Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas116o05.3                         71 END     4          19        5                PREDICTED: zinc finger, CCHC domain containing 6 [Gallus gallus]

 This cluster: approximate FL confidence score = 95%

 1012076512 Xt7.1-CAAN3010.5.5 - 21 ESTs
                                                                       ...-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN3010.5.5                                                                                    ATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAA
                                                  Xt7.1-CHK-1008230082                                                                                          TGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGC
                                                      consensus depths                                                                                         3     3     4     4     5     5     7     8     7     8     9    10     9    12    10    13    10    13    10    14    10    14    10    14    13    14    15    16    15    17    17    18    18    19    19    20    20    21    20    21    20    21    20    21    20    21    20    21    19    21    20    21    20    21    20    21    20    21    19    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    18    20    16    19    16    19    13    19    13    18    13    18    13    18    13    18    13    17    13    17    13    17    11    15    11    15    10    14    10    14    10    14    10    14    10    14    10    14     9    13     9    13     7    12     7    11     7    10     6     9     5     8     5     7     5     5     5     5     5     5     5     5     4     4     3     3
  5   1   2  SIG                                      Xt7.1-CAAN3010.5                                                            CAAGATGAGATTTGTGCTATCGGGATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCTACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAA
  5   1   2  SIG                                    Xt7.1-TTbA003k22.3                                                                                                  AGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAAT
  5   1   2  SIG                                       Xt7.1-st67e23.3                                                                                                                                                  GCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGA
                                                                   VAR                                                                                                                                                                                                CGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGC
                                                                   SNP                                                                                                                                                                                                                                    -AT---------
                                                                   SNP                                                                                                                                                                                                                                                            ------A-----
                                               BLH ATG     179      95                                                                                    
                                               BLH MIN     179      16                                                                                    
                                               BLH MPR      86      16                                                                                    
                                               BLH OVR     179     266                                                                                    
                                               CDS MIN     179      16                                                                                    
                                               EST CLI      35       1                                                                                    
                                               ORF LNG     179      37                                                                                    
                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 9e-010     FAA00165.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 9e-041     NP_705766.2 zinc finger, CCHC domain containing 6 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 2e-044     NP_078893.2 zinc finger, CCHC domain containing 6 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 3e-045     XP_001233427.1 PREDICTED: zinc finger, CCHC domain containing 6 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN3010.5.5                                                                                      TAG---------------------------------------------------------------------------------------------ATG---------------------------------TGA------------------ATG---------------TGA---ATG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2  SIG                                      Xt7.1-CAAN3010.5                                                            CAAGATGAGATTTGTGCTATCGGGATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCTACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAA
                                                  Xt7.1-CHK-1008296320                                                                  GAGATTTGTGCTATCGGGATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCTACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGC
  0   1   1           Neu  FLt3                   TNeu125m12.FL-Sanger CCCGGGGAATCCCCGGGGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGGGGCCTGGAGCTCTGTTTTTAGAGTGAAGAGGGACCTACTTCCTAGAAACAGTGTATCCGATTGTGCTTGGACTTAGGATTTACTGCAGTGCTGGGTGACTGAGCTCAGGAAACATCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAATCTGAGGGAAAAAAAAAAAAAAAAAA
  5   1   0       chi Neu  FLt3 in                   TNeu125m12.p1cSP6    CCGGGGAATCCCCGTTGCTGAAGCAGCTAACCGAATAAGTCCCAAACGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGGGGCCTGGAGCTCTGTTTTTAGAGTGAAGAGGGACCTACTTCCTAGAAACAGTGTATCCGATTGTGCTTGGACTTAGGATTTACTGCAGTGCTGGGTGACTGAGCTCAGAAACATCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAG
  5   1   2       ext Gas  5g                        TGas057b13.p1cSP6                                                            CAAGATGAGATTTGTGCTATCGGGATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTAAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAA
  5   1   3   14   nb Te4  5g3  out                        CAAN3010.5p .............................................................................ATCGGGATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTTTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAAGAGCGTCTAAAAAGAGACTGCATTTACAGGCTC
  5   1   4      seed Te1       in                         CBWN1926.b1                                                                                  GGATTAGCTGTCGGGTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGA
  5   1   3        nb Gas  5g                        TGas006o23.p1kSP6                                                                                                GTAGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTAAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCANAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAA
  5   1   2       add Gas  5g                        TGas052e15.p1cSP6                                                                                                               CTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTAAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGTTCTTAAAATGTTTGTTTATATTGTCCTTTTTTTACTAAACATGCAACTATTGTACTGAAGTGGCTAAGGAATTGTATTCTACTTTTGATTGGCTT
  3   1   0       chi Neu  FLt3 in                    TNeu125m12.q1kT7                                                                                                                                      TTTTAGAGTGAAGAGGGACCTACTTCCTAGAAACAGTGTATCCGATTGTGCTTGGACTTAGGATTTACTGCAGTGCTGGGTGACTGAGCTCAGGAAACATCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAATCTGAGGGAAAAAAAAAAAAAAAAAA
  5   1   3   14   nb Te3  5g3  out                       CAAM14657.5p ......................................................................................................................................CTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCCTGTATAGATGAATCAGCTCTATCTC
  5   1   3   14   nb Te3  5g3  out                        CAAM9326.5p ..........................................................................................................................................AGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGNGCTTGCAACAAGCAGAGGAGCGTCTAANAAGAGACTGCATTTACAGGCTCANAAGGCGTC
  5   1   2   10  ext Fat1 5g3  out                       CABC10738.5p ..............................................................................................................................................................CCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCTACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAG
  3   1   4      seed Te1       in                         CBWN1926.g1                                                                                                                                                                                                                                                            CAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TTbA003k22.3                                                                                                  AGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAAT
                                                  Xt7.1-CHK-1008296316                                                                                                        CAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAxxxAxAAxAGAAATCTGAGG
  5   1   2       ext 1030 5g                         IMAGE:7026277.5p                                                                                                  AGGAGCCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAGGGACTTGTTGGGCTTGNCAACAGCAGAAGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAAATACCCCACTGCTGGTTTATTGCTGTAAAGCTTTTGCGATGCCTTTGGTTTGAA
  5   1   4      seed TbA       in                   TTbA003k22.p1kSP6                                                                                                                       TATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAAAAAAAAAAAAAAAAGCGGCC
  3   1   4      seed TbA       in                    TTbA003k22.q1kT7                                                                                                                        TATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGGTGCGGTGTCTAATTGTAGCCCATAACTGAATCTCTCATAAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAAAAAAAAAAAAAAAGC
  3   1   2       ext Egg       ?                     TEgg007e24.q1kT7                                                                                                                                                                                                                                                                                                         CAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAATCTGAGGGAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-st67e23.3                                                                                                                                                  GCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGA
                                                  Xt7.1-CHK-1008296318                                                                                                                                                        AGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAATCTG
  5   1   4      seed Tail      in                         CBSW3041.b1                                                                                                                                                  GCAAGGAGCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCA
  5   1   2       ext Gas8      in                          st67e23.5p                                                                                                                                                         GCTAGGTATTATTTGTTTGTGGGAGCTGAAGCAGCTAACCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGCATTAATGATTTTGTCTGCAATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACNGAAGA
  5   1   3        nb Gas8      in                          st69e23.5p                                                                                                                                                                                               CCGCGTCTGTCCCAAAGCGGAACTATTGGACGGTATGGATAAGCATTAATGATTTTGTCTGCNATTTGAAAAATGGGGGATGCTGCCAAACAAGTCAAACACCATGCATTAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAANAAAATACNGGTGGACTCTCAAAGAAAGCCNATTCCGGTCATCTGCAGCAACAGTCCCANANATGGGCTACATCAGANCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTANTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCANTGAGCATNAAGAGGCTCACAAC
  3   1   2       ext Gas8      in                          st67e23.3p                                                                                                                                                                                                                                                                   AAAAATGGGGGATGCTGCCAANCAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTC
  3   1   3        nb Gas8      in                          st69e23.3p                                                                                                                                                                                                                                                                                   GCCAAACAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACCAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCNTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGNCTTGTTGGGCTTGCAATCAANCAGAGGA
  3   1   4      seed Tail      in                         CBSW3041.g1                                                                                                                                                                                                                                                                                         CAAGTCAAACACCATGCAATAATGGATGAAGAAGAATACAAAAGGCCTGTTGTCAAACAGTCAATTGGAAACCACGAAATACATGGAGTTAAGAAAATACAAGTGGACTCTCAAAGAAAGCCAATTCCGGTCATCTGCAGCAACAGTCCCAGAAATGGGCTACATCAGAGCACTTTTAAGAATTACAGTCGCAGTCCTAATAGCCGACCAAGCAATATTCATAAAGATGGACATAAGAGATGGCTTACCGACGTTCCTCGTAGTCACTCTGATAACTGGAGAGATCGGAAGCACCAGCCATTTAATCGAACAAGGAACGATTCCACCAATGAGCAAGAAGAGGCTCAGAACTGGAGGCGTGATGGAGGTGAGCGAAGCAATGAAAGTGGGAGGAGACATAATCAGAAGGGGATTACAAGTAAAGATTATGTTGATGGACACACTGGAGTAGCTGACACTTTTAAACAGGAGAAGAAAAGATTTGACAGAAGAAGATGTAAATCTGAGCGAGATGAAGAAGATTATATTGAGAGCCCTGTTATAGATGAATCAGCTCTATCTCAGAAGGACTTGTTGGGCTTGCAACAAGCAGAGGAGCGTCTAAAAAGAGACTGCATTTACAGGCTCAAAAGGCGTCCACGGAAATACCCCACTGCTGTTTATTGCTGTAAGCTTTGCGATGCTTTGGTTGAGTCTGTGTCATCTGCTCATAAGCATATTAAAGAAAAAAGGCATAAGAGAAATCTGAGGGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)