
  3   1   2       bld Tbd1      in                        CBXT16636.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGATTTGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTTTGCTGTTTGCCTTTAACACTAACCTGTATTATTATTATTTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTTTGCACCAACCCCCATAGTCACAAGGAACCCCCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAATAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT16636.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTGATTGGACGATATGTTCAGCACTGGGGTGGCCTTTTGTTTCTCTGCTGTTTGCCTTTAACACTAACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAATAAAAAAAAAAAAAAAGGGCGGC
  5   1   2       bld Neu                            TNeu032l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCGGGGGCTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGGTGCCCCTGCCC
  5   1   2       bld Te5                                  CAAO7432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTGTATTATTATTATTTTTTTTTCCTTTTATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAATAGAAACGCTTCAAGCTATTTATATAACCGAAGGCGTAACACGAGTGGGGATATCGCTTGCATTTTCTGCTTTCCATANGCCACTGTCAACA
  3   1   2       bld Te4       in                         CAAN1832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTACGTGTGTCTAGAGCTTCAGGTCATAACAAAATGGTATGACGAAAGGTATCTTGGAAACGGAACATCAGAATTTTTACATTTTTACATTTACTCCTGTCTTCTTTCTATATAAAGGACAGCTATCTATACTTAAAAATGAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCGGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAAT
  5  -1   2       bld Neu                            TNeu144i10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCTTCAGGTCATAACAAAATGGTATGAGGAAAGGTATCTTGGAACCGGCACATCAGAATTTTTACATTTTTACATTCACTCCTGTCTTCTTTCTAGAGAAAGGACAGCTATTTATACTTAAAAATGAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACACCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTATGTGCCCGGAGACCGGCCCATAAACGCCATCGCCTTTGGCAAGACATGGCAAGCGTTATGGTCAGGAGATCGTGCATGCAAAGCTTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCCATGGTATTTTTTTTAGGTAAAGACCCAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGATTTTCTGCACCAACCCCCATAGTCACAAGGAACCACTTGACACACACAATGGTGCTCTCCCCCCTAAAATGGAAGAGAGCTATTCAATCACTCTTTTTTTTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Tbd0      in                     NISC_nl06h05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGAAAAAAAAAAAATCCAGCCGTGTTTCAGAAAGTTGTATTCCTGTGCATTGACTTTACCTGATTAGAAAACATAGTGCAACCCCAAGTTACTGCTTAAAAACCTCCTTTCCCTGGCAATTCTGTGCCCAGAGACCGGCCCATAAACGCCATCGCCCTTGGCAAGACATGGCAAGCGTTCTGGTCAGGAGCTCGTGCATGCAAAGCCTGTTATTTTTGGCTTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTTTGCACCAACCCCCATAGTCACAAGGAACCCCCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATaaaataaaaaaaaaaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Tbd0 5x3  in                       IMAGE:6977061                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAATTTGGCCCGAGACCGGCCATTAACGCCATCACCTTGGCAAGACATGGCAAGCGTTTTGGTCAAGAGCTTGTGCATGCAAAGCCGTTATTTTTGGCTGAAACGCTTCTTTTATTGAAACACAGCCATGGTATTTTTTTAGGTAAAGATACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCAATGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTTTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAACAAATTTTTGATACAGCCTCAAATTGTTTTATTAAAAAGAACTTATAAAATAGAAACGCTTCAAGCTATTTATATAACCGAAGGCGTAACACGAGTGGTGATATCGCTTGCATTTTCTGCTTTCCATAGGCCACTGTCAACATTTTAGAGCCATATTTTTTGTTTGTTTTTTTGTTTTTGTTTTTTTTAAAGATATTTCTATTAAGTTTTTAATGTATTTATCATCATTTCGGGGGGATGGGGGTGTTGGAGGCTTTATACACTTGTTTTTCCCCCCTGAAAATAAATTTTGGTTTCTAAGCATGATTTTTATTTTTCTTGACTGCTTTGATTTTTTTTTTTTATTTTAATGAGATGGGAAAAAAAAACTTTGCAATAACGTTTCATGCCTTTTGGGTGTTGAGGATTGGCAGATTCTGCACATA
  5   1   2       bld Te1       in                         CBWN8467.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                         CBWN8467.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAATATTTAATGTTGTTTTAATTCTGTTGCCCCTGCCCCGCCATTGCCAGAGATTCAGTGGGCAGTAGTCTCAATCATTTGCTTTTCTGCACCAACCCCCATAGTCACAAGGAACCACCTGACACACACACTGGTGCTCTCCCCCCTAAAATGGAAGATAGCGAGCAATCACTCTTTTTTTTAAAAGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)