Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA015a11.3                         33 END     1           3        3                protein kinase Cds1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012076306 Xt7.1-CABE4899.3 - 26 ESTs
                                                                       ......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE4899.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGCGCCAATAGGAGACGCAGGAGAGACGCGGCACGGTCAATGCTGAGAGTTAGGTTGCGCGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACCATTTCCGGCTCTTACTGCTCATTCCCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTT
                                                  Xt7.1-CHK-1008229061                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCAATAGGAGACGCAGGAGAGACGCGGCACGGTCAATGCTGAGAGTTAGGTTGCGCGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACCATTTCCGGCTCTTACTGCTCATTCCCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        2     2     3     3     3     3     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     8     7     8     8     9     8     9     7     8     7    10     8    10     8    10     9    10    10    11    10    11    10    11    11    12    11    12    12    13    12    13    12    13    12    14    12    14    12    14    12    14    13    15    13    15    13    15    13    15    13    15    13    15    14    17    14    17    14    17    18    20    18    20    18    20    18    20    18    21    18    22    18    22    18    22    18    22    18    22    18    22    17    21    17    21    17    21    19    23    20    24    22    24    22    24    22    24    22    24    22    24    22    24    21    23    21    23    21    23    20    23    20    23    19    23    20    23    19    21    19    21    18    21    18    20    18    20    18    20    17    20    15    19    15    17    15    17    15    17    15    17    15    17    15    17    15    17    14    16    14    16    14    15    13    15    12    14    12    14    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    10    10     8     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------C--
                                               BLH ATG     205      72                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     250      57                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MPR     211      57                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     154     475                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               CDS MIN     154      57                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     154      55                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 1e-011     NP_011497.1 may be involved in assembly/maturation of mitochondrial iron-sulfur proteins;Jac1p [Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Ce ==== 1e-012     NP_500506.1 predicted CDS, DNaJ domain (prokaryotic heat shock protein) (dnj-15)[Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 5e-039     XP_686248.1 PREDICTED: similar to J-type co-chaperone HSC20 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 4e-042     XP_796457.1 PREDICTED: similar to Co-chaperone protein HscB, mitochondrial precursor (Hsc20) [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 4e-042     NP_705799.1 J-type co-chaperone HSC20 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-053     NP_741999.3 J-type co-chaperone HSC20 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Xt ==== 7e-101     AAI21662.1 Hypothetical protein MGC147449 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 8e-108     AAH74193.1 MGC82090 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 8e-108     NP_001086103.1 MGC82090 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE4899.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA---------------------------------------------TAG---------------------------------------------------------ATG------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAG---------------------------------------------TGA---------------------TAA------------------------------------TAA------------------------------------------------TAA------------------------------------------------------ATG------------TGATAG------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           HeRe FL                   EC2CAA19BE08.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ggaggagacgcaggagagacgcggcacggtcaatgctgagagttaggttgcgcgctgggcaatGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACTATTTCCGGCTCTTACTGCTCATTCCCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGaggaAAAAAAagtaaa
  0   1   1           Ova1 FLt5                        CABE4899.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGTGAAAAAAA
  5  -1   2       bld Gas7      out                         XZG5392.5p TGCCACTCAGATCCTCTATGTAAGCTACAGGGGAGTGTCCATGACCAAACTCCCGAAATATTCTGAAATGTCGCTTGCTGTATGTTTTGTACCTCTCCGTCTGGTTTATTACTGGAATATCGAAGGTGTAATCACATTTTTTATCTCTTCCAAATACATATTCTTCAAGCAGGCAATCATGATTTAAAAAGCCCCTTCCAAGGGCCCAGAGACGACCCCAAGGCTGGGGAATATCCTCATCTATCTCAGGGTCTACAGGAATGGACGCAAGATCTTGCACTGGAACAGTTTCCAAAGAACTTAATGTACCCGATGAAGACGACTGACTGTAGGATTGAGGGGCACTGGAGGAAGAACTTGAGGTGCCCTGAGATTGTTGAGACTCTGTTTTAGTATCACGGGACATCATTTACCTCAATTCCAAGATAACGAAACCGGGAAAAGGTGCAGTTTTTCCTTTTGCCGCCATGTACAGTTAAAGGCGACAGCCAATCACAGTAGGAAGCGCAATCACGTGGACTGGGAACTGGTTCCATTCCAGGAAGCGAAAGCGCCAATAGGAGACGCAGGAGAGACGCGGCACGGTCAATGCTGAGAGTTAGGTTGCGCGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACCATTTCCGGCTCTTACTGCTCATTCCTCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATAAAGTGC
  5   1   2       bld HdA  5g                       THdA010o10.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGCGCCAATAGGAGACGCAGGAGAGCCGCGGCACGGTCAATGCTGAGAGTTAGGTTGCACGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACCATTTCCGGCTCTTACTGCTCATTCCCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACAATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGAC
  5   1   2       bld HeRe FL   in                     EC2CAA19BE08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGGAGACGCAGGAGAGACGCGGCACGGTCAATGCTGAGAGTTAGGTTGCGCGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACTATTTCCGGCTCTTACTGCTCATTCCCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAAAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAAC
  5   1   2       bld Te5       in                        CAAO12551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCACGGTCAATGCTGAGAGTTAGGTTGCGCGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACCATTTCCGGCTCTTACTGCTCATTCCTCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAAGTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCCAGCANGTGATC
  5   1   2   12  bld Gas7 5g3  in                         XZG53758.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTGGGCAATGACGGACTTGGGAGGTGGAAGTAGCTTGTCCTTGATGCATTACCATTTCCGGCTCTTACTGCTCATTCTCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAA
  5   1   2   14  bld Te5  5g3  in                         CAAO6040.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGCTCTTACTGCTCATTCCTCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGA
  5   1   2   10  bld Bone 5g3  in                       CBTC10950.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTACTGCTCATTCCCCTGCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGNCAGGTGATCTCNCAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCANATATA
  5   1   2       bld HdA  5x3  out                  THdA053f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACTGCTCATTCCTCTGCTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGGTGAGCCCATATTCCTCATGCATGTCATATAAAGTAGGCACATATACTGGGAAACAATAGATTCCCTATCGTAAAAGGTTGTTCATATTCCAATCCTGAAAACTTGTATAGTATATAGCTTTATCAAATATATGCTTTTACTGTGCAACTTTTTTGGCCTTGCCAGTTTTGATGCAGAATTTCACTGTGAACCCATGCCTGGCGATTAAATTCACTGACTGTACTTACGACAGAAAATTTTTCGTCTTTAAAGGGGGGGCCTATCACCTTATGATATAATTCCAAAGTCATATTAGTTGAGCAAAATTAACTTTAGTTACACTGTATAAATTCTTTAAATCTTGTTTACTTCAATTTTGGAATTCACAATCACAGCCATCAGGCACGCTCTATTTGTTTGGGCACTGTAATTAaaggtggccatacatgggccgattctagccgacgatataggtcccttagaccgacttagcagcttatcggcccgtgtatgggcactaccgacgggcatgcccaacaaacatcaggcctgaaatcgtccagatatcgatcgggcaggt
  3   1   2       bld Te5       in                        CAAO12551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTTTAGCAATGGAGCCTACCAGGGCTGTATTAAAGTGCTATGCCAGTCAGTGGATGCGAATGGTGTTCAGCATGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGT
  3  -1   2       bld Fat1      in                         CABC7782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAGGGCGAGAGGCCGAATGGTGGTTCAGCATTGGTGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCANATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAGGACATTTGCTTACTGGGCT
  5   1   2       chi Ova1      in                         CABE7846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGAGCCGGAAGCCGCCAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGGTGAGCCCATATTCCTCATGCATGTCATATAAATGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACTCAGTAAAGA
  5   1   2       bld Ova1      in                        CABE13692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTGAGCCGGGGCTTCTGGGCTTTCTCTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACAAAATCTAATTTATTGAAAGGACATTTGCTTACTGNGCTAG
  5   1   2       bld Ova1 FLt5 in                         CABE4899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGGCCGCCCCGATTACCATGTATAAAAAGTGCAACAAGTGCAATGTCCCGTAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCNACCAAAATCTAATTTAT
  5   1   2       bld Gas7      in                         XZG20851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAAGTGCAATGTCCCATAGTACCCTGCGTTCAAGCTGCACTTACTCTTTAAGAACTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGCTGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCCAATATACNAGACCAAGTAAAGGAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCAATAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTG
  5  -1   2       bld Fat1      in                         CABC7782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAGCTGCACTTACTCTTAAAGAAGTTTCTGTGTGACTTCCCAGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAG
  3   1   2       bld Ova1 FLt5 in                         CABE4899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGCCGCCTGTGCTGGAGATGTCAGGCTGAAATGAGCAGGGCTGAGTTGTTCTGCCCCACATGTACTTCTCTGCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTNTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGGAAAAAAA
  3   1   2      seed Ova1      in                        CABE13692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGCCACCTGATGAGAGCAAGGACTTTTTCCAGGTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGTG
  3   1   2       bld Ova1      in                         CABE7846.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGGTGAGCCCATATTCCTCATGCATGTCATATAAATGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGTG
  3   1   2       bld Bone 5g3  in                       CBTC10950.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTCTGGATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGNNTTGTTTTTATCGGT
  3   1   2       bld HeRe FL   in                     EC2CAA19BE08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGTGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGC
  3   1   2       bld Te5  5g3  in                         CAAO6040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAAATCATTTAATGTTGACACTCAGGAACTGCAAAGAAAATACCGCAATCTTCAGCGTTTGCTTCATCCAGATTTCTTCAGCCAGAAGTCAGAGAGTGAACGGAACATATCAGAAAAGCAGTCAACAGTGGTTAACAAAGCTTACAAAACCCTTCTATCACCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGTG
  5  -1   2       chi TpA       in                  TTpA047n19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCGCGTCGACACTAGTTCCTTTAGCAAGTCAACAGCTAAAGAAGATACCAGAAGGTACTGTCATTTATTACAGTGGGATCTATACATTGCTGAAGATAAATTGGAGCTCCAAAAATGTGAACCTTGCATGTTTATTTATTTCCCAAAGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGTGAAAAAAAAAAAAAAAAAAAG
  3  -1   2       chi TpA       in                   TTpA047n19.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAGCAAGTCAACAGCTAAAGAAGATACCAGAAGGTACTGTCATTTATTACAGTGGGATCTATACATTGCTGAAGATAAATTGGAGCTCCAAAAATGTGAACCTTGCATGTTTATTTATTTCCCAAAGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGT
  3   1   2       bld Gas7      in                         XZG20851.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTNTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTGTTTTTATCGGTGGTCTCTTTGCGTCATTTGAATGACAGTTCTTCTTCTGTGATGAGAACATTTCAGTCTGACAGTAAATGGAGAAGTAATATGTTAAGTTTTTTCCCCAAACAGCTTTTAACCCTTGGTAGATGGTTTATTGTTTATGATACAGTCAACTTGCTGTTATATGCATTGTGCACAATAGTAACATTTTCAGATTTACAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 5g3  in                         XZG53758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTTAAAGCGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATCCAAGACCAAGTAAAGAAGAAAATAATCCCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAAAAAGTAAAGTTTTTTTTATCGGTGAAAAATAAAAAATT
  5   1   2       bld Gas                            TGas112i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGAGTATATTTGCTAAGTCTGAATGGCATAACATTAAAGGAAGGAGCGGACGATGAAGTGGATACACAATTTCTCTTTGATATATTAGAGCTTAATGAACAACTAAATGATGCAGAAACTAAGGATGACATTGAAGAAGTTGGACATTTTGTACAAGAACAGTTGGTGTCATTGACAAAGGATTTGAGAAAAGCTTTCCAGCAAGGTGATCTCCAAGAAGCTAAAATACTTTTAGCAAAGATGAAATACTTCTCAAATATACAAGACCAAGTAAAGAAGAAAATAATACCTTAGGTTCTGTACAAATCAGGCATAATCCCATTAAGTTCTCAACATTGCTGAACAAAGCATTTGCACTGCCAGTAAGTTTTCCCCTATGTGAAAGCTCTGCCAACCAAAATCTAATTTATTGAAAGGACATTTGCTTACTGGGCTAGACCAGAAAGAGAATTCTAAAATAATTACTCCTGCAATTCTGACAAGGATTTCTCATGCCTAAGGAGAAACCAGATGCTTGGCTTTGTATGATAGCAGCTATATTTATCTGAGTGAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)