Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012076795 Xt7.1-CABI7445.5 - 24 ESTs
                                                                       -170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABI7445.5                                                                                                                                                                           AAGCATGGCGGGGAGCGCTTGGTTATTGTGTAGTGCTGCGGCAATGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGG
                                                  Xt7.1-CHK-1008229546                                                                                                                                                                                 GGCGGGGAGCGCTTGGTTATTGTGTAGTGCTGCGGCAATGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGGACAACA
                                                      consensus depths                                                                                                                                                                                2     2     2     3     3     5     4     5     5     8     4     8     7    10     9    11    10    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    14    14    15    15    16    16    19    19    19    19    19    19    20    20    20    20    20    20    19    20    20    20    20    20    20    20    19    19    19    19    19    19    19    19    20    20    21    21    21    21    21    21    21    21    22    22    22    22    22    22    21    21    20    20    20    20    17    17    16    16    16    16    14    15    13    15    13    14    13    14    12    14    12    13    12    13    12    13    12    13    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11     9    11     8    11     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     8     9     7     9     7     9     7     9     7     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                               BLH MIN      49      14                                                                                                                                                                           
                                               EST CLI      44       1                                                                                                                                                                           
                                                                       PREDICTED - Dr ---- 3e-011     XP_692746.1 PREDICTED: hypothetical protein XP_687654 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PREDICTED - ?? ---- 3e-011     XP_699315.1 PREDICTED: hypothetical protein XP_694223 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Hs ---- 4e-025     NP_009211.1 Opa-interacting protein 5 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Mm ---- 9e-027     NP_001036118.1 Opa interacting protein 5 [Mus musculus] ------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PREDICTED - Gg ---- 2e-033     XP_421136.2 PREDICTED: similar to Opa interacting protein 5 [Gallus gallus] ----------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABI7445.5                                                                                                                                                                               ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------ATG------------------------------------------------------TGA------------------------------TAA------------------------------------------TGA---------ATG---TAG---TAG------------------------------------------------------------------TGA------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------TGA------------------------TGA---------------------------------------TGA---------------------------------TGA---TGA---------------TGA---------------------------------------------------------------TAA------------------------------ATG------------TAA---------------------------------ATG---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld HdA       in                   THdA011g12.p1kSP6                                                                                                                                                   ACTTTGACAAACTATAAAGTTCCAAAGCATGGCGGGGAGCGCTTGGTTATTGTGTAGTGCTGCGGCAATGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTGGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTATGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACTTATTCTCTGCTATAATCTAAAATCCTACGCTTTGGTCCCA
  5   1   2       bld Neu0      ?                      NISC_ng19d03.y1                                                                                                                                                                           AAGCATGGCGGGGAGCGCTTGGTTATTGTGTAGTGCTGCGGAAATGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACT
  5   1   2       chi Brn4      in                         CAAL7482.5p                                                                                                                                                                                 TGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGTGAGTCCTAAGCGGCCTTAGGCTTGGTCAGTTTAAATGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTT
  5   1   2       bld Gas7      in                         XZG62151.5p                                                                                                                                                                                            CGGACGCGTGGGGTAGTGCTGCGGCAATGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGCGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTG
  3   1   2       bld Gas7      in                          XZG3202.3p                                                                                                                                                                                                 CCACGCGTCCGTGTTGCGGCAATGCAGTCTGTTTGCGGGGAAGCACGGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCAAAAAAAAT
  5   1   2      seed Lun1      in                         CABD1822.5p                                                                                                                                                                                                                 CGGCAATGCAGTCTGTTTGCGGGGAAAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAAT
  5   1   2       bld Gas       in                   TGas131k23.p1kSP6                                                                                                                                                                                                                       CAGTCTGTTTGCGGGGAAAGCACGGTGGGACTTGGTAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCATATTTTATATACTG
  5   1   2       bld Gas7      in                          XZG3202.5p                                                                                                                                                                                                                           CGTCTGTTTGCGGGGAAAGCCGGTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCAAAAAAAATAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas8                                  st85p15.5p                                                                                                                                                                                                                                            AAGCACGGTGGACTTGGAGCAGACAAACCCAGAGGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAG
  5   1   2       bld TbA       in                   TTbA041h10.p1kSP6                                                                                                                                                                                                                                                 GTGGACTTGGAGCAGACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGAAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAACATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGATAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCACATTTATGTACTACGTTGAGTACTCTTCGACAGGATGTCTGACATGCAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACATGAGTATGTTCTCCTGAGCCTTAG
  5   1   2       bld Ovi1      in                         CABI7445.5p                                                                                                                                                                                                                                                       CATCGATTCGCAAACCCAGAGGTGTCACGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATCAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAT
  5   1   2       bld Ova1      in                         CABE1192.5p                                                                                                                                                                                                                                                                ACAAACCCAGAGGTGTCATGTCGGAAGTTAAATGGCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAATTACCAGTTGGGGTACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTA
  5   1   2       bld Ovi1      in                        CABI11755.5p                                                                                                                                                                                                                                                                                                  GCAGTTCGGGCGGGCCTGAGGCGTGTGTGGTATTCCTGTGTAAGAACTGCTACACGGTGCTGGGGGACTCGCTCAGTGTGTGTGGGGAGGAGAGGAGCTTGGCTGCCATCGCCTGCCTGCGAGTCACAGAAGATTTGAATGTAGGAGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATAANAGAAAACCC
  5   1   2       bld Ova1      in                         CABE7838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAATCAGTACTTTTTGTGGTGAATGGGAACCTGAAAGGCTGTGCCTATTACCCTTTACTGTGTCGCTCCTGTGGGACCAATATTGGCTTCAACCTTTACTCTGCGCCTAGGGCTTATGCCTACCTGAGAGGCTTATTCTGTCTCCTCAAAGAACATATTCTCTGCTATAAACTAAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAAATCAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTTGTTGCTTTGGGCTGGTAC
  3   1   2       bld Gas7      in                         XZG62151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATCCAGCGCTTTGGTCCCAGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACAGTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTAAAAAAAATACT
  3   1   2       bld Gas       in                    TGas131k23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAAATGAAATGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGTTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTTTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTTTCTTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATTTGAATCACTAACCACCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTTTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTTTGCGTTAAAATTAAATAAGTATCTGGCCACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                        CABI11755.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAATTTGAGTTTCCAAGCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGGACAACAGTGAG
  3   1   2       bld Ova1      in                         CABE1192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGGACAAC
  3   1   2       bld Ova1      in                         CABE7838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTAGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTNTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGG
  3   1   2       bld Ovi1      in                         CABI7445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGGAGGATGTGGCAGAACTGAAGATGCAACTGGTGCAGCTGCATGTTAAAATGGAACTGATATCCAAACAACTGCTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGCTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATCAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTCAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGG
  3   1   2       bld HdA       in                    THdA011g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAATTGGTGCAGCTGCATGTTAAAATGGAANTGATATCCAAACAANTGNTACAGCAGGAGAAAAACACTACAGCCTGTTCATGACATGCCACACAAACTAACCTCAAGCCATGCTAACTGCATTTTGGGAGGAGTCTGTTCAGCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATTTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATACAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATC
  3   1   2       bld Lun1      in                         CABD1822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCTNTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATCTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATATAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGGAC
  3   1   2       bld TbA       in                    TTbA041h10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTTGCTCCATCTGGCTGACCCAAATTTATGTACTAGGTTTAGTACTCTTCGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATTTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTTTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATACAATTTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTTTGCATACATTTTTTGCGTTAAAATTAAATAAGTATCTGGACAACAGTTGAGTTTTCAGTGCGTTTCAGCCCGTGCTGTTTATTGCTTAAAACATTTTTACATAAATGCAATTTTTTTTTTTTTCTATTTTTACACAACCCAGTTTTAACAAAGTTTATACAATCATGAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Brn4      in                         CAAL7482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGACAGGATGTCTGACATGGAATGGATTAGCTCTTTTTTGTGTTGAGAATTGTGAGATTTGAACAGGAGTATGTTCTCCTGAGCCTTAATTAAAAGAAAACCCAATAAAATTGAGCCACACTAATCCAAATTACCAGTTGGGTAACAGGGAACATGACTGTAAGGCCCATATTTTATATACTGAACTTACAGCACCAGTCTTAAGTTTCAGAACCTCTATACCTGCAGTAATTTAGGCCTTCAAAGTTTTGCACAGGGAGTCACCATCTTGAATTGCACTTGCTCTGTGCAGCTGTTGAGAAGCTAAGCTTAGGGGTCATTCCAAATCAAGCACAAAATGAGGTTCATTTGTCACAAGCACCCATAAGCATCCATGAATTTGAATCACTAACCAGCCTTGAGGGCAGTTGTTGCTTTGGGCTGGTACAGAAGCCCAGCACATAGTGTGCATTTCTAGCCTTCTATAATCTTTAAGGTTCCCTTTCCCTACCTTCAGTATGTGTGTATGTATACAATCTATATTGAAGCAAAATAGAATCGGTGGTTTAATGCTTTGTACAAAGTGGTCTGCATACATTTTCTGCGTTAAAATTAAATAAGTATCTGGCCACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)