Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA020m23.3                          9 END     1           3       11                yes-associated protein; yes-associated protein, 65 kDa [Mus musculus]

 This cluster: approximate FL confidence score = 0%

 1012076365 Xt7.1-CAAQ1420.3 - 30 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAQ1420.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTGTGATGTTCAAGATAACCAATTGCTGTAGAAGAAATTCTCCCGTGTCCTACAAATATACCAAGATCAGCACTGAAGAAGAAGCAGATGACAATGAGACTGAATGGCTAATGGAAGAGGTGTCCACAGGCAATAATGCAAAACAACGTCAAGAGAATGGTCACATTAAGTCTGTAAAGCCCGGGACCTTCACCTCACTTCCTGTGGACGACCTGGACAGTGAGGATGAAGTCTTAACCATACCAGAAGTCAGAATTCAGTCTGCCAGGAACAAAGAGATGAATGCAAGTCAGGCACAAAGAGGCTACAGTTCTGCCATTGACGAGAAGTTGATGGGAGCACAGAATGGAGCACGAGGAAATCAGGGCAAGGCCAAGCCTGGTCACCATAAAAAAGAAGATAAGCTGAATGTCCTTTCATTCCATGATGACAGTGATGAAGACATGCTGAATGTGTAGCACCGGTGTGTACGCTCACTCCCATTTACTCTTTGTGCCTAAGAAAATATTGTTGGGACAGACAAAGCTACTGCAACCAAATATGAATAACTTGACCTAATGCGCTGTTCCCTCACATTTTTCTCCTTGGGGGGAAATTTAGGAAAACAAACTAAAATAAAAAGTGCAAGGAAAGAGAAGAAGGGAAGTGGCCTTTTTGCAGTTTACAGTGATGATAATGTACAGATTTAGTGCGCAGTGGGTTTGCGGGGAAGTTCAGTGCATTTGGAATCGTAGCCTCCTGGGATTCCTGTGCCATCTATGGGAGCTGATCATCTTCTTGCTTTGTACGTTGCACTTTGTAATCAATGAAATTCAAAGAAACTTCAATGACTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCAGAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGGTATGGTACCTGCTGCTGTCTGTGCACGACATAAACTTGTATTGCTCTGTATGTGTTTGGGGTGTAGAGATCACTTGATCTACATTTAATTAGTACATCAGAACCCAGCTTAAATCTAAAGAAACCGATTGAAGTCCTCATGTGATTTCATCCTAAATCTCAGTTATGCTCTGCTGAGTGCAGCTCTGGTAAATGCCATAATATTAAATCCAAGTCCTATAAAGAGGCCTTACAGTGTGCATCCAGCAGTATTCCTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGTTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCGTGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGTACAGTAAGCTTTGCAGATTGGTGTAGGAAATGTGGTTGATGTGCCACATTTAATAGCTTCTGTATCTCTGTCCTTTAGGGGTTTACTTGCCCTTTAAAGACTGAGTGCATTTTGTATAAAACTTTACATTGCATTTCCACAAGATGAAGGAATCCATTTTCTTTTGCACTTTTGGCAACAGACGTTTTCCGTAGCTTGCTAGGTTGTTAGTAAAAGCCTCCCCAGCCAAAAGGGGGCAGTATATAACATGTTGGTTATATTGGGGAAAAGCCAGCGCTTATGTGTGTAGTGTCCCTTTACCCTAGGACTATTTGTATTTTACCCCATTTCAATAAAACAAAAATGTGTTTGTTTATGAACCCCAGCCAGATATAACACTCCTATATTATCTTTGGTTGCGAGCAGCATTCCCAGCATCCTCAGCCAGTTTGCATTTATGCTTACCTAGATGGTTGTTGTAGTTCACAGCGGCTGAGTAGCGGTGGCTTTGACTGTTCTGTTATTAATGCAGTATATACAGGACTATCAAATTATAAGTCTTCTCCCACTATTGATATTTTTAAAATCTGCAGCTGAAATACAGTGATTTTTACAGTTTTATTAACTTTTTTTAAAAGAAAACATGCAGGCAATATGCCCAACTAACCCCCGGTGGGGGGGGGAATGTCTCTGTTCTAGGCATCCTTTACTGCATATTTGTTTGCATATGCACTGAAGCTTCCATACTGCTTTTGTCAGTGGGGGGTAATCTCCATAGTCAAAAGGTGGCCATACACTTTGACGTGGACTCTTTTGGTGAGGTCTCCAAATGAGTGGATCTCTCCCCAGTCCAGCCACCCACACGCTGGGCCAGTGTGGTCTGATCCTAGTTGATGACCTCCACACACCAATTTGTTCCTCGACCAGTCAAGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGCGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAA
                                                  Xt7.1-CHK-1008228143                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGTTCAAGATAACCAATTGCTGTAGAAGAAATTCTCCCGTGTCCTACAAATATACCAAGATCAGCACTGAAGAAGAAGCAGATGACAATGAGACTGAATGGCTAATGGAAGAGGTGTCCACAGGCAATAATGCAAAACAACGTCAAGAGAATGGTCACATTAAGTCTGTAAAGCCCGGGACCTTCACCTCACTTCCTGTGGACGACCTGGACAGTGAGGATGAAGTCTTAACCATACCAGAAGTCAGAATTCAGTCTGCCAGGAACAAAGAGATGAATGCAAGTCAGGCACAAAGAGGCTACAGTTCTGCCATTGACGAGAAGTTGATGGGAGCACAGAATGGAGCACGAGGAAATCAGGGCAAGGCCAAGCCTGGTCACCATAAAAAAGAAGATAAGCTGAATGTCCTTTCATTCCATGATGACAGTGATGAAGACATGCTGAATGTGTAGCACCGGTGTGTACGCTCACTCCCATTTACTCTTTGTGCCTAAGAAAATATTGTTGGGACAGACAAAGCTACTGCAACCAAATATGAATAACTTGACCTAATGCGCTGTTCCCTCACATTTTTCTCCTTGGGGGGAAATTTAGGAAAACAAACTAAAATAAAAAGTGCAAGGAAAGAGAAGAAGGGAAGTGGCCTTTTTGCAGTTTACAGTGATGATAATGTACAGATTTAGTGCGCAGTGGGTTTGCGGGGAAGTTCAGTGCATTTGGAATCGTAGCCTCCTGGGATTCCTGTGCCATCTATGGGAGCTGATCATCTTCTTGCTTTGTACGTTGCACTTTGTAATCAATGAAATTCAAAGAAACTTCAATGACTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCAGAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGGTATGGTACCTGCTGCTGTCTGTGCACGACATAAACTTGTATTGCTCTGTATGTGTTTGGGGTGTAGAGATCACTTGATCTACATTTAATTAGTACATCAGAACCCAGCTTAAATCTAAAGAAACCGATTGAAGTCCTCATGTGATTTCATCCTAAATCTCAGTTATGCTCTGCTGAGTGCAGCTCTGGTAAATGCCATAATATTAAATCCAAGTCCTATAAAGAGGCCTTACAGTGTGCATCCAGCAGTATTCCTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGTTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCGTGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGTACAGTAAGCTTTGCAGATTGGTGTAGGAAATGTGGTTGATGTGCCACATTTAATAGCTTCTGTATCTCTGTCCTTTAGGGGTTTACTTGCCCTTTAAAGACTGAGTGCATTTTGTATAAAACTTTACATTGCATTTCCACAAGATGAAGGAATCCATTTTCTTTTGCACTTTTGGCAACAGACGTTTTCCGTAGCTTGCTAGGTTGTTAGTAAAAGCCTCCCCAGCCAAAAGGGGGCAGTATATAACATGTTGGTTATATTGGGGAAAAGCCAGCGCTTATGTGTGTAGTGTCCCTTTACCCTAGGACTATTTGTATTTTACCCCATTTCAATAAAACAAAAATGTGTTTGTTTATGAACCCCAGCCAGATATAACACTCCTATATTATCTTTGGTTGCGAGCAGCATTCCCAGCATCCTCAGCCAGTTTGCATTTATGCTTACCTAGATGGTTGTTGTAGTTCACAGCGGCTGAGTAGCGGTGGCTTTGACTGTTCTGTTATTAATGCAGTATATACAGGACTATCAAATTATAAGTCTTCTCCCACTATTGATATTTTTAAAATCTGCAGCTGAAATACAGTGATTTTTACAGTTTTATTAACTTTTTTTAAAAGAAAACATGCAGGCAATATGCCCAACTAACCCCCGGTGGGGGGGGGAATGTCTCTGTTCTAGGCATCCTTTACTGCATATTTGTTTGCATATGCACTGAAGCTTCCATACTGCTTTTGTCAGTGGGGGGTAATCTCCATAGTCAAAAGGTGGCCATACACTTTGACGTGGACTCTTTTGGTGAGGTCTCCAAATGAGTGGATCTCTCCCCAGTCCAGCCACCCACACGCTGGGCCAGTGTGGTCTGATCCTAGTTGATGACCTCCACACACCAATTTGTTCCTCGACCAGTCAAGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGCGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     3     4     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     6     9     9    10    11    13    12    14    13    15    13    15    13    14    13    14    13    14    14    16    15    17    15    17    15    17    15    17    15    17    15    17    15    17    14    16    14    16    14    16    14    16    14    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    15    16    15    16    15    16    15    16    15    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    13    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    11    12    11    12    10    12    10    12
                                                                       ...PREDICTED - Dr ---- 6e-020     XP_685231.1 PREDICTED: similar to insulin-like growth factor 2 receptor [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-031     NP_000867.1 insulin-like growth factor 2 receptor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-034     NP_034645.1 insulin-like growth factor 2 receptor [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 2e-039     NP_990301.1 cation-independent mannose-6-phosphate receptor [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ1420.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------TAG---------------------------------------TAA---------------------------------------------TAA---------ATG------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TAG------------------------ATG---------------------------------------------TGA------------------TGA------------------------------------------------------------------------------------------------------------------------------TAATAA---------TGA---------------------------------------------------------------------------------TAA---------------ATG------------------------------------------TAG---------------------------------------------------------------------------TGA------------TAG------------------------------------TGA---------------------TAA---------ATG------TGA------------TAAATG---TAA---TAA------------TAA---------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------TAA---TAG---------------------------------------TAA---------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------TAG---------------------------------------------ATG------------------------------------TAG------------------------------------------------------------------TGA------------------------------------------------------------------------------ATG------TAGATG---------------------TGA------------------------------ATG---------------------------------------------------------------------------TGA---------------TAA------------------ATG---------------------------------------------------------------------------------ATG---TGA------------------------------TAA------TAG---------------------TGA---------------TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TAG------------------------------------------------------ATG---------------TAA---------------------------------------TGA------------------------------------------------ATG---------------------------------------------------------------------ATG------------TGA------TAG------------------------------------------------TAA------------------------------------------------TAG------------------------------------------------------TAA------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------TGA------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld TpA       out                  TTpA020m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                    CCAAACCTGCGGAAATGAAAAATGGCATATTAAGCCTTGATGATGGTGTTAATGTCAATTTAACTGATATTTATTTCAAATCATACAATGCTACTGGTGACATCCGATCGAATGGCAAGGACAGCTATGTCTATGAGATACAGTTATCTGGAAAAGCAGATTCCCGCTACCAGGAATGTAAAGATGCCAGCGTATGTCAAATAAAACTAAATGGGGATTTCAAAAGACCAGTTGGTTCTGTTAGGAATGTCAAGTATTACATTAATGATGATGATTTGGATGCTGTGTTCACTTCTGACTCTCAGTGTGGCAAAGATAAGTCAAAAAATGCTACAGCCACCATCTTGTTCTACTGCAGTCAGATTGTCGGGGAGGGAAGGCCAGAATTCTTCCACGAAACGACCGATTGTCAATACTTGTTTACTTGGTATACTTCCGCCGTCTGCCCCTTGGTGCCTAATGGCAATCCAGGCAGTGAGCCGAACTACCAGGGCCTGTCTGGCCGGAGCCAAGCTGTGGGTGCCATTCTCAGCATACTACTGGTTGTTCTTGTTATATGCCTGCTGGTGCTCTTGCTGTACAAGAAAGAAAGAAGAGAAAGTGTGATGTTCAAGATAACCAATTGCTGTAGAAGAAATTCTCCCGTATCCTACAAATATACCAAGATCAGCACTGAAGAAGAAGCAGATGACAATGAGACTGAATGGCTAATGGAAGAGGTGTCCACAGGCAATAATGCAAAACAACGTCAAGAGAATGGTCACATTAAGTCTGTAAAGCCTGGGACCTTCACCTCACTTCCTGTGGACGACCTGGACAGTGAGGATGAAGTCTTAACCATACCAGAAGTCAGAATTCAGTCTG
  5   1   2       bld Te1                                 CBWN10777.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGTTCTGCTTTACCTTATGTAGATGTCCTCCCACCCAACCCGTAACTTGCATGTCATTCAGATGTTAGGGAGAGGAAGTAGGCACCGCCTGCAGCAGGACCCTGTTTTTACCTCCTGCCCTAAGTCAGGCAATAAGGACAGGGTACAGATGCACTTCCTGGTGCTGCTCTCTGCTTTTTGCGACGGATTAGGAATCTGGCATGAGGAGCTGAGTACAGCTTACCCTGGCCGCAAGTGATGATGAAGCACTAAGAGGCGTACTCTAGTGACATTTACCAACTCTATCGCTTGCGCCCCAGGGTAAAGTGAATGACCCCTAATGTCTATGCACAAATGCAATACTAGGTTTTAAACCAGCTTTGCTAGATGTTTTTGTATAGCAGGGCCAGTTCCAAACCCCCTGTTTGTGTGACATAAGTTTTTTGTTCAGCTTGTTTACCCTTTTCCACAGAGAAAGTGTGATGTTCAAGATAACCAATTGCTGTAGAAGAAATTCTCCCGTGTCCTACAAATATACCAAGATCAGCACTGAAGAAGAAGCAGATGACAATGAGACTGAATGGCTAATGGAAGAGGTGTCCACAGGCTATAATGCAAAACAACGTCAAGAGAATGGTCACATTAAGTCTGTAAAGCCCGGGACCTTCACCTCACTTCCTGTGGACGACCTGGACAGTGAGGATGAAGTCTTAACCATACCAGAAGTCAGAATTCAGTCTGCCAGGAACAAAGAGATGAATGCAAGTCAGGC
  5   1   2       bld Lun1      in                        CABD11507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCACATTACTAAATCTAGTAAACTATCTAAATAAGTTAATTGTATGAGACCTTCGTTAGATAGAATACTTTGAAAACCATTGTTCTAAATCTGCCTTCCCCATTTTTACAATCATATAGATCAGCACTGAAGAAGAAGCAGATGACAATGAGACTGAATGGCTAATGGAAGAGGTGTCCACAGGCAATAATGCAAAACAACGTCAAGAGAATGGTCACATTAAGTCTGTAAAGCCCGGGACCTTCACCTCACTTCCTGTGGACGACCTGGACAGTGAGGATGAAGTCTTAACCATACCAGAAGTCAGAATTCAGTCTGCCAGGAACAAAGAGATGAATGCAAGTCAGGCACAAAGAGGCTACAGTTCTGCCATTGACGAGAAGTTGATGGGAGCACAGAATGGAGCACGAGGAAATCAGGGCAAGGCCAAGCCTGGTCACCATAAAAAAGAAGATAAGCTGAATGTCCTTTCATTCCATGATGACAGTGATGAAGACATGCTGAATGTGTAGCACCGGTGTGTACGCTCACTCCCATTTACTCTTTGTGCCTAAGAAAATATTGTTGGGACAGACAAAGCTACTGCAACCAAATATGAATAACTTGACCTAATGCGCTGTTCCCTCACATTTTTCTCCTTGGGGGGAAATTTAGGAAAACAAACTAAAATAAAAAGTGCAAGGAAAGAGAAGAAGGGAAGTGGCCTTTTTGCAGTTTACAGTGATGATAATGTACAGATTTAGTGCGCAGTGGGTTTGCGGGGAAGTTCAGTGCATTTGGAATCGTAGCCTCCTGGGATTCCTGTGCCATCTATGGGAGCTGATCATCTTCTTGCTTTGTACGTTGCACTTTGTAATCAATGAAATTCAA
  5   1   2       bld Brn2      in                        CAAJ19455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGGATGAAGTCTTAACCATACCAGAAGTCAGAATTCAGTCTGCCAGGAACAAAGAGATGAATGCAAGTCAGGCACAAAGAGGCTACAGTTCTGCCATTGACGAGAAGTTGATGGGAGCACAGAATGGAGCACGAGGAAATCAGGGCAAGGCCAAGCCTGGTCACCATAAAAAAGAAGATAAGCTGAATGTCCTTTCATTCCATGATGACAGTGATGAAGACATGCTGAATGTGTAGCACCGGTGTGTACGCTCACTCCCATTTACTCTTTGTGCCTAAGAAAATATTGTTGGGACAGACAAAGCTACTGCAACCAAATATGAATAACTTGACCTAATGCGCTGTTCCCTCACATTTTTCTCCTTGGGGGGAAATTTAGGAAAACAAACTAAAATAAAAAGTGCAAGGAAAGAGAAGAAGGGAAGTGGCCTTTTTGCAGTTTACAGTGATGATAATGTACAGATTTAGTGCGCAGTGGGTTTGCGGGGAAGTTCAGTGCATTTGGAATCGTAGCCTCCTGGGATTCCTGTGCCATCTATGGGAGCTGATCATCTTCTTGCTTTGTACGTTGCACTTTGTAATCAATGAAATTCAAAGAAACTTCAATGACTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTTGCTTCCTTTATTAATTCCTTTTCTTTAA
  5   1   2       bld Egg                            TEgg099n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAGGGCTTTTTCCCTGAGACAAAATTGTTGCGGACAGACAAATCTACTCGCACCAAATATGAATAACTTGACTCTAATGCCCTGTTCCCTCACATATTTCTCCTTGGGGGGAACTTTCCGAGACCGAACTAAACTAAGATGTTTCTGGACAAATAATAAGGGAACTGGCCTTTTCTCCAGTTGACTTGCTGATTATAATGTACAGATTAAGTGCTGCAGTGGGTTTGCGGGGAAGGTCACTGCATTTACAATCGAAACCTCCTGGGATACCTGAGCTCTCTATGGCAGCAGATCCTCTTCTTGCTTTGTACCCTGCACTTTGTACTCAATGAAATTCAGAGAGACTTCAATGACTTGATCCTCTGGCAGCGGCGAGACAAAAGACACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTGAGGCTGGCTGACTAAACAGCACCTAGTTCTTCCTGCCGGCAGGGTCAAACAATAATAATCCAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCACAACTATTAAGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCATAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGTATGGTACCTGCTGCT
  5   1   2       bld Spl1      in                         CABK5284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCGATTCGCTATGCGCTGTTCCCTCACATTTTTCTCCTTGGGGGGAAATTTAGGAAAACAAACTAAAATAAAAAGTGCAAGGAAAGAGAAGAAGGGAAGTGGCCTTTTTGCAGTTTACAGTGATGATAATGTACAGATTTAGTGCGCAGTGGGTTTGCGGGGAAGTTCAGTGCATTTGGAATCGTAGCCTCCTGGGATTCCTGTGCCATCTATGGGAGCTGATCATCTTCTTGCTTTGTACGTTGCACTTTGTAATCAATGAAATTCAAAGAAACTTCAATGACTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCAGAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGGTATGGTACCTGCTGCTGTCTGTGCACGACATAAACTTGTATTGCTCTGTATGTGTTTGGGGTGTAGAGATCACTTGATCTACATTTAATTAGTACATCAGAACCCAGCTTAAATCTAAAGAAACCGATTGAAGTCCTCATGTGATTTCATCCTAAATCTCAGTTATGCTCTGCTGAGTGCAGCTCTGGTAAATGCCATAATATTAAATCCAAGTCCTATAAAGAGGCCTTACAGTGTGCATCCAGCAGTATTCCTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGNTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGG
  5   1   2       bld Gas7                                  XZG3087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCTGATCATCTTCTTGCTTTGTACGTTGCACTTTGTAATCAATGAAATTCAAAGAAACTTCAATGACTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCAGAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGGTATGGTACCTGCTGCTGTCTGTGCACGACATAAACTTGTATTGCTCTGTATGTGTTTGGGGTGTAGAGATCACTTGATCTACATTTAATTAGTACATCAGAACCCAGCTTAAATCTAAAGAAACCGATTGAACTCCTCATGTGATTTCATCCTAAATCTCAGTTATGCTCTGCTGAGTGCAGCTCTGGTAAATGCCATAATATTAAATCCAAGTCCTATAAAGAGGCCTTACAGTGTGCATCCAGCAGTATTCCTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGTTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCGTGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGT
  5   1   2       bld Hrt1      in                         CAAQ1420.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATCAATGAAATTCAAAGAAACTTCAATGACTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCAGAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGGTATGGTACCTGCTGCTGTCTGTGCACGACATAAACTTGTATTGCTCTGTATGTGTTTGGGGTGTAGAGATCACTTGATCTACATTTAATTAGTACATCAGAACCCAGCTTAAATCTAAAGAAACCGATTGAAGTCCTCATGTGATTTCATCCTAAATCTCAGTTATGCTCTGCTGAGTGCAGCTCTGGTAAATGCCATAATATTAAATCCAAGTCCTATAAAGAGGCCTTACAGTGTGCATCCAGCAGTATTCCTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGTTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCGTGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGTACAGTAAGCTTTGCAGATTGGTGTAG
  5   1   2       bld Mus1      in                         CABH4117.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGAGGCTTGATCCTCTGGCAGCGGTGAGAGAAAAGAGACTACTGGCATCTTCACTATTTATTCGCTTGAACTACATCTCAGGTTGGCTGAATAAACAGCACCAAGTTCTTCCTGCCGGCAGGGTAAAACAATAATAATCGAAATACTGATGGAGCAGAGAAACGCACTCCCCTTTGGTCAGAACTATTAGGAACCTGGCCTCTTCGCTTCCTTTATTAATTCCTTTTCTTTAAATCCCAGAGCATTATATGAAGGACTGTCATGAATGTCATGTTTTCTGTAGTAATATATCATAGGTATGGTACCTGCTGCTGTCTGTGCACGACATAAACTTGTATTGCTCTGTATGTGTTTGGGGTGTAGAGATCACTTGATCTACATTTAATTAGTACATCAGAACCCAGCTTAAATCTAAAGAAACCGATTGAAGTCCTCATGTGATTTCATCCTAAATCTCAGTTATGCTCTGCTGAGTGCAGCTCTGGTAAATGCCATAATATTAAATCCAAGTCCTATAAAGAGGCCTTACAGTGTGCATCCAGCAGTATTCCTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGTTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCGTGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGTACAGTAAGCTTTGCAGATTGGTGTAGGAAATGTGGTTG
  5   1   2       bld AbdN                               IMAGE:7021026                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAGGCAGTGTGCAAGGTCAGCGGGAAATCATTCCGTTCATTACTTGCCATTGTGTGCCAACTATCCACAAAACTGGCACAGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCGTGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGTACAGTAAGCTTTGCAGATTGGTGTAGGAAATGTGGTTGATGTGCCACATTTAATAGCTTCTGTATCTCTGTCCTTTAGGGGTTTACTTGCCCTTTAAAGACTGAGTGCATTTTGTATAAAACTTTACATTGCATTTCCACAAGATGAAGGAATCCATTTTCTTTTGCACTTTTGGCAACAGACGTTTTCCGTAGCTTGCTAGGTTGTTAGTAAAAGCCTCCCCAGCCAAAAGGGGGCAGTATATAACATGTTGGTTATATTGGGGAAAAGCCAGCGCTTATGTGTGTAGTGTCCCTTTACCCTAGGACTATTTGTATTTTACCCCATTTCAATAAAACAAAAATGTGTTTGTTTATGAACCCCAGCCAGATATAACACTCCTATATTATCTTTGGTTGCGAGCAGCAATCCCAGCATCCTCAGCCAGTTTGCATTTATGCTTAACTTAGATGGTTGTTGTAGTTCACAGCGGGCTGAATAACCGTGGGCTTTGAACTGGTTCTGTTTATTAAGGCAGTATTTTACGGGGACTTTCCAATTTATTAAGTCCTTCCTCCCCATAATTGGAAAATTTTTAAAAAATCTGCAGACTGGAAAATACCAGTGGAATTTTTTTTACAAGTTTTTTAC
  5   1   2      shim Tad5      in                         XZT37289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGACGCGTGGGGCCAACTATCCACAAAACTGGCACTGGCCAATTTGGGTGCTTCCATTTCCTTCTTGCTGAACAGTAATGTAACCAAGCTAACACCATGTGACACTGTATTCTGGGTGTGAAGTGGTCAAAATACAGTATTGGCACATGAAATATTCCCTTTATAAGTTTAGATATTACCTAGTGATGGGCAAGTAAAGCCTGAAGTACAGTAAGCTTTGCAGATTGGTGTAGGAAATGTGGTTGATGTGCCACATTTAATGGCTTCTGTATCTCTGTCCTTTAGGGGTTTACTTGTCCTTTAAAGACTGAGTGCATTTTGTATAAAACTTTACATTGCATTTCCACAAGATGAAGGAATCCATTTTCTTTTGCACTTTTGGCAACAGACGTTTTCCGTAGCTTGCTAGGTTGTTAGTAAAAGCCTCCCCAGCCAAAAGGGGGCAGTATATAACATGTTGGTTATATTGGGGAAAAGCCAGCGCTTATGTGTGTAGTGTCCCTTTACCCTAGGACTATTTGTATTTTACCCCATTTCAATAAAACAAAAATGTGTTTGTTTATGAACCCCAGCCAGATATAACACTCCTATATTATCTTTGGTTGCGAGCAGCATTCCCAGCATCCTCAGCCAGTTTGCATTTATGCTTACCTAGATGGTTGTTGTAGTTCACAGCGGCTGAGTAGCGGTGGCTTTGACTGTTCTGTTATTAATGCAGTATATACAGGACTATCAAATAATAAGTCTTCTCCCACTATTGATATTTTTAATATCTGCAGCTGAAATACAGTGATTTTTACAGTTTTATTAACTTTTTTTAAAAGAAAACATGCAGGCAATATGCCCCACTAACCCTGGGTGGG
  5   1   2       bld Sto1      in                         CABG4601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAGGTTGTTAGTAAAAGCCTCCCCAGCCAAAAGGGGGCAGTATATAACATGTTGGTTATATTGGGGAAAAGCCAGCGCTTATGTGTGTAGTGTCCCTTTACCCTAGGACTATTTGTATTTTACCCCATTTCAATAAAACAAAAATGTGTTTGTTTATGAACCCCAGCCAGATATAACACTCCTATATTATCTTTGGTTGCGAGCAGCATTCCCAGCATCCTCAGCCAGTTTGCATTTATGCTTACCTAGATGGTTGTTGTAGTTCACAGCGGCTGAGTAGCGGTGGCTTTGACTGTTCTGTTATTAATGCAGTATATACAGGACTATCAAATTATAAGTCTTCTCCCACTATTGATATTTTTAAAATCTGCAGCTGAAATACAGTGATTTTTACAGTTTTATTAACTTTTTTTAAAAGAAAACATGCAGGCAATATGCCCAACTAACCCCCGGTGGGGGGGGGAATGTCTCTGTTCTAGGCATCCTTTACTGCATATTTGTTTGCATATGCACTGAAGCTTCCATACTGCTTTTGTCAGTGGGGGGTAATCTCCATAGTCAAAAGGTGGCCATACACTTTGACGTGGACTCTTTTGGTGAGGTCTCCAAATGAGTGGATCTCTCCCCAGTCCAGCCACCCACACGCTGGGCCAGTGTGGTCTGATCCTAGTTGATGACCTCCACACACCAATTTGTTCCTCGACCAGTCAAGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTAT
  5   1   2       bld Tad5      in                         XZT69770.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAAAAATGTGTTTGTTTATGAACCCCAGCCAGATATAACACTCCTATATTATCTTTGGTTGCGAGCAGCATTCCCAGCATCCTCAGCCAGTTTGCATTTATGCTTACCTAGATGGTTGTTGTAGTTCACAGCGACTGAGTAGCGGTGGCTTTGACTGTTCTGTTATTAATGCAGTATATACAGGACTATCAAATAATAAGTCTTCTCCCACTATTGATATTTTTAATATCTGCAGCTGAAATACAGTGATTTTTACAGTTTTATTAACTTTTTTTAAAAGAAAACATGCAGGCAATATGCCCAACTAACCCTGGGTGGGGGGGGGATGTCTCTGTTCTAGGCATCCTTTACTGCATATTTGTTTGCATATGCACTGAAGCTTCCATACTGCTTTTGTCAGTGGGGGGTAATCTCCATAGTCAAAAGGTGGCCATACACTTTGACGTGGACTCTTTTGGTGAGGTCTCCAAATGAGTGGATCTCTCCCCAGTCCAGCCACCCACACGCTGGGCCAGTGTGGTCTGATCCTAGTTGATGACCTCCACACACCAATTTGTTCCTCGACCAGTCAAGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGTGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATGCAGTCTCACCAATGCCAACCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGT
  5   1   2       bld Tad5      in                         XZT54648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAATATGCCCAACTAACCCCCGGTGGGGGGGGGAATGTCTCTGTTCTAGGCATCCTTTACTGCATATTTGTTTGCATATGCACTGAAGCTTCCATACTGCTTTTGTCAGTGGGGGGTAATCTCCATAGTCAAAAGGTGGCCATACACTTTGACGTGGACTCTTTTGGTGAGGTCTCCAAATGAGTGGATCTCTCCCCAGTCCAGCCACCCACACGCTGGGCCAGTGTGGTCTGATCCTAGTTGATGACCTCCACACACCAATTTGTTCCTCGACCAGTCAAGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGCGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACT
  5   1   2       bld Sto1      in                        CABG12410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCACTGAAGCTTCCATACTGCTTTTGTCAGTGGGGGGTAATCTCCATAGTCAAAAGGTGGCCATACACTTTGACGTGGACTCTTTTGGTGAGGTCTCCAAATGAGTGGATCTCTCCCCAGTCCAGCCACCCACACGCTGGGCCAGTGTGGTCTGATCCTAGTTGATGACCTCCACACACCAATTTGTTCCTCGACCAGTCAAGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGCGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCTTGTTACTTTGCATCACACTGC
  5   1   2       bld Tad5                                 XZT47589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTTTTAATCTGCCCAATGGATTTATTGCTATCTTTTGGGAGTCCTTAGGTTGCCACCCCAGTCTGGATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGCGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAA
  5   1   2       bld Ova1      in                        CABE10683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATAGGCAGGGTAAGCCGCTTAGATTGCCCAGTCTATGGCCAGCTAAAAACTGAACAGTAGTATGTGGTGGCTACAGTTTTGGTGTAGTACATAGAGAGGGTATATCAGCCCTTTGTGTCCTCAGATGTAGCCATAGCGTCACTCAATTATTTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAAGTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCA
  3   1   2       bld Hrt1      in                         CAAQ1420.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTCTGCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAC
  3   1   2       bld Sto1      in                        CABG12410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTCTGCTTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTT
  5   1   2       bld Tad5      in                         XZT51178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGNTCCGCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTT
  3   1   2       bld Ova1      in                        CABE10683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTGCCTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATGAACAAATAAAAAATATAAGTTATAACTCAAAAAAAAAAA
  3   1   2      seed Spl1      in                         CABK5284.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCTTCCCAACCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTT
  3   1   2       bld Lun1      in                        CABD11507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACAAATAATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTATAACTC
  3   1   2       bld Tad5      in                         XZT37289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGACCCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTGAGACACCAGGATCCAAGATTGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACTTTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTCCTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAAGGAGGCTTCGTTTACTGTCTATTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGGATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAGAAGTATTGAACAAATAAAAAATATAAGTT
  3   1   2       bld Mus1      in                         CABH4117.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACAGTCTCACCAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAT
  3   1   2       bld Sto1      in                         CABG4601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATGCCAATCAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAT
  3   1   2       bld Brn2      in                        CAAJ19455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTAGAGCCTGGGACAGGTAGAACCATACAGCTAGTAACAGTGCTGGGTGCTGTTCTAAGACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAT
  3   1   2       bld Tad5      in                         XZT54648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACACCAGGATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAT
  3   1   2       bld Tad5      in                         XZT69770.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAGATTGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTCCTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAAGGAGGCTTCGTTTACTGTCTATTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAGTTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAT
  3   1   2       bld Tad5      in                         XZT51178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATCCAAGATGGGGGTACACCTTGTATAACAAACATTTGGAAGTATAACCCACAATACATTTCCTGTATGACCTATCCCAATATACATTTGCTCCTCTACTTGGGAAATCCCAATTCACATGCCACAGACAATCCTGCCAAATGAGGCTTCGTTTTTGAACCAAATTGTTTTCCTTTTTACTTCTGTGCCAATGTTGAGAGCAGAGTGAATAGAGTAGCACACTGAGGGTACTCATGCCATCCCTGTTAGCCATTTGAATCCCTTTTAAGGAGCAGAAACAGGTGCAGATGGGGGGAAATGTAAGCAACATTTGCACTAGCATAATCTCCCTTGTTACTTTGCATTCACACTGCTTTATACATTGCCCTGTCTATAAGACATTTGGTACAGTTCATGTGGAGGTACAGTGACCAGATCTTCCCTTTAATGCTTGGCCCCATTAAAAAAACAAAACATTCATTCTGCAGGGTTCCATGGTAGCCAAACATCCCTTCTCTCTGCATTTTTAGTATGTGGCCTCTTAAAGGGGTGGCCTGGTAAAGGTTATTTGTGGTATGTTTTTCCCTGTGAAGTTAATTTAAAGGTGATGCTGAGTGAGCCTCAGCTCAGGTACTTCCCATATGATTTGTATATTTTTGCTGATTCTTTTGGTTTATTGGTAAAAGAAGCTTTTTTTTTTAATTTGTGATCCTCTTGTAATATAAAAGTATTGAACAAATAAAAAATATAAGTTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)