Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 75%

 1012076418 Xt7.1-CABE9428.5 - 28 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                       4     7     7    10    11    12    11    12    12    13    12    14    12    14    13    14    13    14    13    14    13    15    13    15    13    15    13    15    13    16    13    17    13    18    14    18    14    18    14    18    18    21    18    21    18    21    19    22    16    23    17    24    17    24    17    24    17    24    18    24    18    24    18    24    18    25    18    25    18    25    18    25    18    25    18    25    18    25    18    25    18    25    18    25    20    26    20    26    20    26    20    26    21    27    21    27    21    27    22    27    21    26    21    26    19    24    17    22    16    21    16    21    16    21    16    21    16    21    16    21    17    22    17    21    17    21    16    20    16    20    16    20    16    20    16    20    15    19    15    18    15    17    14    17    13    17    14    17    14    17    13    15    12    14    11    14    11    14    11    14    10    12    10    12    10    12    10    12    10    12    10    12     9    12     8    10     7     9
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                              GTGTTGTTGGTTCAACCCTTCCGGTGCTGGTATCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGATAAGATACAAGCATCACTTTACATGTACATCAGTTCTGAAAACACTGAATTACTTGCTTGTCATACTTAATGTAGATATCTTTCCATTGACTGACACAGCTTCAGTGTGTATTGTGCTACACTGAGCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAGGCATACTTGAGTGTTTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGTGTAGCTCCACACAGGCAGACACTGCCTGTTAATGGTTCTACAGGAAGGAGCGCATGACAGTGGATCCACTTTCCTCTGCCTGGGTAAAAACTGCAGGTGAAAGAAAGAGTATCCGCTCCATGTTCCCTTACCTTAAATCTACTCTGCTGAGTAGATATAGCAGTTGTTAGTTCTAAAGTGATACACTGCTAAAAGAATGGATTTTGGACAATACATTCTCATAGGATGCACATTTTTTTGTACTCGGCAGGTTTTGCCTTTATAAATATTCTTATATTTTTAGCAGCAATTTTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                               BLH ATG      17     102                                                                                  
                                               BLH MIN      17      28                                                                                  
                                               BLH OVR      17      29                                                                                  
                                               EST CLI     -12      37                                                                                  
                                               ORF LNG      17       2                                                                                  
                                                                                                          PREDICTED - Gg ---- 1e-027     XP_417759.2 PREDICTED: hypothetical protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED - Dr ---- 1e-032     NP_775376.1 hypothetical protein FLJ20508 (human) - like [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PREDICTED = Mm ==== 3e-037     NP_808241.2 hypothetical protein LOC194268 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PREDICTED = Hs ==== 2e-041     NP_060320.1 hypothetical protein FLJ20508 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PROTEIN === Xt ==== 2e-111     CAJ82165.1 novel protein [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE9428.5                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TGA---------------------ATG------------ATG---------TAA------------------TAAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TAA---------------------------------------------------------------------------------------------TAA------TGA---------------TAA------ATGATG------------------------------------TAA
                                                                   ORF                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  3   1   1         - Egg  5g3  in                    TEgg076i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAGATAAAGGTTTTCATTAAAAATCAACAAAAAAGGAAAAAAA
  3   1   1         - Gas0                                 dad20c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATACTCCTTCCTTTTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTC
  5   1   1         - Neu                            TNeu069f14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCAT

In case of problems mail me! (