Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI14392.5.5                        26 END     1           1        3                (no blast hit)
     2   2.0    0Xt7.1-CABG4016.5                           16 END     1           1        6                hypothetical protein MGC29784 [Homo sapiens]
     3   2.0    0Xt7.1-XZT58172.3                            8 END     1           1       12                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012076688 Xt7.1-CABE1709.3.5 - 63 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     4     4     4     4     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    12    15    15    15    15    15    15    14    15    13    15    14    15    13    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    15    13    14    13    13    13    14    14    14    14    15    14    15    14    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    15    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    13    13    13    13    13    13    13    13    12    12    12    12    11    11    11    11    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     9     7     8     6     7     7     8     7     8     7     8     7     8     8     9     8     9     6     7     6     7     6     7     6     6     6     6     6     6     4     6     4     6     4     6     4     6     4     7     6     8     6     8     6     8     5     8     5     8     5     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     7     9     7     9     7    10     8    10     8    10     8    10     8    10     8    10     9    12    10    12    10    12     9    13    10    13    11    14    12    15    13    16    12    16    14    17    15    18    14    17    15    20    16    20    16    20    17    21    17    21    17    21    17    21    17    22    17    22    17    22    17    23    17    22    17    22    17    22    17    22    19    23    19    23    19    23    19    23    19    23    19    23    19    23    18    23    19    23    17    22    16    20    15    20    15    20    15    20    15    20    15    20    15    19    15    19    15    19    15    19    15    19    14    18    14    19    15    19    19    23    18    24    17    24    18    25    18    25    19    27    19    24    19    24    19    24    19    24    20    25    20    24    20    24    20    24    21    25    22    25    22    25    22    25    22    25    22    25    21    23    22    23    22    23    22    23    22    23    20    23    19    23    14    20    13    17    13    14    13    14    14    14    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13     7    13     7    13     7    13    11    13     6    13     6    13     5     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACAAGAAGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATCAGTGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAAGGGATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAACTGGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------TG--
                                               BLH ATG     512     940                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     512     171                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     512     571                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     512     181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Br ---- 2e-007     ABH05921.1 Bam32 [Branchiostoma belcheri tsingtaunese] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-007     XP_800520.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sc ---- 1e-009     NP_012284.1 Required for invasion and pseudohyphae formation in response to nitrogenstarvation; Muc1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 4e-022     NP_523890.2 CG1044-PA, isoform A [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 2e-091     NP_998522.1 zgc:56412 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_067331.2 growth factor receptor bound protein 2-associated protein 1 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_002030.2 GRB2-associated binding protein 1 isoform b [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 0          XP_420422.2 PREDICTED: similar to GRB2-associated binding protein 1 isoform 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          AAH77980.1 Unknown (protein for MGC:81548) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = ?? ==== 0          NP_001089201.1 hypothetical protein LOC734248 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABE1709.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAA------------------------------------------------TAA---------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------ATG---------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------TAA---------TGA------------------------------------------------------------TGA------------------------------------TAA---------------------------------TAA---------------TAA------TAG------------------------------------------------TGA------------------TAA---------------------------TAG------------------------------------------TAA------------TAA---------------TGA------------------------------------------------------------TAA------------------TGA---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       ext Neu  5g                        TNeu039g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGAGAAAGAAGAGAAAGGGAGGAGAGCGAAGGATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCNGGATGGCTCCGCAAATCCCCCC
  5   1   2       ext Neu  5g3  in                   TNeu055f02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAGCGAAAGGATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTATCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCATGAGGGGAGCGCCGAGGAGCATGATGATGATCAGTGGCATCGGCGGATGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATG
  5   1   2       ext Egg  5g3  in                   TEgg058i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGGGATTTACTGTTACGAGATAAAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAAGGGGGTGGGGGCT
  5   1   4      seed Tad5      in                          XZT4711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGATTTACTGTTACGAGATAAAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGTGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATNCAGACCATTGACAGAGTATTTTATTTAG
  5   1   0       chi Tbd0 5x                            IMAGE:6976578                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGGGATTCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCACTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGCAACGTTTCGTACAGCAGCTCTGAAACAGGGTAGATCCCCATCGCATGGGCCCCAATTGGCATGGAAGAGGAGATGGTTTTGTCCTTCGCAATGGACCTCCTACAGGCACACCCCCATGTGCCTGGCATATTACCAAACTGATCCTGCCAAAAAAGCCAATCCGGCCTTATTGGACTTAAAATTTGCGGTGAACCCACTTGATTGCTGGGGTTGGGTGTTTCCACAAAAAAAGGAATTTTTGGAAAATTAATTTATTATTTTTTTGCACACCCAGGGAACCTTTTGACCCGAACTCATTTTTTATCTTCAATGGGGCG
  5   1   3        nb Neu  5g                        TNeu009k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAAACGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAAGAGATGGTTTGTCCTTCACAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGC
  5   1   3        nb Egg       in                   TEgg044g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGATAGCTGGAGTACTTTATTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACGGGAACAACACAAAGTTGCGCGGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGC
  5   1   3        nb Egg  5g                        TEgg097k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGACGCGGCGGGGAGGTGGTAAGCTCGGGATGGCTCCTCAAATCCAGCACCGGAGAAAAAGTTGAAACGTTTCCCATGGA
  5   1   3        nb Egg  5g                        TEgg131l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGAT
  5   1   2   12  ext Gas7 5g3  in                         XZG28814.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACGCGNTCCGTAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGACACATCTGTGATATCTGTGGATTTAATCC
  5   1   2       ext TpA  5g3  in                   TTpA051b02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCCTCAATAG
  5   1   2   14  ext Brn3 5g3  in                        CAAK11861.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAAACCTGAAACATTGAGAACTCAAGGGGGATTCCACAAGGACA
  5   1   3        nb Egg  5g                        TEgg084f24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTC
  5   1   3        nb Egg                            TEgg120c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTTGCT
  5   1   0       chi Ova1      in                         CABE2048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCATAGATATGGGAAGGTAACGGGGAAGAGAGACCCTTCCTGCATTTTTAACACGCTTTACTTTCAGACTGGACAAGTCACCATTTTGTTTTGCAGAGAAACAAAGGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGGCATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACCGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACT
  5   1   3        nb Egg                           TEgg053a13.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAG
  5   1   3        nb Neu0                               IMAGE:6996116                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTTAACATGTCTGGGAGCCCTCTTCTCTAGAAACACANGCTAAAGGCAGTTTTTCATTAAAGCTAATGACATTCCCCTCCATCATTCTGGAAAGCCACTTTATCAAATTCCCCCAGAACTG
  5   1   3        nb Gas7                                 XZG37232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACT
  5   1   2       ext Ova1      in                        CABE10345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAANGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTT
  5   1   3        nb In63                            IMAGE:8957437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGGCCCCAATTCCCGCATTATTGACTTAAATTTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGAACATGTTGCTACTCACAAAGGTTCCTCCGGCCCAAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATTGACTCTCATCCCGTGGTGGATCATCTTCTACAGAATCTAGTTTCTACAGTCCTTCCTAGAAGCTACTCACAAGAAGGTTTCACCAAAGCTACTTCCCC
  5   1   3        nb Gas7      in                         XZG51473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCANTTGGAATGCAGGTCCCACCTCCAG
  5   1   2       add Gas7                                  XZG8865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATAATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGGCCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCNAACCAGATAGGAAAGATCAGTGAATATCTGC
  5   1   2       ext Gas7      in                         XZG45990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCGAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCT
  5   1   3        nb Gas1                               IMAGE:6987581                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTTTTCATTAAGCTATTACCTTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTATTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAAGAAACTATGTAGCCATGAAACCCAGTCTCTCCACAGAAAGATCCCAGGTTTGTTTGGGGAGCACCAGCCCTTGATGAAGGCCAACAGTCCCTATTGATAAA
  5   1   3        nb Ova1      in                         CABE1709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCGAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCGCCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAATCCAAGTCTCTCCACA
  5   1   3        nb HeRe                             EC2CAA40AD07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAG
  5   1   0       chi Gas7      in                         XZG18545.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCAC
  5   1   2       add Tad5      in                         XZT26756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGGTCAGAGCCCTAAAATTTTAAGACCTAAACCTCATGGTTTAGAGCGAACCGATTCCCAAACCATAGGTGAATTTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAAGCAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCCACCA
  5   1   2       add In63                            IMAGE:8959648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGGGGCCCCTTTTTTTAAAAAAATAAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAGTGTTGGCTCTGGAAGGCAGTGCTGCTGATGAAAAGGTTGACTACGTGTCGTAGACAACAGAAAACTCTAGCGCTGAAGTAACAGAGAGCATGACTGATGGGAGACGTCGACGGACCGACGCACTAGATTAAAATACGCTAGGATTGGACTCTTAATCCAGGGTGCAGTTGGAGCAACATTCAATGCTTCATAGAATGA
  5   1   3        nb Gas       in                   TGas131a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTG
  5   1   2       add Tad0                               IMAGE:6985652                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTTTCGAGCCCGAACTCTCCTCCGCGAGATCTTTTCCACCGCTGTCCTGAACCAGTTCAAGAAACCCACTATGTTCCTATGACTCCTGGTATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGCATAGTGAACAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTCGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCATGAAAGAATATAAGTGTTGGTTCTGGAAGCAATGCTGCTGATGAAAAGTTGACTACGTTGCCGTATACAACAGAAAACTCTACCGCTGAAAGTACCAAAGAACATGGATGATGGGAGACCCCACCGAACCTAATGTCATTAATATATTAATCACCCCCTCAGACTG
  3   1   3        nb Ova1      in                         CABE1709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGCATTCCAACAGCTGTACTGAACCAGTCAAGAAAACCAACTATGTTCCTATGACTCTTGGCATGTTTGACTTCTCATCATTGGAATGCAGGTCCCGCCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACNCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAATCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGCCTCTCG
  3   1   3        nb Gas       in                    TGas131a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCCTGTGTAAATAAATAATGTTTTATGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg044g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAACCAACTATGTTCCTATGACTCCTGGCATGTTGACTTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAAATTGAAGTCCTGTGTAAATAAATAATGTTTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                        CABE10345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCATTTGGAATGCAGGTCCCGCCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGT
  3   1   2       add Tad5      in                         XZT26756.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACCAGTCGATCGTATCTCAAACCAGATAGGAAAGGTCAGAGCCCTAAAATTTAAGACCTAAACCTCATGGTTTAGAGCGAACCGATTCCCAAACCATAGGTGAATTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGT
  5   1   2       add Met5      in                         CACX1346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGAGACGTGCAACTAAACTGGTCAGAGCCCTAAAATTTTAAGACCTAAACCTCATGGTTTAGAGCGAACTGATTCCCAAACCATAGGTGAATTTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAANAAGATTACCATCTNAACAGAACCATTTGTTTAACACATCTAGCCATGTTT
  3   1   2       ext Gas7      in                         XZG45990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTCTATGTAAAAAGAAAAAAAAACAAAAACC
  3   1   2       add Gas8                                 st107j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACCAGATAGGAAAGGTCAGAGCCCTTAAATTTTTAGACTTAAACCTCATGGTTTAGAGCGAACTGATTCCCAAACCATAGGTGAATTTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGTCTTGGATTTAGACTCTGGAAANTCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGNGCAGTTTGGAGCAACACATTNTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTC
  3   1   3        nb Gas7      in                         XZG51473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTAT
  3   1   2       add Ova1      in                         CABE2048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAAACCAGATAGGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAG
  5   1   3        nb TpA       out                  TTpA050i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTCAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACAC
  3   1   2       add Gas7      in                         XZG18545.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCACCTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGAAATAAATAATGTTTTATGTAAAAAGAAAAAGAAAAAAAAAAAAAAAGG
  3   1   2       ext Egg  5g3  in                    TEgg058i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAGGAAAGAAGAAAAGTGTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad0                               IMAGE:6982715                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAATGCATTGATATTCCGGGGCTTCAGGATGGCAGCCCTTGTTTAAGGAAAAACCCTGCAA
  3   1   3        nb Neu                             TNeu132m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA  5g3  in                    TTpA051b02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu  5g3  in                    TNeu055f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAAACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCAATAGGTGGACATAAGCTCATTCCAAATTAAAAAAAAACCGCGTTTGGGGTGTGTATGTACGCACACACAGGGACT
  5  -1   2       add AbdN                               IMAGE:7005958                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATTAAGGTTGTTGGTGGCCCACCCCGGAAAATCTTTTGGCGTGGAAAAGTTCCCCAGGGAAAGCCTGGAACTGTTGGGAGACAGTTCGCCCGAAACGGAAAACGCCCACTTAGGATTTTAAATTAACCGGCCTTTGGGTTTGAACACTTCTTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTNTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAGGGCG
  3   1   3        nb TpA       out                   TTpA050g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTTTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTT
  3   1   2       add Met5      in                         CACX1346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGC
  3   1   3        nb Egg                             TEgg045g05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTAAGCACACACACACGCACACACAGGGACTT
  3   1   4      seed Tad5      in                          XZT4711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTGC
  3   1   2       ext Brn3 5g3  in                        CAAK11861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGC
  3   1   2       ext Gas7 5g3  in                         XZG28814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAATAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGC
  5   1   2       ext Egg       out                  TEgg054o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAAAATAGCACGTTTATTAAGAAAAAGGGTCCGGCGTTTTGGGCGCCAACTGTGCTCTTCCTCAGTTTTTGTCCCTGGGGAGGAGCACAGTTGGTGCTCGAAGCGTTGGACCTTTTTACACACTAACACACACACACATATATTTATATATGTATGTATATATACATATATTAACAGAATGTTTTTTGGGTTAGTCATG
  5   1   3        nb Gas                            TGas049l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGAAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTTGC
  5   1   2       ext Egg  5g3  in                   TEgg055e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGACAGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTACATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCAATGGGACTGGGAATCCCGAGACACGCAACTTTCAGACACTGGAACAACACTAAAGTGGCGCAGATCCCCCCTTTCCCTGCGGGACACAACGCGCCAGAGGGGCCACAAGAGCAACTGGATACTGGAGCCACCAACTACTGACCCGGAGGAGCATGAAGGGAGCGCCGAAGGAGCAGATGATGAGCATTGGCAGCGGTGGAAGGGTGGGGGCTGG
  5   1   4      seed Egg  5g3  in                   TEgg054b01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTT
  5   1   2       ext Neu0                               IMAGE:6994013                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAACCGCTGATATGGATGGAGATTCAAAAGTTTTTTAAATGTCCTGGAGCCCTCTTCTCTAAAAAAAACAGCCTAAGGGCAGTTTTTCCTTAAAGCCTATCGACATTTCCTTCCATCCACCCTGGGAAAGCCATCTTTATCAACAATTTCCCAAGAAAACCTGGTTTCT
  3   1   4      seed Egg  5g3  in                    TEgg054b01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATTGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTTTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCCCAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTTTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCAG
  3   1   2       ext Egg  5g3  ?                     TEgg053c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCCAGGTGACTTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg055e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCTGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCAGGTGACTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (