Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI14392.5.5                        26 END     1           1        3                (no blast hit)
     2   2.0    0Xt7.1-CABG4016.5                           16 END     1           1        6                hypothetical protein MGC29784 [Homo sapiens]
     3   2.0    0Xt7.1-XZT58172.3                            8 END     1           1       12                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012076688 Xt7.1-CABE1709.3.5 - 63 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABE1709.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACCACACGCACACA
                                                  Xt7.1-CHK-1008224747                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCxxxxxxCACACGCACACACAGGGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     4     4     4     4     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    12    15    15    15    15    15    15    14    15    13    15    14    15    13    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    15    13    14    13    13    13    14    14    14    14    15    14    15    14    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    15    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    13    13    13    13    13    13    13    13    12    12    12    12    11    11    11    11    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     9     7     8     6     7     7     8     7     8     7     8     7     8     8     9     8     9     6     7     6     7     6     7     6     6     6     6     6     6     4     6     4     6     4     6     4     6     4     7     6     8     6     8     6     8     5     8     5     8     5     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     7     9     7     9     7    10     8    10     8    10     8    10     8    10     8    10     9    12    10    12    10    12     9    13    10    13    11    14    12    15    13    16    12    16    14    17    15    18    14    17    15    20    16    20    16    20    17    21    17    21    17    21    17    21    17    22    17    22    17    22    17    23    17    22    17    22    17    22    17    22    19    23    19    23    19    23    19    23    19    23    19    23    19    23    18    23    19    23    17    22    16    20    15    20    15    20    15    20    15    20    15    20    15    19    15    19    15    19    15    19    15    19    14    18    14    19    15    19    19    23    18    24    17    24    18    25    18    25    19    27    19    24    19    24    19    24    19    24    20    25    20    24    20    24    20    24    21    25    22    25    22    25    22    25    22    25    22    25    21    23    22    23    22    23    22    23    22    23    20    23    19    23    14    20    13    17    13    14    13    14    14    14    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13     7    13     7    13     7    13    11    13     6    13     6    13     5     6
  5   1   2  SIG                                      Xt7.1-CABE1709.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACA
  5   1   2  SIG                                    Xt7.1-TEgg054b01.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGACAGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTACATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCAATGGGACTGGGAATCCCGAGACACGCAACTTTCAGACACTGGAACAACACTAAATGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAACCGCTGATATGGATGGAGATTCAAAAGTTTTTTAAATGTCCTGGAGCCCTCTTCTCTAAAAAAAACAGCCTAAGGGCAGTTTTTCCTTAAAGCCTATCGACATTTCCTTCCATCCACCCTGGGAAAGCCATCTTTATCAACAATTTCCCAAGAAAACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACAAGAAGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATCAGTGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAAGGGATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAACTGGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------TG--
                                               BLH ATG     512     940                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     512     171                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     512     571                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     512     181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Br ---- 2e-007     ABH05921.1 Bam32 [Branchiostoma belcheri tsingtaunese] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-007     XP_800520.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sc ---- 1e-009     NP_012284.1 Required for invasion and pseudohyphae formation in response to nitrogenstarvation; Muc1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 4e-022     NP_523890.2 CG1044-PA, isoform A [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 2e-091     NP_998522.1 zgc:56412 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_067331.2 growth factor receptor bound protein 2-associated protein 1 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_002030.2 GRB2-associated binding protein 1 isoform b [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 0          XP_420422.2 PREDICTED: similar to GRB2-associated binding protein 1 isoform 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          AAH77980.1 Unknown (protein for MGC:81548) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = ?? ==== 0          NP_001089201.1 hypothetical protein LOC734248 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABE1709.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAA------------------------------------------------TAA---------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------ATG---------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------TAA---------TGA------------------------------------------------------------TGA------------------------------------TAA---------------------------------TAA---------------TAA------TAG------------------------------------------------TGA------------------TAA---------------------------TAG------------------------------------------TAA------------TAA---------------TGA------------------------------------------------------------TAA------------------TGA---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2  SIG                                      Xt7.1-CABE1709.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACA
                                                  Xt7.1-CHK-1008285628                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGA
  5   1   2       ext Neu  5g                        TNeu039g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGAGAAAGAAGAGAAAGGGAGGAGAGCGAAGGATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCNGGATGGCTCCGCAAATCCCCCC
  5   1   2       ext Neu  5g3  in                   TNeu055f02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAGCGAAAGGATTTACTGTTACGAGATAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTATCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCATGAGGGGAGCGCCGAGGAGCATGATGATGATCAGTGGCATCGGCGGATGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATG
  5   1   2       ext Egg  5g3  in                   TEgg058i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGGGATTTACTGTTACGAGATAAAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAAGGGGGTGGGGGCT
  5   1   4      seed Tad5      in                          XZT4711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGATTTACTGTTACGAGATAAAAAAAATGTGTTATATCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGTGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATNCAGACCATTGACAGAGTATTTTATTTAG
  5   1   0       chi Tbd0 5x                            IMAGE:6976578                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGGGATTCCAGTGCGTTTCCAGGAGGAGACGGATAAAGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCACTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGCAACGTTTCGTACAGCAGCTCTGAAACAGGGTAGATCCCCATCGCATGGGCCCCAATTGGCATGGAAGAGGAGATGGTTTTGTCCTTCGCAATGGACCTCCTACAGGCACACCCCCATGTGCCTGGCATATTACCAAACTGATCCTGCCAAAAAAGCCAATCCGGCCTTATTGGACTTAAAATTTGCGGTGAACCCACTTGATTGCTGGGGTTGGGTGTTTCCACAAAAAAAGGAATTTTTGGAAAATTAATTTATTATTTTTTTGCACACCCAGGGAACCTTTTGACCCGAACTCATTTTTTATCTTCAATGGGGCG
  5   1   3        nb Neu  5g                        TNeu009k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAAACGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAAGAGATGGTTTGTCCTTCACAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGC
  5   1   3        nb Egg       in                   TEgg044g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGATTTATTTCTTTGCTCAAACGCGAATCCCCGGTGCTGCCCTCCGTAATGGCACTGGGCTTATAAAGCTTAGCCCGCCTGCGCCTTTTCTTCTGGGAAAAAAAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGTCGGGGAAAGGGGGCGAAGGGTGGATAGCTGGAGTACTTTATTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACGGGAACAACACAAAGTTGCGCGGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGC
  5   1   3        nb Egg  5g                        TEgg097k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGACGCGGCGGGGAGGTGGTAAGCTCGGGATGGCTCCTCAAATCCAGCACCGGAGAAAAAGTTGAAACGTTTCCCATGGA
  5   1   3        nb Egg  5g                        TEgg131l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGAT
  5   1   2   12  ext Gas7 5g3  in                         XZG28814.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACGCGNTCCGTAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGACACATCTGTGATATCTGTGGATTTAATCC
  5   1   2       ext TpA  5g3  in                   TTpA051b02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCCTCAATAG
  5   1   2   14  ext Brn3 5g3  in                        CAAK11861.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGACACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAAACCTGAAACATTGAGAACTCAAGGGGGATTCCACAAGGACA
  5   1   3        nb Egg  5g                        TEgg084f24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTC
  5   1   3        nb Egg                            TEgg120c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTTGCT
  5   1   0       chi Ova1      in                         CABE2048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCATAGATATGGGAAGGTAACGGGGAAGAGAGACCCTTCCTGCATTTTTAACACGCTTTACTTTCAGACTGGACAAGTCACCATTTTGTTTTGCAGAGAAACAAAGGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGGCATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACCGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACT
  5   1   3        nb Egg                           TEgg053a13.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAG
  5   1   3        nb Neu0                               IMAGE:6996116                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTTAACATGTCTGGGAGCCCTCTTCTCTAGAAACACANGCTAAAGGCAGTTTTTCATTAAAGCTAATGACATTCCCCTCCATCATTCTGGAAAGCCACTTTATCAAATTCCCCCAGAACTG
  5   1   3        nb Gas7                                 XZG37232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACT
  5   1   2       ext Ova1      in                        CABE10345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAANGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTT
  5   1   3        nb In63                            IMAGE:8957437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGGCCCCAATTCCCGCATTATTGACTTAAATTTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGAACATGTTGCTACTCACAAAGGTTCCTCCGGCCCAAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATTGACTCTCATCCCGTGGTGGATCATCTTCTACAGAATCTAGTTTCTACAGTCCTTCCTAGAAGCTACTCACAAGAAGGTTTCACCAAAGCTACTTCCCC
  5   1   3        nb Gas7      in                         XZG51473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCANTTGGAATGCAGGTCCCACCTCCAG
  5   1   2       add Gas7                                  XZG8865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATAATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGGCCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCNAACCAGATAGGAAAGATCAGTGAATATCTGC
  5   1   2       ext Gas7      in                         XZG45990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAGCCGCTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTAAGGCAGTTTTCATTAAGCTACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCGAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCT
  5   1   3        nb Gas1                               IMAGE:6987581                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTTTTCATTAAGCTATTACCTTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCAAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTATTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAAGAAACTATGTAGCCATGAAACCCAGTCTCTCCACAGAAAGATCCCAGGTTTGTTTGGGGAGCACCAGCCCTTGATGAAGGCCAACAGTCCCTATTGATAAA
  5   1   3        nb Ova1      in                         CABE1709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTTGGGTCAGTCTTCAGCAAAGTTAGAGTCCATTACAGATGTTCCTCCTCCCAGACCGCCGAAGCCTCACCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCGCCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAATCCAAGTCTCTCCACA
  5   1   3        nb HeRe                             EC2CAA40AD07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAG
  5   1   0       chi Gas7      in                         XZG18545.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTTCCAACATCCGGAATGCCTGCATCCCGTAGTAATACTGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATACAAGTTCTCAAGATTTCTATGACATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCAC
  5   1   2       add Tad5      in                         XZT26756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCCACGACCATTTACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGGTCAGAGCCCTAAAATTTTAAGACCTAAACCTCATGGTTTAGAGCGAACCGATTCCCAAACCATAGGTGAATTTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAAGCAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCCACCA
  5   1   2       add In63                            IMAGE:8959648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGGGGCCCCTTTTTTTAAAAAAATAAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAGTGTTGGCTCTGGAAGGCAGTGCTGCTGATGAAAAGGTTGACTACGTGTCGTAGACAACAGAAAACTCTAGCGCTGAAGTAACAGAGAGCATGACTGATGGGAGACGTCGACGGACCGACGCACTAGATTAAAATACGCTAGGATTGGACTCTTAATCCAGGGTGCAGTTGGAGCAACATTCAATGCTTCATAGAATGA
  5   1   3        nb Gas       in                   TGas131a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTG
  5   1   2       add Tad0                               IMAGE:6985652                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTTTCGAGCCCGAACTCTCCTCCGCGAGATCTTTTCCACCGCTGTCCTGAACCAGTTCAAGAAACCCACTATGTTCCTATGACTCCTGGTATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGCATAGTGAACAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTCGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCATGAAAGAATATAAGTGTTGGTTCTGGAAGCAATGCTGCTGATGAAAAGTTGACTACGTTGCCGTATACAACAGAAAACTCTACCGCTGAAAGTACCAAAGAACATGGATGATGGGAGACCCCACCGAACCTAATGTCATTAATATATTAATCACCCCCTCAGACTG
  3   1   3        nb Ova1      in                         CABE1709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGCATTCCAACAGCTGTACTGAACCAGTCAAGAAAACCAACTATGTTCCTATGACTCTTGGCATGTTTGACTTCTCATCATTGGAATGCAGGTCCCGCCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACNCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAATCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGCCTCTCG
  3   1   3        nb Gas       in                    TGas131a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCCTGTGTAAATAAATAATGTTTTATGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg044g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAACCAACTATGTTCCTATGACTCCTGGCATGTTGACTTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAAATTGAAGTCCTGTGTAAATAAATAATGTTTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                        CABE10345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCATTTGGAATGCAGGTCCCGCCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGT
  3   1   2       add Tad5      in                         XZT26756.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACCAGTCGATCGTATCTCAAACCAGATAGGAAAGGTCAGAGCCCTAAAATTTAAGACCTAAACCTCATGGTTTAGAGCGAACCGATTCCCAAACCATAGGTGAATTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGT
  5   1   2       add Met5      in                         CACX1346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGAGACGTGCAACTAAACTGGTCAGAGCCCTAAAATTTTAAGACCTAAACCTCATGGTTTAGAGCGAACTGATTCCCAAACCATAGGTGAATTTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAANAAGATTACCATCTNAACAGAACCATTTGTTTAACACATCTAGCCATGTTT
  3   1   2       ext Gas7      in                         XZG45990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTCTATGTAAAAAGAAAAAAAAACAAAAACC
  3   1   2       add Gas8                                 st107j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACCAGATAGGAAAGGTCAGAGCCCTTAAATTTTTAGACTTAAACCTCATGGTTTAGAGCGAACTGATTCCCAAACCATAGGTGAATTTTCCACAAGAAGAAAGGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGTCTTGGATTTAGACTCTGGAAANTCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGNGCAGTTTGGAGCAACACATTNTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTC
  3   1   3        nb Gas7      in                         XZG51473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTAT
  3   1   2       add Ova1      in                         CABE2048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAAACCAGATAGGGAAAGTAAGGCCAGCGCCATTGGAAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAG
  5   1   3        nb TpA       out                  TTpA050i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGAATCAAGCCTTTACCTGAATGGGAAGAATTAATGCAGACGCCAGTCCGTTCTCCAGTTCAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACAC
  3   1   2       add Gas7      in                         XZG18545.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGTTACAAGAAGCTTTACACGGGATTCCTCTAGGTTCCCTATGCCTCCCAGGCCAGATTCAGTACATAGCACAGCTTCCAGCAGTGACTCGCAGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACAGAAGATCCAGGTTTGTTTGGGAGCAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAAGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAAAGTGTTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCACCTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGAAATAAATAATGTTTTATGTAAAAAGAAAAAGAAAAAAAAAAAAAAAGG
  3   1   2       ext Egg  5g3  in                    TEgg058i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAGGAAAGAAGAAAAGTGTGGTTCTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad0                               IMAGE:6982715                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAATGCATTGATATTCCGGGGCTTCAGGATGGCAGCCCTTGTTTAAGGAAAAACCCTGCAA
  3   1   3        nb Neu                             TNeu132m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA  5g3  in                    TTpA051b02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu  5g3  in                    TNeu055f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCAGTGCTGCTGATGAAAAGGTTGACTACGTTGTCGTAGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAAACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCAATAGGTGGACATAAGCTCATTCCAAATTAAAAAAAAACCGCGTTTGGGGTGTGTATGTACGCACACACAGGGACT
  5  -1   2       add AbdN                               IMAGE:7005958                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATTAAGGTTGTTGGTGGCCCACCCCGGAAAATCTTTTGGCGTGGAAAAGTTCCCCAGGGAAAGCCTGGAACTGTTGGGAGACAGTTCGCCCGAAACGGAAAACGCCCACTTAGGATTTTAAATTAACCGGCCTTTGGGTTTGAACACTTCTTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTNTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAGGGCG
  3   1   3        nb TpA       out                   TTpA050g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACAAACAGAAAACTCTAGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTTTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTT
  3   1   2       add Met5      in                         CACX1346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCGCTGAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTCTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGC
  3   1   3        nb Egg                             TEgg045g05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAGTACCAGAGAAGCATGGACTGATGGGAGACAGTCGACCGAAACGGAAACGCCAACTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTTTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTTTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTAAGCACACACACACGCACACACAGGGACTT
  3   1   4      seed Tad5      in                          XZT4711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAAGAATATAAAATAAACGCCCTTAGGATTTGAACACTTGTTTTATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTGC
  3   1   2       ext Brn3 5g3  in                        CAAK11861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTATCACAAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGC
  3   1   2       ext Gas7 5g3  in                         XZG28814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGGTGCAGTTTGGAGCAACACATTCTAATGCCTTCTATGATTGATTCTGCAGAGATGGAACCTATATTTGATCTTTGTGGTGGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAGCCTGTGTAAATAAATAATGTTTTATGTAAATAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATGTTTATGCACTTTTTGTGGTTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGCTTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGGAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACAGGGACTTTGC
  5   1   2       ext Egg       out                  TEgg054o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGAGACAATGGTTCTGCCATTTAATACCGTAAGCCTTTTTTGTTATTAACATAGCTTATTTTTAGTGGGATTTTATCATCCACATTTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCAATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAAACCCTGCAAATTAGGGGAAAAATACCCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTTGCAAAAAAAAAAAAAAAAAAAATAGCACGTTTATTAAGAAAAAGGGTCCGGCGTTTTGGGCGCCAACTGTGCTCTTCCTCAGTTTTTGTCCCTGGGGAGGAGCACAGTTGGTGCTCGAAGCGTTGGACCTTTTTACACACTAACACACACACACATATATTTATATATGTATGTATATATACATATATTAACAGAATGTTTTTTGGGTTAGTCATG
  5   1   3        nb Gas                            TGas049l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTAATACACTAAGGATTATCCCTGTAAGGAATAGAGAGTCCGTGAGAGTATTACAGTGTACAAGAACTCCAGACTTTCTGTCACTTGCACCAGTCAAATGGCTTCTAACAATACACCGATAGCAGCTGATGTACCTACTTAACATCCGTTATGGTTAACTTACATTTATATACTGTTGTGATAAATGCATTGATATTCCCGGGGATTCAGGAATGGCCAGCCCTTGTTTTAAAGGAAAAAAACCCCTGCAAATTAGGGGAAAAATACCCCCCCCTCTTTGACATAAGCTCATTCCAAATTAAAAAAAAAAATGTTTGTCTGTGTGTATGTACGCACACACACACGCACACACAGGGACTTTGC
  5   1   2  SIG                                    Xt7.1-TEgg054b01.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGACAGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTACATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCAATGGGACTGGGAATCCCGAGACACGCAACTTTCAGACACTGGAACAACACTAAATGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAACCGCTGATATGGATGGAGATTCAAAAGTTTTTTAAATGTCCTGGAGCCCTCTTCTCTAAAAAAAACAGCCTAAGGGCAGTTTTTCCTTAAAGCCTATCGACATTTCCTTCCATCCACCCTGGGAAAGCCATCTTTATCAACAATTTCCCAAGAAAACCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAAC
                                                  Xt7.1-CHK-1008285624                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGACAGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTACATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCAATGGGACTGGGAATCCCGAGACACGCAACTTTCAGACACTGGAACAACACTAAAxxxGCxGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAACCGCTGATATGGATGGAGATTCAAAAGTTTTTTAAATGTCCTGGAGCCCTCTTCTCTAAAAAAAACAGCCTAAGGGCAGTTTTTCCTTAAAGCCTATCGACATTTCCTTCCATCCACCCTGGGAAAGCCATCTTTATCAACAATTTCCCAAGAAAACCTGGTTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCCAGGT
  5   1   2       ext Egg  5g3  in                   TEgg055e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACTTGTGTCCAAAGGAAGGAGGCGGAAGAGGCCAAGCAGCGACTCCTGACAGGGAAAGGGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTACATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCAATGGGACTGGGAATCCCGAGACACGCAACTTTCAGACACTGGAACAACACTAAAGTGGCGCAGATCCCCCCTTTCCCTGCGGGACACAACGCGCCAGAGGGGCCACAAGAGCAACTGGATACTGGAGCCACCAACTACTGACCCGGAGGAGCATGAAGGGAGCGCCGAAGGAGCAGATGATGAGCATTGGCAGCGGTGGAAGGGTGGGGGCTGG
  5   1   4      seed Egg  5g3  in                   TEgg054b01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCGAAGGGTGGAGAGCTGGAGTAGTTTAGTCATCCTTTATGTGCGCCCCTCTCAGCTGCTGCACTCATGGACTCACCCTAGTCATAATAACAACGCTGTAGGTACTCTCACTGGGACTGGGAATCCCGGACACGCAACTTTCCGAGACAGGAACAACACAAAGTTGCGCAGTTCCCCCCTTTCCCTGCGGGACACAACGCGCCGGTGGGGCCGCAGGAGCAGCTGGATACTGGAGCCCCAAACTACTAACCCGGAGAGCAGGAGGGGAGCGCCGAGGAGCAGGATGATGAGCAGTGGCAGCGGCGGAGGGGTGGGGGCTGGAGGCGGCGGGGAGGTGGTATGCTCGGGATGGCTCCGCAAATCCCCCCCGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTT
  5   1   2       ext Neu0                               IMAGE:6994013                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGAGAAAAAGTTGAAACGTTTCGCATGGAAGAGGAGATGGTTTGTCCTTCGCAGTGGACGTCTAACAGGAGACCCAGATGTGCTGGAGTATTACAAAAATGATCATGCAAAGAAGCCAATCCGCATTATTGACTTAAATTTGTGTGAACAAGTTGATGCTGGGTTGGTGTTCAACAAAAAGGAATTTGAAAATAGTTATATTTTTGACATCAAGACCATTGACAGAGTATTTTATTTAGTGGCAGAAAGTGAGGAAGAAATGAATAAGTGGGTTCGAAACATCTGTGATATCTGTGGATTTAATCCCACCGATGAAGATGTTGTAAAACCTGCTGTTAATTCAGAACCTTCCAACCAAGCAGCATTGGTCCAAGGCCCTCTACCTCCCCCTTACCAGCTTATAAATATGCCACTTGTGGAATCCTCAAATAGCCAAGAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAAAGCAAGAAACCTGAACCATTGAGAACTCAAGGGGATTCCACAAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAGCATGCAGTGAATGGATACTTTCAGCAATCTAGTATTTATGACTCTCCATCCCGTGGTGGATCATCTTCTACAGAACCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTCACCAAAAGCTACTTCTCCATCAACCGCTGATATGGATGGAGATTCAAAAGTTTTTTAAATGTCCTGGAGCCCTCTTCTCTAAAAAAAACAGCCTAAGGGCAGTTTTTCCTTAAAGCCTATCGACATTTCCTTCCATCCACCCTGGGAAAGCCATCTTTATCAACAATTTCCCAAGAAAACCTGGTTTCT
  3   1   4      seed Egg  5g3  in                    TEgg054b01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAGTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATTGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTTTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCCCAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTTTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCAG
  3   1   2       ext Egg  5g3  ?                     TEgg053c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGACAGATCTAGCTCACTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGGATTGGGAAGTTTTTCTAATGAAGAGTTAGATGAAAACTATGTTCCAATGAACCCGAACTCTCCTCCGCGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCCGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCCAGGTGACTTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg055e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTCCTGGCATGTTTGACTTCTCATCATTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCTGCTGGGAAGAAAGGGATGTCTGCCTGTAACCAAGAACTGGGAAGTTTCCCTATCACAATAAAAGAATAAAAGCATATCATATAAAGTATTGTTGTCCTATAAATAGTATTAGAAACAGGGAAATTACACCAACAATGACAACTTGTTGTTAGGAATTGTCACTGCTATTTTATAGTCACAGTTTTATTGCTTTGTTTTGATTTTTCAATATTGACTTCATTTTGATTTTATAAACTAACTGCCTGTTTAATGTTGGAGTGGACTGGTGATCTTCTCAGACTGGAAACCAAAATTTAAATGTTCTGATTTAGTCTTTTTAGTTATTTTTTTTATCTTTGTTTTTTTTTTTTGTTGTCCAGATTTAAATGCATTACCATACTAGTACATCAATTTGTAATTCTGAAATTCAAATAAACTGACAACCAGGTGACTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)