Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012076493 Xt7.1-CABI10906.3 - 40 ESTs
                                                                       ...-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI10906.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGTCGAGGATTGGGTTTCCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAGATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGATGAAGGAGCTTCAGCTAAAACCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGCAACTATTTGGATTAGACAACTCTGGAGGTTACAAGCAGCAATCCCTTCACAATATGGAAAGGGCAGTTGGAAGGGGAAGGATGCAGCCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAGTCGTTGGCTACTGGTGTGGATGATGGAAGAACTAAGACTTCGGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCT
                                                  Xt7.1-CHK-1008226792                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGATTGGGTTTCCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAGATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGATGAAGGAGCTTCAGCTAAAACCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGCAACTATTTGGATTAGACAACTCTGGAGGTTACAAGCAGCAATCCCTTCACAATATGGAAAGGGCAGTTGGAAGGGGAAGGATGCAGCCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAGTCGTTGGCTACTGGTGTGGATGATGGAAGAACTAAGACTTCGGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     2     3     3     5     5     7     7     7     7     7     7    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    11    12    11    12    11    13    11    13    11    13    11    13    11    13    11    13    10    13    10    13    10    13    10    13    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12     9    11     9    11     9    11     9    11     8    11     9    11     9    11     9    11     9    11     7     9     7     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     6     8     4     6     4     6     4     6     4     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     4     5     5     6     6     7     6     6     6     8     6     8     7     9     7     9     8     9     8     9     8     9     8    10     8    10     8    10     8    10     9    11    10    12    11    13    12    14    13    17    13    17    14    18    15    19    15    19    15    20    14    19    14    18    14    18    14    18    14    18    13    19    17    23    16    22    15    22    16    22    17    22    18    22    18    22    19    22    19    22    17    22    18    22    19    22    20    21    20    21    20    21    20    21    20    21    20    21    17    21    19    21    20    21    20    21    18    21    18    21    19    21    18    20    18    20    18    20    17    21    19    21    17    21    17    21    17    21    17    20    17    20    16    20    17    20    17    20    17    20    17    18    17    18    17    18    14    16    13    15    13    15    11    15
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------TC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------T-----
                                               BLH ATG      82    1530                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN      82     167                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR      82     602                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               CDS MIN      82       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI      16       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG      82     158                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                       PREDICTED - Sp ---- 9e-087     XP_789133.2 PREDICTED: similar to MGC83919 protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 3e-129     XP_690950.1 PREDICTED: similar to RIKEN cDNA 2700019D07 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 2e-157     XP_419771.1 PREDICTED: similar to Chromosome 6 open reading frame 113 [Gallus gallus] ------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 2e-173     NP_082563.1 RIKEN cDNA 2700019D07 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Hs ==== 3e-178     NP_659499.1 hypothetical protein LOC221302 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAH76846.1 MGC83919 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001086590.1 MGC83919 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ82345.1 novel zinc finger protein [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI10906.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA---------TGA---------------------------------TAA---ATG---------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------ATG------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------TAA---------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Neu  FL                     TNeu109g23.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGTGACATAAAACATGCTCATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGACATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAGATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGATGAAGGAGCTTCAGCTAAAACCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGCAACTATTTGGATTAGACAACTCTGGAGGTTACAAGCAGCAATCCCTTCACAATATGGAAAGGGCAGTTGGAAGGGGAAGGATGCAGCCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAGTCGTTGGCTACTGGTGTGGATGATGGAAGAACTAAGACTTCGGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg144f03.p1kSP6                                                                                                                                                                                                                                                                                                             CCGGGGCACAGCCATCGCTTAGCACCACTATGTGTATTGCCCATTACTTGCTAGAGCATTAGGGACAGTCTTGTAGAGAGGAAAGTTTGGCAGTGCATCAGTAACCCGTCACGCCTCAGTGTCAGAAATTTACTTTTATTGGTATTTTGTACTTTATTTGTCTAATAAACCTAACCCGGAAGTGATGACACCTATGCGCTGTGGCGCCTGGGTGACGTCACGAGTTTAGTTCTAAATTGAAATCCCTGTCAGTCTGGGAAACGAAAGTCGAGGATTGGGTTTCCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAAAGAAATGTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCTCCCACCTTCCTATGAC
  5   1   2       bld HdA  5g                        THdA051f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGTCGAGGATTGGGTTTCCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATGTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCTCCCACCTTCCTATGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAAATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGAT
  5   1   2   10  bld Ovi1 PIPE in                        CABI10906.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTGGGTTTCCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTCATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGACATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAGATCTT
  5   1   2       bld Egg  5g                        TEgg126n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTCCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCCTTAAATAATGAATGT
  5   1   2       bld Egg  5g3  in                   TEgg014k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGATGTGTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTCATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGACATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTG
  5   1   2       bld Egg  5g3  in                   TEgg001f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATGTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCTCCCACCTTCCTATGACATGGACTTTGTTC
  5   1   2       bld Egg  5g                        TEgg105e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATCCTTTTATGATTTGTGAAGTCTCTCCAGCTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCGGGAAGCTTGTTGCCCTTTCTCCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTT
  5   1   2       bld Egg  5g3  in                   TEgg056e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGTAAGGTGACATAAAACATGCTTATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGAGATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGAAGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCGGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAGCCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAACAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATGTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCTCCCACCTTCCTATGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAA
  5   1   2       bld Neu  FL   in                   TNeu109g23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGACATAAAACATGCTCATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGACATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACACTACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGAC
  5   1   2       bld Neu  5g                        TNeu024d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGACATAAAACATGCTCATTTGTGACATCTGCACTCAGGAGGTGCACTCTGAAAATGACATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTNTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACT
  5   1   2       bld Eye       in                         CCAX8689.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCTGCACTCAGGAGGTGCACTCTGAAAATGACATGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCA
  5   1   2       bld Brn2      out                       CAAJ19432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACACGTGCATATATTTAAAAATGTGACCTTTCCTTTATCTTCGTAACAAATATGAGAAAGCACTCAAATAAGCAATCCTTCAGACAGGCATGTAAACAAATTCCAGTATTTTAATTGCACGAACAAGAGCAGCCTTAGTTCTTTCAATACCCCATAGTCATAGGCTTTGTGACTCTTTTGCATATGTCTGTGCAAAATAAAATCCTGGAATTTGTTCACATTCATGTCTAAATTTCTCGTATTTTTTACCAATATTATCTGCCCCCTTAGCTGAAAGCTAAGGCAGTGCACCTAAGCACCCCCTGGACTGTGGTGGGTTACTTTATTCAGACTCTTTTCTATTTTCATCTTGTGATTTTGTTTACCTTGCAATAAATAGTTGTTATCCTCTAGCCCCTAAGGCCATGGTCACCTCAGTTTCTCTCAGCCTGTGTATTTTCTGCAGGCTGAAAGAAGTTAATCTGCTCCCTTCTACATCCCTGTGTATCTGCCCTGAAAACTATAGCTTCGGCTTGCGTGCAGGTACACGAAGGGGAGGAAAGGACAGCACTAATCTGCAAATGTTGTTACTGTACCATAATGTAATTTGGGGATTCACAGGAGCTTCAGCTAAATCCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGGTATTCTGGTTTTACAGGTCACGTTTTATACACTTGTGCCCTTTTTCATTTCTTTTTTAAGTTTGTTTAGTTCTGTAGAAAACTACTAGTTTGCATTGTGTATTATCTGTATTGCATATATTGAAGATATTATGTCCCTCAATGGATACATATTATAAAATATAAAAAGTCATGTTTTGAAAATGAGTTAGCAGCCTTAGTTATGGC
  5   1   2       chi Egg       out                  TEgg001b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAGAGCCATTTGCTGCTTGCTCACATGGAGCAGGATGCTTGTTGCCCTTTCTGCCCCCTGGCTGGATTATCGTATGATGAACTGAACTTCCATATTCACGCAGCCCATGAGGACATATTGGAGGTGTGGAGTGAGGATGAGCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAGATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGATGAAGGAGCTTCAGCTAAAACCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACG
  5   1   2       bld Tad0      in                     NISC_no24h11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAAATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGATGAAGGAGCTTCAGCTAAATCCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGCAACTATTTGGATTAGACAACTCTGGAGGTTACAAGCAGCAATCCCTTCACAATATGGAAAGGGCAGTTGGAAGGGGAAGGATGCAGCCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAGTCGTTGGCTACTGGTGTGGATGATGGAAGAACAAAGACTTCGGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCC
  3  -1   2       bld Ovi1      in                        CABI11229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGTGCCCTTTCTGTTGTGAAGTAAAAGCTTCTCTGGAAGAACTAGAATGTCATGTCAAGACTGAACATGCAGATCTTCTGGGAACACCTACTAAAGATGATTGCAGACAGTACGAGTGTCCATTGTGCACCCTTGTGTGTGCAAATAGTCAGATCTTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGCTGTGATGAAGGAGCTTCAGCTAAAACCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGCAACTATTTGGATTAGACAACTCTGGAGGTTACAAGCAGCAATCCCTTCACAATATGGAAAGGGCAGTTGGAAGGGGAAGGATGCAGCCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAGTCGTTGGCTACTGGTGTGGATGATGGAAGAACTAAGACTTCGGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAA
  5   1   2       bld BrSp                             EC2BBA11DA02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACCTCAGTTTCTCTCAGCCTGTGTATTTTCTGCAGGCTGAAAGAAGTTAATCTGCTCCCTTCTACATCCCTGTGTATCTGCCCTGAAAACTATAGCTTCGGCTTGCGTGCAGGTACACGAAGGGGAGGAAAGTACAGCACTAATCTGCAAATGTTGTTACTGTACCATAATGTAATTTGGGGATTCACAGGAGCTTCAGCTAAAACCTCCACTGATCAGAATTTGGCAAGACAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACAACGAGAGAAGGAAGAGTTCCAGAAATTACAGCAACTATTTGGATTAGACAACTCTGGAGGTTACAAGCAGCAATCCCTTCACAATATGGAAAGGGCAGTTGGAAGGGGAAGGATGCAGCCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAGTCGTTGGCTACTGGTGTGGATGATGGAAGAACTAAGACTTCGGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTAC
  5   1   0       add Tad5      in                         XZT24771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTGATTGGGGTTGTGCTCTTCAAACTGGGTTATAAGGTTTCTTTCTGTCCTGGATAGACATAATATGAGCTGTTCTTTATGGTTTGTTGTATCAAAGGGAATCTTTAAAAAGAAAGACCTCTATAAATCAAGTGCTGTGTGCAAAGTGCAATTTTGGATGCATATTACAAAGTTTTTTCCATAATGCAGAGTTTTCTCCCATTATTCATTATTGTTTTGCCTTCATGCATTTTTGCACTCAACACAATTGCATTAAATTGCATTAAGGCACAAGCAGCCATTGTAGTAGGGATTGGGCCATTTCTTGTGCTTGGCATTTAAATTATATATGTGCAGCCTCATTTAGGGGCATTATCACAATTGCAGATAAATAAACCCTGTTATTATATGAGTTATTCATCTGGACAGTATTGTGAATGATCAATAATTCACAATCATGTTTCAGAATAAATATTGGTAGATACAATcacactaaggggctgatttactaacccacgaatccgacccgaattggaaaagttccgacttgaaaacgaacattttgcgactttttcgtatgttttgcgattttttcggcgtctttgcgaatttttcgttaccaatgcgatttttgcgtagaggcgcgagtttttcgtagcctttgcgaaagttgcgtagaatcttgcgatttttccgtggcgttgaaacttgcgcgaaaagttgcgcctttttcgtagcattaaaacttaaaaggtgcgaagtttcgcgtaagttttaccgctacgaaaaaagcgcgGC
  5   1   2       bld Liv1      in                        CAAR10371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGGGGTTTAGCTTGAAAAATACAAAAATGTATTAATGTTTTCTAATGGATTTATTTTTCCTTAAGGTGTTATAGAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACNAGATTCAAAAGTCTTCAGAGCTGAAA
  3   1   2       bld Liv1      in                        CAAR10371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGTGTATAGAAAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGAGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGC
  5   1   2       chi Ovi1      out                        CABI4444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCTTTGACTAGATATTATCGTAATGCAGCCCATGAAGTTACTCGTGTTTGGCTATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTAAGCTATTATATACAATCATTTATTCTATTTAGTGCCCAACCATCTGTTAAAGTATTCCATTTAACAAAAAGGTATTGCACCTTCTTGATTTGCCGGGTCAGTCTTATGATACATTGCCCCCTTCCACTTGTCTATATGTCTTTTTTGTACCTGGTCCTACCATAATTGGTGGGTTTTTTCTTTGTTTTTTTGCTCATTCTATGAAGTAAGAATATATAGTTAGTAGTACTGCACTCCACAGTTTATAAGAAAATGCTTTATTTGGATAAAAAAAAACTATAGTGGTCCTGAGGAAGGTCACCTGAATGTGACCTTTACATTGGAAGTGACCTGTGGAGTGCAGTGCTATATTGACTATTGATTCCTCCTAATCTGTACCCAGACAAATTGAgacacatagaggccgattcactaaaggttgttaacgcttaacacatagttttatgtgttaaaaagtgttcattaattaagtactgattcatncagtacttttgcatactttactactcatatcgcatgtgca
  5   1   2       chi Egg       in                   TEgg024h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAAAATACATCTGAGGGCATCATTGATAACTCTGCTGGTCGTAGAGCTTTACAGGATTCCGACACTAGGGACCACGAAGCATTGATTGCAGACAAACCCAGGCTTTCTGTCCCTTCCCAACCCAATGAGAACAATCTTCAAAACAACCTAAATAATGAATGTCCACAATTCAGCAGAATTCATTGTCTTTCTACTTCTAAATCTTCTTCTGTTGCACAACCTACAAATACTATCATAGACCTTACCGCTGGTGCTGCTTGTTCTGAGCCTTCTGTATATGATGTTGACTCTGTTAGAGAAATTTGTGACAATACAAATTTTGATGTTCAGTCCCAGTCTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTCTGTTGTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGC
  3   1   2       bld Neu  FL   in                    TNeu109g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCAGCCCATGAAGTTACTCGTGTTTGGTATGCTCAAACTTAGACCACTTCAGTAACTTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Ovi1 PIPE in                        CABI10906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATGCTCAAACTTAGACCACTTCAGTAACTCTTCAGGGGATAAAGGTTGGGGCTGTGGCTTCCGGAATTTCCAGATGCTTCTTTCTTCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCT
  3   1   2       bld Te5       in                         CAAO1287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCATTGTGTTTTTGCCTTCATGCATTTTTGCACTCAACACAATTGCATTAAATTGCATTAAGGCACAAGCAGTCATTGTAGTAGGGAATTGCGCCATTTCTTGTGCTTGGCATTTAAATTATATATGTGCAGCCTCATTTAGGGGCATTATCACAATTGCAGATAAATAAACCCTGTTATTATATGAGTTATTCATCAGTATTGTGAATGATCAATAATTCACAATCATGTTTCAGAATAAATATTGGTAGATACAATCACACTAAGAGATGGAAATTTCAGTTTTAAGCTAATTAGCTTCAAGTGCTGTTTATGGATAAAGATTTAGTATAGATAGTAGATGTGTTTTTATTGTGATAATAACAGTAATATCTGTTTAATGGACACAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTG
  5  -1   2       bld Ovi1      in                        CABI11229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCCTTTTGCTGAATGATGCTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGC
  5   1   2       bld TpA                           TTpA045n11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTACCATAACTGCTTGCAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTG
  3   1   2       bld Egg  5g3  in                    TEgg056e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGCCTGTAGGTCAATACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTTACCCTCAAGGTGTTTTTCATTTTAATGGCAAATTACAAGGTTCCAAGGCTTGGATTGGAGCATGTGAAATTTTTTTTTTGCTGACATCACTCCAGCTAAAGTGTTGAATTATTGATTTCCATCAGCCAAGCAGTTTATCCGGAACACATCCTTTGTTATTTGACTGGGTGCTGAAGTATTATGGTTTGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTTCCACCAAGGTGCCAATTTATTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGGGAAAGAATAACCCCTTTTCCCTTTTAATTTTTGATCCGGGGGGCTTTTTTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGGTGTTTTTAAAGGTTTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTTCCAGATTGTGGCAGTAGATGGAACCCTTTTTCCAGAAGGAAAAGCAGTCCGATTACAAGATTCAAAAGTTTTCAGAGCTGAAAGGATTCCATAGGGAAAAGAGCATTTTTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAAGTTTATATTTGGCAAAAAAAAGGTTCAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                          XZG5814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGACCTTGTATTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTAGC
  5   1   2       bld Egg                            TEgg108a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCAAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTG
  5   1   2       bld Gas7      in                          XZG5814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGATCCAGTCTATGATTGAAGATGCGTGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTAGCANAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                         XZT24771.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           aaagactcgcgtttttgcgcgggaatcgtgttggtaacgagaaattcgtggggacgccgaaagagacgcaaaacatacgaaaaaatcgcaaaataccgatctttacgaaaaaaacgcaatcggactcatttcgacccgttcgtgggttagtaaatcagcccctaagaGATGGAAATTTCAGTTTTAAGCTAATTAGCTTCAACTGCTGTTTATGGATAAAGATTTAGTATAGATAGTAGATGTGTTTTTATTGTGATAATAACAGTAATATCTGTTTAATGGACACAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACCCCTTTTGCCTTTTAATTTTTGATCCTGGGGGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATTTTTG
  5   1   2       chi Egg                            TEgg131c24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAAGGAAGGTTTTGACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTAT
  3   1   2       bld Egg  5g3  in                    TEgg001f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCTCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCGAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX8689.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATTTACTGTCTGCTGACATCACTCCAGCTAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGGGAAAGAATAACCCCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTTTTTTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCCCAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTTTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATTTG
  3   1   2       bld Egg       in                    TEgg024h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTTTGATGTTCAGTCCCAGTTTGTTACCCCTCCACCTTCCTGTGACATGGACTTTGTTCCAGAGTGCCCTTTTTGTTGTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCCCCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACCCCTTTTGCCTTTTAATTTTTGATCCTGGGGGCTTTTTTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTTTTAAAGGTTTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTTTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTTTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTTTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGGGAAAAAAAAAAAAAAAAAAAA
  5   1   0       chi Te5       in                         CAAO1287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTATTTGGAATCCTTCTGACAGGAGTAGTTAAAAATCTGCAGTAATTAAGTACCATAAATGCTTAAAAATGTAGCGTACTGAAATGTGGATTTTCACTTCCTGCAATAGTAAATCACAAACATGGTGAACATTGCATTAAGGCATGGCAGCTGCTAAACATATAAATAATACTCAAAAGCAATAACCTATAAAATATATCCTCATACGTGATGTATAATGATGTGCTCAGTTAAACTTGGTGCTTAGTTGTATGTTTCCCCTTTACTTAAGCATACAAAATGATACATAAATAGTTCTGAAATAAAGGTGAACTGTAAACCGAATAAAATGTTATGATGTTGCAGAAAACATTAGGTTTCATTAAAAAAGTCTGAAATATTACTGCTTCTGAACAAGTTTAATGTGACACCTGATTGGGGTTGTGCTCTTCAAACTGGGTTATAAGGTTTCTTTCTGTCCTGGATAGACATAATATGAGCTGTTCTTTATGGTTTGTTGTATCAAAGGGAATCTTTAAAAAGAAAGACCTCTATAAATCAAGTGCAGTGTGCAAAGGGCAATTTTGGATGCATATTACAAAGTTTTTTCCATAATGCAGAGTTTTCTCCCATTATTCATTGTTGTTTTTGCCTCATGCATTTTTGCACTCAACACAATTGCATTAAATTGCATTAAGGCACAAGCAGTCATTG
  3   1   2       bld Tad0      in                     NISC_no24h11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTATTGATTTCCATCAGCCAAGCAGTTCATCCGGAACACATCCTTTGTTATTTGACTGGGTGGTGAAGTATTATGCTTTGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTTCCCCCAAGCTGCCAATTTTTTTTCAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGGGAAAGAATAACCCCTTTTGCCTTTTAATTTTTGATCCTGGGGGGTTTTTTGAAAATATGGGAAAATTTTTAAAACAGAATGTAGATGGTGGTGTTTTTAAAGGTTTGGGGAAATTTGTGGGGAGCCTGAAGCCCAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTTTTTCCAGAAGGAAAAGCAGTCCGGTTTCAAGATTCAAAAGTTTTTAGAGGTGAAAGGATTCCATAGAGAAAAGAGCATTTTTTTTATTTCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGGGAAATATTAGTTTTTAAAAGCAGATTTATTTTTGGTATTAATATTAAAAGTTTATTTTTGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Ovi1      in                         CABI6714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAAAAAAA
  5   1   2       bld Ovi1      in                         CABI6714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTATTGATTTCCATCAGCCAAGCAGTTCATCAGGAACACATCCTTTGTTATTCGACTGGGTGCTGAAGTATTATGCTTCGGAAGGGCCTGTAGTAGGCAAGGTGGTTTGTACCACCAAGCTGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAGCGAAAGAATAACACCTTTTGCCTTTTAATTTTTGATCCTGGGTGCTCTTCTGAAAATATGCAAAAACTATTAAAACAGAATGTAGATGGTGCTGCTCTTAAAGGTCTGCGGAAATTTGTGGGGAGCCTGAAGCACAAGCAGTACCAGATTGTGGCAGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg014k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTAGATGGAACACTCTCTCCAGAAGGAAAAGCAGTCCGACTACAAGATTCAAAAGTCTTCAGAGCTGAAAGGATTCCATAGAGAAAAGAGCATTTCTATTATTCCATTGTATAAAATAAAAATGTATGTAATATCCAACATTTGTTTTTATATTTATTATGAGAAATATTAGTTTTTAAAAGCAGATCTATTTTTGGTATTAATATTAAAAGTTTATATCTGAAGTTTCATTTGTCTGTGGTTCTTCAACTGCTCAGTTAGATGGCTCTATTCAAAACTGTACATAAAAGGACATTGTATTACAGATTTATCAAACCCTTATAGGCAGATTTATTTATTTATTTTTTTTTTTTAAATCTGGAAACCTTGATTGTGTAAAAACTTGAAAAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)