Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 75%

 1012076418 Xt7.1-CABE9428.5 - 28 ESTs
                                                                       .-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE9428.5                                                                                  TAAGCAGCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAA
                                                  Xt7.1-CHK-1008228578                                                                                        GCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAATCAA
                                                      consensus depths                                                                                       4     7     7    10    11    12    11    12    12    13    12    14    12    14    13    14    13    14    13    14    13    15    13    15    13    15    13    15    13    16    13    17    13    18    14    18    14    18    14    18    18    21    18    21    18    21    19    22    16    23    17    24    17    24    17    24    17    24    18    24    18    24    18    24    18    25    18    25    18    25    18    25    18    25    18    25    18    25    18    25    18    25    18    25    20    26    20    26    20    26    20    26    21    27    21    27    21    27    22    27    21    26    21    26    19    24    17    22    16    21    16    21    16    21    16    21    16    21    16    21    17    22    17    21    17    21    16    20    16    20    16    20    16    20    16    20    15    19    15    18    15    17    14    17    13    17    14    17    14    17    13    15    12    14    11    14    11    14    11    14    10    12    10    12    10    12    10    12    10    12    10    12     9    12     8    10     7     9
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                              GTGTTGTTGGTTCAACCCTTCCGGTGCTGGTATCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGATAAGATACAAGCATCACTTTACATGTACATCAGTTCTGAAAACACTGAATTACTTGCTTGTCATACTTAATGTAGATATCTTTCCATTGACTGACACAGCTTCAGTGTGTATTGTGCTACACTGAGCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAGGCATACTTGAGTGTTTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGTGTAGCTCCACACAGGCAGACACTGCCTGTTAATGGTTCTACAGGAAGGAGCGCATGACAGTGGATCCACTTTCCTCTGCCTGGGTAAAAACTGCAGGTGAAAGAAAGAGTATCCGCTCCATGTTCCCTTACCTTAAATCTACTCTGCTGAGTAGATATAGCAGTTGTTAGTTCTAAAGTGATACACTGCTAAAAGAATGGATTTTGGACAATACATTCTCATAGGATGCACATTTTTTTGTACTCGGCAGGTTTTGCCTTTATAAATATTCTTATATTTTTAGCAGCAATTTTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                               BLH ATG      17     102                                                                                  
                                               BLH MIN      17      28                                                                                  
                                               BLH OVR      17      29                                                                                  
                                               EST CLI     -12      37                                                                                  
                                               ORF LNG      17       2                                                                                  
                                                                                                          PREDICTED - Gg ---- 1e-027     XP_417759.2 PREDICTED: hypothetical protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED - Dr ---- 1e-032     NP_775376.1 hypothetical protein FLJ20508 (human) - like [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PREDICTED = Mm ==== 3e-037     NP_808241.2 hypothetical protein LOC194268 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PREDICTED = Hs ==== 2e-041     NP_060320.1 hypothetical protein FLJ20508 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PROTEIN === Xt ==== 2e-111     CAJ82165.1 novel protein [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE9428.5                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TGA---------------------ATG------------ATG---------TAA------------------TAAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TAA---------------------------------------------------------------------------------------------TAA------TGA---------------TAA------ATGATG------------------------------------TAA
                                                                   ORF                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Te5  FL                         CAAO11562.FL-MGC                                                                                     TTTAAAAAAAAAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAATAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg082i12.FL-Sanger                                                                                      CAGCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACAGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAATAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1   10    - Liv1 5g3  in                         CAAR9305.5p CCGAGGGCTGTATAACTGATTTGTTGGCTTGAGTTTTATTTTAAGTGCAAAGCATCAGATTTATGACATGTATTTCACCAGTTTTATCGTTTTATAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAGTATCCTTTAAAGTAGAACTACTAACAAGTCCTGCCTTGAGACACAAGTAGGAATCCCTGTTCCCATAAACCTAAATGCTAAGAATGTATGATGATGCCAATGAATTTAACACACAAATTATAAAAAGATATTTAGGATCTTTGGATCATGGTAATTATTACATATTTAGCTCCTTATTGAAGTCCTACTATAGTTTGAAAAATTGANACTTTTTTAGTATGGACTTTTATAGGCTATATACATTATTTTGGGCACATACTCAGTAATTCA
  5   1   1         - Egg  5x                        TEgg101e20.p1kSP6                                                                      TGCGGCAAACTCAGCTTCTTGTACAGGTGTCTGAAAAAGAGGCCTTTGTTTCCGAGCATCAATCGGTGACAAAGTCCTTTAATGCCGTATAACCACTGCATGAACAATGGAATAATACTCTTTAAGAGAGTAATCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACACGCCTGCCGGAAATCACTGGTTAATATAACCCCCCTGACCAGCTATATTCTCCTGCAAGAATATCTTCGCTTTAGACTACAAGCAGCAATGGACTTTTTATTTGCAGATCCTAGATCAGAAGTTGACTACGCTGCACAGAATAAGGGACTCTGTATTTCACGTGGATTGGATCTGCTCGTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAATCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACGACATATAGATAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTA
  5   1   1         - Egg  5g3  in                  TEgg076i08.p1kSP6w                                                                         CGGGCAAGCTAAGCAGCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGGAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTANATGCAGAACATTTGGCAACATTATTTGGGAAAGTATTTTGAACTTGAACCTCAAACATT
  5   1   1         - Egg  5g3  in                   TEgg034f05.p1kSP6                                                                           GGCAAGCTAAGCAGCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGATAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTT
  5   1   1         - Egg  5g3  in                   TEgg050f10.p1kSP6                                                                           GGCAAGCTAAGCAGCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACAGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCT
  5   1   1         - Egg  5g                        TEgg127e15.p1kSP6                                                                           GGCAAGCTAAGCAGCTTTTCCAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGATAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTA
  5   1   1   40    - Fat1 5g                              CABC4986.5p .............................................................................CCAGTTTTATCGTTTTATAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTAAGTCCAATGTGTTGTTGGTTCAACCCTTCCGGTGCTGGTATCACCATGCAAATTTTTAGATAAGATACAAGCATCACTTTACATGTACATCAGTTCTGAAAACACTGAATTACTTGCTTGTCATACTTAATGTAGATATCTTTCCATTGACTGACACAGCTTCAGTGTGTATTGTGCTACACTGAGCGGATATCGGCACGAATAGGCATACTTGAGTGTTTCTGCGCCGATATCCGCTATGTGTAGCTCCACACAGGCAGACACTGCCTGTTAATGGTTCTACAGGAAGGAGCGCATGACAGTGGATCCACTTTCCTCTGCCTGGGTAAAAACTGCAGGTGAAAGAAAGAGTATCCGCTCCATGTTCCCTTACCTTAAATCTACTCTGCTGAGTAGATATAGCAGTTGTTAGTTCTAAAGTGATACACTGCTAAAAGAATGGATTTTGGACAATACATTCTCATAGGATGCACATTTTTTTGTACTCGGCAGGTTTTGCCTTTATAAATATTCTTATATTTTTAGCAGCAATTTTCTTCT
  5   1   1   14    - Te5  FL   in                        CAAO11562.5p ....................................................................................TTTAAAAAAAAAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCANACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCANGACAACTGGGGTTCAGTTGTTTCTCTCT
  5   1   1         - Egg  FL                        TEgg082i12.p1kSP6                                                                                       AGCTTTTCCAGGATGTCTGAGAAACCCGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACAGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGAC
  5   1   1         - Tad5 PIPE in                         XZT55355.5p                                                                                          AAAAAAAGGATGTCTGAGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTAAGTCCAATGTGTTGTTGGTTCAACCCTTCCGGTGCTGGTATCACCATGCAAATTTTTAGATAAGATACAAGCATCACTTTACATGTACATCAGTTCTGAAAACACTGAATTACTTGCTTGTCATACTTAATGTAGATATCTTTCCATTGACTGACACAGCTTCAGTGTGTATTGTGCTACACTGAGCGGATATCAGCACGAATAGGCATACTTGAGTGTTTCTGCGCCAATATCCGCTATGTGTAGCTCCACACAGGCAGACACTGCCTGTTAATGGTTCTACAGGAAGGAGCGCATGACAGTGGATCCACTTTCCTCTGCCTGGGTAAAAACTGCAGGTGAAAGAAAGAGTATCCGCTCCATGTTCCCTTACCTTAAATCTACTCTGCTGAGTAGATATAGCAGTTGTTAGTTCTAAAGTGATACACTGCTAAAAGAATGGATTTTGGACAATACATTCTCATAGGATGCACATTTTTTTGTACTCGGCAGGTTTTGCCTTTATAAATATTCTTATATTTTTAGCAGCAATTTTCTTCTTCCTCAAT
  5   1   1         - Ova1      in                         CABE9428.5p                                                                                                          AGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCANACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTNNCTACTATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACACAGGCTGGAGTCAGCCATCTTTNTGCACTTTTCAGGCTGTG
  5   1   1         - Spl1      in                         CABK2816.5p                                                                                                          AGAAACCAGCCTTTGTTTCCGTGCAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAGTATCCTTTAAAGTAGAACTACTAACAAGTCCTGCCTTGAGACACAAGTAGGAATCCCTGTTCCCATAAACCTAAATGCTAAGAATGTATGATGATGCCAATGAATTTAACACACAAATTATAAAAAGATATTTAGGATCTTTGGATCATGGTAATTATTACATATTTAGCTCCTTATTGAAGTCCTACTATAGTTTGAAAAATTGAAACTTTTTAGTATGGACTTTTATAGGCTATATACATTATTTTGGGCACATACTCAGTAATTCATTTGCCAAACATCTACTTCCATAGAATTGTGATTATTATTTTCTCCGTCCCTGAACTTGCTGTTAGATACCTGCAGAGGAAGCTTCTCNCTACAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAACAGAGAGATGCAGCATCA
  5   1   1         - Ova1      in                         CABE1575.5p                                                                                                                                 CAGCAATCGCTGAGAAAGTCCTTTGATGCCATAGAACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCANACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCNATCTCCTTCCTTCTAACTAATTCTCCTTCCCTACTAATTCAGTCAGTGCTGTACTAGTGAGGG
  5   1   1         - Ova1      in                        CABE13232.5p                                                                                                                                              AAAGTCCTTTGATGCCATAGACACCACTGCATGAAGAATGGAATAATACACTTTTAGAGTGTAACCCACACCTAACTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCCTGCCAGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCANGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACT
  5  -1   1       chi Int1      out                       CAAP13448.5p                                                                                                                                                                                                        AAGTTACATNTTATATGCCAATTCTTCTTAATGCATTGCAGCACTATACCACCTATGTTAGTATGTGCTTNTNTTAAACACAGTGGTAAAAACCAGCACATCTCAAAAACAAAACACTCTAAAATATAAAATTAGGATTTGTTTTAGGATTCCCTGTCACTTTTAATTTGCAGCCAGTGACATGGCTTCTTAGATCTCTGAAAAAGTGCTATAATAATTTGAGTATTTTGAAACTTTCACAAAACATTAGTCCCATGGTTGCACATGAACTGAGGTTAAATAAGCATCTTTTTTTGCCATTACAACAGACCTAAAACAGAAAACATCATTCTTACCTGACATTTCTTTTTAAAGCTAAAAAAAAGTGTTACCAGAGTGGAGCAATGAGTTTACTTTAGTGCATAGTTGATGCATAAAAAGTTGTGTATTATTGGTGGCATACTACACTAAATATTTCTTATTTCTCCATACAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGG
  5   1   1         - TbA                            TTbA029f05.p1kSP6                                                                                                                                                                                                                                                         CCTGCCGGAGAGTACTGTTTAAGAAAACCCCCCTGAGCAGCTTTATTAACCTGCAAGAACATCTTCAGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCGGCATTCGCATGTCTACCTGACACGGAGATACTTCT
  3   1   1         - Egg  5g3  in                    TEgg050f10.q1kT7                                                                                                                                                                                                                                                              CAGAGAGTACTGTTTAAGAAAACCCNCCNTGAGCAGCTTTATTAACCTGCAAGAACATCTTCGTTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACAGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTCTAAACGCGACTATTTCATAAAAATAAAGGTTTTCATAAAAAAAAAAAAAAAAAAAA
  3   1   1       chi Spl1      in                         CABK2816.3p                                                                                                                                                                                                                                                                        AGGAATCCCTGTCCCCATAAACCTAAATGCTAAGAATGTATGATGATGCCAATGAATTTAACACACAAATTATAAAAAGATATTTAGGATCTTTGGATCATGGTAATTATTACATATTTAGCTCCTTATTGAAGTCCTACTATAGTTTGAAAAATTGAAACTTTTTAGTATGGACTTTTATAGGCTATATACATTATTTTGGGCACATACTCAGTAATTCATTTGCCAAACATCTACTTCCATAGAATTGTGATTATTATTTTCTCCGTCCCTGAACTTGCTGTTAGATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACAGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAAAAAAAA
  3   1   1         - Ova1      in                         CABE1575.3p                                                                                                                                                                                                                                                                                                                           CGTTTTAAACTACAAGCAGCTATGGAGTTTATTTGGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATT
  3   1   1         - Ova1      in                         CABE9428.3p                                                                                                                                                                                                                                                                                                                            CGTTTAAACTACAAGCAGCTATGGAGTTTAATTTGGAGATCTTAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAAT
  3   1   1         - Tad5 PIPE in                         XZT55355.3p                                                                                                                                                                                                                                                                                                                              TTTAAACTACAAGCAGCTATGGAGTTAATTTGGGAGATCTTAAATCAGAAGTGTAAAGTCCAATGTGTTGTTGGTTCAACCCTTCCGGTGCTGGTATCACCATGCAAATTNTTAGATAAGATACAAGCATCACTTTACATGTACATCAGTTCTGAAAACACTGAATTACTTGCTTGTCATACTTAATGTAGATATCTTTCCATTGACTGACACAGCTTCAGTGTGTATTGTGCTACACTGAGCGGATATCAGCACGAATAGGCATACTTGAGTGTTTCTGCGCCAATATCCGCTATGTGTAGCTCCACACAGGCAGACACTGCCTGTTAATGGTTCTACAGGAAGGAGCGCATGACAGTGGATCCACTTTCCTCTGCCTGGGTAAAAACTGCAGGTGAAAGAAAGAGTATCCGCTCCATGTTCCCTTACCTTAAATCTACTCTGCTGAGTAGATATAGCAGTTGTTAGTTCTAAAGTGATACACTGCTAAAAGAATGGATTTTGGACAATACATTCTCATAGGATGCACATTTTTTTGTACTCGGCAGGTTTTGCCTTTATAAATATTCTTATATTTTTAGCAGCAATTTTCTTCTTCCTCAATAAGAAGAGATATGAAATGGCGTTGATACTCACACTTGCATACAAGTTACAGGTTAATTTATTTTGTATGGAAGGTTTATATCCCCACAATATAACCTCAAGCTGGTTGGTTGTATTTCAGTGTGAAGTACATGATTGTCAGTTGTGTAATCACTACCTTTTGGTTCCCACAAAATCTAACCAAATCAGTAATAGGTTTAATATTTTCCTACAATAAATTATTACATTGGAAAAAAAAAAAAAAAGG
  3   1   1         - Te5  FL   in                        CAAO11562.3p                                                                                                                                                                                                                                                                                                                                                                      TAAATCAGAAGTTGTCTACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAAT
  3   1   1         - Liv1 5g3  in                         CAAR9305.3p                                                                                                                                                                                                                                                                                                                                                                        ATCATGGTAATTATTACATATTTAGCTCCTATGNNAAGTCCTACTATAGTTTGAAAAATTGAAACTTTTTAGTATGGACTTTTATAGGCTATATACATTATTTTGGGCACATACTCAGTAATTCATTTGCCAAACATCTACTTCCATAGAATTGTGATTATTATTTTCTCCGTCCCTGAACTTGCTGTTAGATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCGTTAAAAAT
  3   1   1         - Ova1      in                        CABE13232.3p                                                                                                                                                                                                                                                                                                                                                                                       ACGCTGCAGAGAATAAGGGACTCTGTAAGTCAGGTGGTTGGATCTGTCCTCTACATGTATGAGACAAGCATTGAAAAAATTGGTCTTGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCTGACATGTTAGAATGGCTACAAGATATAGAGAAACATTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAAAAAGAAAAAAAG
  3   1   1         - Egg  5g3  in                    TEgg034f05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGCAATTTTGGAGCGTTCTTCTCTCTGTCCTTCCATAGCNGACATGTTAGAATGGCTACAAGATATAGATAAACATTACAGAAACCCAATACTCTGCAGAGGAAGCTTCTCCTACAANGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAAATAAAGGTTTTCATTAAAAATAAAAAAAAAAAAAAAAAA
  3   1   1         - Egg  5g3  in                    TEgg076i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAGTGTGTGGCGGTCATTTGTCAGATATTCAGGCATTGCCTCAGTCCTGGGCCAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCATAAAGATAAAGGTTTTCATTAAAAATCAACAAAAAAGGAAAAAAA
  3   1   1         - Gas0                                 dad20c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAACTGAGAGATGCAGCATCATCCAAACAGCAGCATGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCATGTCTACATGACACGGAGATACTTCTTATGGTATGACCTGTTCCGAGATGGAAATATTCTAATCTTTTATAAGGATCTATTAAATGCAGAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATACTCCTTCCTTTTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTC
  5   1   1         - Neu                            TNeu069f14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACATTTGGCAACATTATTTGGGAAGTTATTTTGAACTTGAACCTCAAACATTGTATGCCCAAGTATGGCCCTACCTGTCAGCGCAGGACAACTGGGGTTCAGTTGTTTCTCTCTGGAGGCAGGACAAACTGAAAGAACTTCTCCAATCTCCTTCCTTCTAACTAATTCTCCTTCCTAACTAATTCAGTCAGTGCTGTACTAGTGAGGGGACCACAGGCTGGAGTCAGCCATCTTTTTGCACTTTTCAGGCTGTGTCCGGCATTGTAAATAAGTCTTAATATCTCTGAATATTGCATGTCTTATAACATGGAATGATGTTTAAACCACTATTTCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)