Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1 109.0    0(repeat)                                    0 REP     79        787     1090                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012076369 Xt7.1-TGas119c22.3 - 29 ESTs
                                                                       ..-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas119c22.3                                                                                                                                                                   CAGCTGACCGGGTGGGTCACATGAGCAAACACCCGGAAGAGGAACTGCTTTAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAGGACCTGGGGTTTTCTGGATAAGGGATCTTTCCATAATTTGGATTACCCAACTTTTAGTCTCAAAAAATAATTTAAACATTAAATAAACCCAACAGGATTGTTTTGCTTCCAATAAGGATTCATTATATCTTAGTTGGAATCAAGCAAAAGGTCATGTTTCATTATTACAGAGAAAAAAGGAATATAAGAAAAAAAAATATTTGATTAATATGGAGTCTATAAAAGATTGCCTCACCATAATTTGGAGCTTTCTGGATAATGGGTTTCCAGCTAACAGATCCTAGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAATGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTATTGTACCTAAACTAAATAAACCCCTCTGGTTTTGTGT
                                                  Xt7.1-CHK-1008228417                                                                                                                                                                         ACCGGGTGGGTCACATGAGCAAACACCCGGAAGAGGAACTGCTTTAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAGGACCTGGGGTTTTCTGGATAAGGGATCTTTCCATAATTTGGATTACCCAACTTTTAGTCTCAAAAAATAATTTAAACATTAAATAAACCCAACAGGATTGTTTTGCTTCCAATAAGGATTCATTATATCTTAGTTGGAATCAAGCAAAAGGTCATGTTTCATTATTACAGAGAAAAAAGGAATATAAGAAAAAAAAATATTTGATTAATATGGAGTCTATAAAAGATTGCCTCACCATAATTTGGAGCTTTCTGGATAATGGGTTTCCAGCTAACAGATCCTAGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTATTGTACCTAAACTAAATAAACCCCTCTGGTT
                                                      consensus depths                                                                                                                                                                        3     3     3     3     4     5     4     6     5     8     7     8     9     9     9     9    13    13    14    14    16    16    16    16    17    18    18    18    18    18    18    18    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    19    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    22    21    22    21    22    19    20    19    20    19    20    18    19    15    16     8    12     8    11     8    11     9    11    10    12    10    12     8    12    10    12    10    11     9    10     8     9     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10     9     9     8    10     9    10     9    10     9    10     9     9     9     9     8     8     8     8     6     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     4     7     4     7     4     7     4     7     3     7     3     7     3     7     3     6     3     6     2     5     2     4
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------G
                                               BLH ATG      84      85                                                                                                                                                                   
                                               BLH MIN      66      27                                                                                                                                                                   
                                               BLH OVR      84     388                                                                                                                                                                   
                                               EST CLI      71       1                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 3e-017     XP_783035.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PREDICTED = Dr ==== 9e-030     XP_695585.1 PREDICTED: similar to Hepatitis B virus X interacting protein homolog (HBX-interacting protein) (HBV X interacting protein) [Danio rerio] ============================================================================================
                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 1e-036     XP_417947.1 PREDICTED: similar to hepatitis B virus x-interacting protein; hepatitis B virus x-interacting protein (9.6kD); HBx-interacting protein [Gallus gallus] ==============================================================================
                                                                       PROTEIN --- Hs ---- 1e-038     NP_006393.2 hepatitis B virus x-interacting protein; hepatitis B virus x-interacting protein(9.6kD); HBx-interacting protein [Homo sapiens] ---------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                           PREDICTED - Mm ---- 5e-039     XP_914949.1 PREDICTED: similar to hepatitis B virus x-interacting protein [Mus musculus] ------------------------===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 1e-045     AAH70520.1 MGC78763 protein [Xenopus laevis] =====================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PREDICTED = ?? ==== 1e-045     NP_001084999.1 hypothetical protein LOC432061 [Xenopus laevis] ===================================================================================================================================================================================
                                                    Xt7.1-TGas119c22.3                                                                                                                                                                                        TGA------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------TAA------------TAA------------------------------------------------------------------------------------------------------------------ATG------------------------TAATAG---------------------------------------------------------TAAATG---------------ATG------------------------------TAG---------TAA---------TAG------------------TAA------------TAA------------------TAG---------------TAA------------------------------------------------------------------------------ATG---------------------------------------------TGA---------------TAA---------------TAA------------------ATG------------------------------------------------------------TAA------TAA---ATG---------------------TAATAA------TAG---------------------ATGTGA---------------------------------------------------TAGTAA---TGATAA------------TAG---TAA------------------------------------TAG------------------ATG------------TGATAG------------------------------TAA------TAA
                                                                   ORF                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                            ]
  0   1   1           BrSp FL                   EC2BBA26AD02.FL-Pollet                                                                                                                                                                                                                     GAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCGAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAGGACCTGGGGTTTTCTGGATAAGGGATCTTTCCATAATTTGGATTACCCAACTTTTAGTCTCAAAAAATAATTTAAACATTAAATAAACCCAACAGGATTGTTTTGCTTCCAATAAGGATTCATTATATCTTAGTTGGAATCAAGCAAAAGGTCATGTTTCATTATTACAGAGAAAAAAGGAATATAAGAAAAAAAAATATTTGATTAATATGGAGTCTATAAAAGATTGCCTCACCATAATTCGGAGCTTTCTGGATAATGGGTTTCCAGCTAACAGATCCTAGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAAGAAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCtcgaGTTATTGTACCTAAACTAAAtaaacccaatctccg
  3   1   2       bld Gas7 PIPE in                         XZG41970.3p                                                                                                                                                CCACGCGTCCGCTAACAGTCAGCTGACCGGGTGGGTCACATGAGCAAACACCCGGAAGAGGAACTGCTTTAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCCCAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTTTT
  5   1   2   32  bld Gas7 5g                              XZG24005.5p ......................................................................................................................................................CTGTCTAACAGTCAGCTGACCGGGAGGGTCACATGAGCAAACACCCGGAAGAGGAACTGCTTTAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATT
  5   1   2   12  bld Gas7 PIPE in                         XZG41970.5p ..........................................................................................................................................................CTAACAGTCAGCTGACCGGGTGGGTCACATGAGCAAACACCCGGAAGAGGAACTGCTTTAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTT
  5   1   2   32  bld Gas7 5g                              XZG12067.5p ...............................................................................................................................................................................AGGGTCACATGAGCAACACCCGGAAGAGGAACTGCTTTAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATC
  5  -1   2       bld Neu5      in                         ANHP2780.5p                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNNNAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCG
  3  -1   2       bld Neu5      in                         ANHP2780.3p                                                                                                                                                                                                  TTTTTTTTTTTTTTTTTTNTAAGGGTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCG
  3   1   2       bld Gas  5x3  ?                     TGas119c22.q1kT7                                                                                                                                                                                                               ACTTTTGATTGGCTTCACGAAGCCTAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAggacctggggttttctggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttgaacattaaataaacccaacaggattttttGCTTTCAGAAAAAA
  5   1   2       bld BrSp FL   in                     EC2BBA26AD02.g1                                                                                                                                                                                                                   GGGAAGGTTTTTTTGACAGGAAGAAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCGAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGT
  5   1   2   12  bld Gas7 5g3  in                         XZG28488.5p .........................................................................................................................................................................................................................................AAGAGACTCAGCTATGGAAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATT
  5   1   2       bld Gas7      in                          XZG1043.5p                                                                                                                                                                                                                                                           AAGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2      seed Gas7      in                          XZG4264.5p                                                                                                                                                                                                                                                            AGCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGTGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAGGACCTGGGGTTTTCTGGATAAGGGATCTTTCCATAATTTGGATTACCCAACTTTTAGTCT
  5   1   2       bld Tad5                                 XZT53702.5p                                                                                                                                                                                                                                                             GCGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCNNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaN
  5   1   2       bld Brn2      in                        CAAJ19348.5p                                                                                                                                                                                                                                                              CGGCTCTGGAGCAGCATTTGGAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGTGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAggacctggggttttctggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttaaacattaaataaaccccacaggattgttttgcttccnataaggattcattatatcttagttggaatcaa
  3   1   2       bld Gas7      in                          XZG1043.3p                                                                                                                                                                                                                                                                               TTGGAAGATCCAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAATCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTCCCAGTTGTATGCCTAGAATCTGACACCGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCCCAAAGTGACATTGTAGCATCCCTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACCGTATGGGCTTTCACCTAACCTTTTTATATGGCCCAAGGCCCAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCCGATTATTTGATTTTTTGGCAAATAACCCAATTTTCCGGTTGTTACATTGCTGCTCCCTTTATTTCCCTTATTTACAAAATAAATCTCCTTTAT
  3   1   2       bld Hrt1      in                         CAAQ3138.3p                                                                                                                                                                                                                                                                                  GAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTAT
  5   1   2       bld Hrt1      in                         CAAQ3138.5p                                                                                                                                                                                                                                                                                  GAAGATACAATGAAAAATCCATCAATTGTTGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Kid1      in                         CABA2545.5p                                                                                                                                                                                                                                                                                                               TGGAGTTCTGTGTACAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTT
  3  -1   2       bld Kid1      in                         CABA2545.3p                                                                                                                                                                                                                                                                                                                TGGAGTTCTGTGTCAGATTCACAGGGGCTAAGTCTGGGATGTTGTGGAAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTT
  5   1   2       bld Eye       in                         CCAX6455.b1                                                                                                                                                                                                                                                                                                                                                              ACAGCCTTTCCGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCA
  3   1   2       bld Brn2      in                        CAAJ19348.3p                                                                                                                                                                                                                                                                                                                                                                        CGATAAACATGCTGGTGTGATCTCCATTCTTCCTCAGTATGCAGCCAAACTTACGTCAGACCCCACAGATGTGCCAGTTGTATGCCTAGAATCTGACAACGGAATTGTCATGATTCAAAAACATGATCATCTGACTGTAGCAGTGCACAAAGTGACATCGTAGCATCACTCTGCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTATTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGTGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATaggacctggggttttctggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttaaacattaaataaacccaacaggattgttttgcttccaataaggattcattatatcttagttggaatcaagcaaaaggtcatgtttcattattacagagaaaaaaggaataT
  3   1   2       bld Gas7      in                          XZG4264.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGAGCAAGTCAAGTTTGTCACTGAAAATACTGCTATCTGTGTAATTTATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCCCAAGGCACAAGTGTTCCAGCCTTAAAAGGAGTTTTATTAAAAGAGCGGCAGCTCTGATTATTTGATTTTTTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGGGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAAAGTATTTTTATTTTAACCTCCCCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAGGCcctggggttttttggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttaaaccttaaataaacccaacaggattgttttgcttccaataaggattcattatattttagttggaatcaagcaaaaggtcatgtttCTTTTTTCCGGGN
  5   1   2       bld Tad5      in                          XZT8985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTGTGTATATATTTAGCAGGACTGTATGTGCTTTCACCTAACCTTTTTATATGGCACAAGGCACAAGTGTTCCAGCATTAAAAGGAGTTTTTTTAAAAGAGCTGCAGCTCTGATTATTTGATTTTCTGGCAAATAACACAATTTTCTGGTTGTTACATTGCTGCTCACTTTATTACCCTTATTTACAAAATAAATCTCCTTTATTATCCGATGGCCATAAGTAGTTGTGTATTGCAGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCACGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATaggacctggggttttctggataagggatctttccataatttggattacccaactttaagtctcaaaaaataatttaaacattaaataaacccaacaggattgttttgcttccaataaggattcattatatcttagttggaatcaagcaaaaggtcatgtttcattattacagagaaaaaaggaatataagaaaaaaaaacatttgattaatatggagtctataagagattgcctcaccataatttggagctttctggataatgggtttccagctaacagatcctaGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCANAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCAT
  5  -1   2       bld AbdN                               IMAGE:7023879                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTACCCCAATAAACAGGGGAAGGTGGTCTGTGGTGGTATATNTTGTCCACAGGGTATAAATAAAGAAGGGTTTTTTTTTTGAGAGAGAAAGGCCGTGGGAAAAAAGAGGGGTTCCTTTTTGTTTATAAAGTCTCTCGGGCTGTTTTTTTTGTTAACCCTTAAACCATTAAAATAGGTTTTGGGTTCTTAAAATAAACCAATTGTTATTTTTTTTATTGTTTAAACCTTCACCCAAATGAATCTGTTAGGCCTGGAAAGTTAAGTTACAAAGTATGgggccctggggttttctgggaaaagggatctttccataatttggattacccaatttttagtctcaaaaaataatttaaacattaaataaacccaacaggattgttttgcttccaataaggattcattatatcttagttggaatcaagcaaaaggtcatgtttcatttttacagagaaaaaaggaatataagaaaaaaaaatatttgattaatatggagtctataaaagattgcctcaccataatttggagctttctggataatgggtttccagctaacggatcctaGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTATTGTACCTAAACTAAATAAACCACTCTGGTTTTGTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 5g3  in                         XZG28488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTAATAGAGTTGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATaggacctggggttttctggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttaaacattaaataaacccaacgggattgttttgcttccaatggggattcattatatcttagttggaatcaagcaaaaggtcgtgtttcattattacagagaaaaaaggaatataagaaaaaaaaatatttgattaatatggagtctataagagattgcctcaccataatttggagctttctggataatgggtttccagctaacagatcctaGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAAGAAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTATTGTACCTAAACTAAATAAACCACTCTGGTTTTGTGT
  3   1   2       bld BrSp FL   in                     EC2BBA26AD02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTTGAGAAGCGTGAAAGAGGTTCTGTATAAGCTCGCGTTTGTGTACCTAACATAAATGTTTGGTCTAATAACAATGTATTTTTATTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAggacctggggttttctggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttaaacattaaataaacccaacaggattgttttgcttccaataaggattcattatatcttagttggaatcaagcaaaaggtcatgtttcattattacagagaaaaaaggaatataagaaaaaaaaatatttgattaatatggagtctataaaagattgcctcaccataattcggagctttctggataatgggtttccagctaacagatcctaGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAAGAAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAAGTTATTGTACCTAAACTAA
  5   1   2       bld Gas7      in                         XZG32623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTAACCTCACCAATGATCTGTAGACTGGAAAGTAAGTACAAGTATAggacctggggttttctggataagggatctttccataatttggattacccaacttttagtctcaaaaaataatttgggcattgaataaacccaacgggattgttttgcttccaatggggattcattatatcttagttggaatcaagcaaaaggtcatgtttcattattacagagaaaaaaggaatataagaaaaaaaaatatttgattaatatggagtctataaaagattgcctcaccataatttggagctttctggataatgggtttccagctaacggatcctagacatgtacCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTATTGTACCTAAACTAAATAAAACACTCT
  3   1   2       bld Tad5      in                          XZT8985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGTCTCaaaagataatttaaacattaaataaacccaacaggattgttttgcttccaataaggattcattatatcttagttggaatcaagcaaaaggtcatgtttcgttcttacagagaaaaaaggaatataagaaaaaaaaacatttgattaatttggagtctataagagattgcctcaccataatttggagctttctggataatgggtttccagctaacagatcctaGACATGTACCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAGTTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCGCCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAAGAAATGTTTCAAATAATTTGATAGAAATATCGT
  3   1   2       bld Gas7      in                         XZG32623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGAAAAAAGGAATATAAGAAAAAAAAAtatttgattaatatggagtctataaaagattgcctcaccataatttggagctttctggataatgggtttccagctaacggatcctagacatgtacCTGCACTAAGGGAGTGCAATTGTTACAAATAATATGTATAATTTATGGTAAATTTTATCCAGTGTAACTAATAACACTGGTAGGCCTCTGTCACAGTGGCTGCAATGTGAAGCCTCAAAAGCTGTGCTGGACGTTATCACCCTGAAATACATGTTTTGGCATAGTAATGGTGATAAAACACCAGGTTTTAGTCCTAAAAAAAGTGTTATTTAGTAAAAGTGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAATGTTTCAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTATTGTACCTAAACTAAATAAACCACTCTGGTTTTGTGTTGAAAAAAAAAAAAAAAAT
  3   1   2       add Eye       in                         CCAX6455.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAGTGTTATTTAGTAAAAATGGTTTTATGTGCATAGCTTTCATCCTTTTGTATAATGTTTAAAATAATTTGATAGAAATATCTTGATGCGCTCAGTTTTTGTACCTAAACTAAATAAACCCCTCTGGTTTTGTGTTGGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)