Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-XZG39982.3.5                         91 END     1           2        1                RAB3A interacting protein (rabin3) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 90%

 1012076913 Xt7.1-TTbA049e03.5 - 36 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA049e03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCCTCTCTCATTATATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227217                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AxxCTCTCATTATATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     6     4     8     7     8     9    10     9    10    10    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    16    16    16    16    15    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    13    15    13    15    13    15    13    15    13    13    13    13    13    13    13    13    11    12    12    13    12    13    12    13    11    12    11    12    11    11    10    10     9     9     7     8     6     7     6     7     5     6     5     6     5     6     5     5     5     5     5     5     6     7     5     7     5     7     7     8     7     8     7     8     7     8     7     8    12    13    12    13    13    13    14    14    15    16    15    16    16    17    15    16    15    16    15    15    16    16    16    16    16    16    16    16    16    17    16    17    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    17    15    17    15    17    15    17    15    17    15    17    15    17    14    16    14    16    14    16    14    16    14    16    14    16    15    16    16    16    17    17    17    17    17    17    17    17    16    17    16    17    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    17    16    17    16    17    16    17    16    17    14    17    14    17    13    17    11    17    11    17     8    16     5    11     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --A---------
                                               BLH ATG     156     386                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     129     107                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     156      72                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0      33                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     156       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Bf ---- 4e-012     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ---- 2e-011     NP_012154.1 Yil112wp [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 5e-016     FAA00217.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-018     NP_500824.1 feminization 1 homolog a, FEMinization of XX and XO animals FEM-1 (fem-1)[Caenorhabditis elegans] ---------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-020     NP_648826.2 CG5841-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 2e-025     XP_791856.2 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Gg ---- 3e-070     NP_989736.1 ankyrin-like repeat protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 7e-092     XP_691649.1 PREDICTED: similar to Ankrd2-prov protein [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ==== 1e-106     NP_064417.1 ankyrin repeat domain 2 (stretch responsive muscle) [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 3e-107     NP_065082.2 ankyrin repeat domain 2; ankyrin-repeat protein [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 8e-167     AAH44065.1 Similar to ankyrin repeat domain 2 (stretch responsive muscle) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 1e-176     AAI35223.1 Unknown (protein for MGC:121289) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 1e-176     NP_001090801.1 hypothetical protein LOC100037897 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA049e03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAA------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATGATG------------------------------------------------------------------ATG---------------------------------------TGA---------------------------ATG---------ATG------------------------------------------------------------------------------------------------TAA------------------------TAA------------------------------TAA---------TGA---------------------------------------------------------------------------TAA---------------------------TAG------------------------TAG---------------------------------------------------------TAA------------------------TAA---------------------------ATG---------------------------------------------------------------------ATG---------------------------------------ATG------TAGTGA---------------------------------TAA---------ATG------------TAG------TGA---------ATG---------------------------------------TGA---TAA---ATGTAA---------------------ATG---ATG------TAA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Tad5 FL                          XZT25008.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGCAGCCTCTCATTATATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g3  in                   TTbA033j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCAGCCTCTCATTATATCCCACACCGTCATCTCATTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTAC
  5   1   2       bld TbA  5g3  in                   TTbA015i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCCTCTCATTATATCCCACACCCTCTCTCTTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCAT
  5   1   2       bld TbA  5x                        TTbA050f04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCCTCTCATTAATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCCGACTCCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGCAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGACAGTTGCTCCAGAACCACCTCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTNGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCGACAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTG
  5   1   2       bld Tad5 FL   in                         XZT25008.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGCAGCCTCTCATTATATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTG
  5   1   2       bld TpA  FS   in                   TTpA004e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCNGAGGCCCGGGGCCCACACCTTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT3320.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCCTCTCATTATATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGC
  5   1   2       bld TbA  5g3  in                   TTbA043k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCCACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCANGGCTTATCGGTACANAATCATCAAAATGCT
  5   1   2       bld TbA  5g3  in                   TTbA071l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACCTCTCTCTTTCTAAACCACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTG
  5   1   2       bld TbA  5g                        TTbA068a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAANGTGACACTGCTCTTCATGATTCCGTC
  5   1   2   10  bld Mus1 5g3  in                         CABH7604.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACAAACCCAGTCTGGTGGCAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT4866.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAGACAAGTCCCAGTGGACAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCAC
  5   1   2       bld TbA  5g                        TTbA047e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACAGGGAAAGGAAACTCTTTCAGGAGGACTGGCTGAGTCTGGTGAAGGGGGCCTGGACTACAACTTACCAATGGAGGACGAAGTGAAATGGGCGACTGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTTGGAGGGTCACATAGAAATCATCAAGAAACTCTTANGACAGTGGGATCATCAGTCAACTTCAGGGACCAGGCTGGATTGCACTGCTATTCACT
  5   1   2       bld TpA       in                   TTpA062i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGAGGAACATGAGAAGGTAAAGCCTCGTTTCCGGAAGATAGGTGTTGTTGACATCGACTCTAGTGATTTAAATGATGGGAAGCCACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGCAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGACAGTTGCTCCAGAACCACCTCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCGACAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAACTCCCACAGACCTTGTGCAGCAGTG
  5   1   2       bld Tbd1      in                        CBXT16475.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACCGCTGAATCGAAACCTCGCCAATTTAAAGGGTGATGATCGGGTGAGGAAGACATCAGTGGACCTAAGGAAAGAAATTATTGATGTTGGAGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCACTGACAGTTGCTCCAGAACCACCCCCTGAGCCAGAGCCACTTACGGGACCTGTCACTGCTGAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGTAAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATA
  5   1   2       bld Tbd1      in                        CBXT17784.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCATTCCTCAAAGCTGCTGTTGAAGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCATCAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCTGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGA
  5   1   2       bld TpA                            TTpA039a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCGGGCCCCGGGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCCCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCGTCATTGGAGGGTCACATAGAAATCATCAAGAAACTCTTAGACAGTGGATCGACAGTCAACTTCAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGAAATAGTAAAGCTTCTTCAAGACAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGC
  5   1   2       bld Tail      in                         CBSW4608.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGCAAAGACAAGCTCCTTAGTACACCTCTCCATGTGGCCACCCGCACAGGTCATGCTCATATTGTGGAGCACCTTATTGCTACTGGTGTGGAGATTAATGCCAGAGACAGGGAAGGTGACACTGCTCTTCATGATTCCGTCAGGCTTAATCGGTACAAAATCATCAAAATGCTTATCTTATATGGATCCAACATGATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGAT
  5  -1   2       bld TpA       out                  TTpA010e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAAATAGAATAATCAACCTAAAAAAAAAAAAAAAA
  5  -1   2      seed TbA       out                  TTbA049e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCAAAGAATGCAGAGGGCAAAACTCCCACAGACCTTGTGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA  5g3  in                    TTbA043k16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTAATAATCAACTAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TbA  5g3  in                    TTbA033j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGCAGTGGCAGGCAGACACCAAAGAGATGTTGGTGAAAAGGGCAAACAACATTTCAGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTTTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATAAGCGTATGCCATATTAACTAAATATCAACCTAAAAAA
  3   1   2       bld Mus1 5g3  in                         CABH7604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTNTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCT
  3   1   2       bld Tbd1      in                        CBXT16475.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAA
  3   1   2       bld TbA       ?                     TTbA031k09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTACTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATATGCATATGCCATATTAACTTAATATCAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA       in                    TTpA062i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTACTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATATGCATATGCCATTTAAACTAAATATCAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA015i22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAGTGTGATGCAGCCATTCGACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad5 FL   in                         XZT25008.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTAGATACCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAAT
  3   1   2       bld TbA                             TTbA043k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATATGATTGTGAGGATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTTTTTTCCGGTAGAGTATTTCTGTACAGCAAATCCTTTCAGTAACATATTGTAAAATGTGCTTTATTGTTCTCTAACATAAATTAGAGCCAGGGAT
  5  -1   2       bld TpA       ?                    TTpA010d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAATGCTCTACCCTTGGATTAACTTCACGTCTAGTAGGGTTCAACATCTCAATGCGACAGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTCGGGCTTAACTTAGAATTTATCTCCTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTACTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1 5g3  in                         CBXT3320.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCATTTGCCCAGTGATGCCAAAAGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1 5g3  in                         CBXT4866.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATATTTATTTTTGATGCATTTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT17784.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCAGTTCAGCTTTAGATGTTACATATTCCTAATTTGGGCTTAACTTAGAATTTATCTACTGGCCCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTACTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAA
  3   1   2       chi Tail      in                         CBSW4608.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCTTTTACTGTAGAGTATTTCTGTACAGCAAATCCTTTCTGTAATATATTGTAAAATGTGCTTTATTGTTCTTTAACATAAATTAGAGCCAGGGATGTGCCAGCTGTGCCGTAACATTGTTGCTGAACCACTCCCATTGTCGTACATGCCAGCATATCCCTTTGCTTGACCAGTAACTTAAAACATCAGCATGCATTGGTATAATATAGTTCCTTGGATCACAGGCATTTATAGCTGTATACACTATCCCGGCTCATTTAGTCTGAGGGTGATTATTTTCTTTAAAAGAGGAGTTTCTTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACACGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTACTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA071l21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAGCATGCATTGGTATAATATAGTTCCTGGAATCACAGGCATTTATAAGCTGGTATACACTATCCCGGGCTCATTTAGGTTGGAGGGGGGATTATTTTCAGTTCAGCTTTAGGATGGTTACATATTCCTAATTTGGGCTTAACTTAGGAAATTTATCTACTGGCCCTTTAAAAAAGAGGTTTCTTTTCAAAATGTAGTATGCGAGAATGTGTTCAGACCTATGCACACACGCATTTGAGGTGGTATTTAATTACCTTTCATTATTA
  3   1   2       bld Tail      out                       CBSW11857.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTCAAAATGTAGTATGCAGGAATGTGCTCAGACCTATGCACACAAGCATTTGAGTGTATTTAATTACCTTTCATTATTAATAGTTATGTTGGCATGTAGGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTACTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTGTTGAGGGCATGAAGATTTTCTATGATAAAAGTATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATGAAACTATGTAAATAGCATATATATATGCATATGCCATATTAAACTTAAATAATCAACCTAAAAAAAAAAAAAAA
  3   1   2       bld TpA  FS   in                    TTpA004e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAATCATGTGCATCCAGCCAATGACTGGATGTTGGCTTAGTGAGTCCTGGAGGGGCATGGCCTGATAAAGACTTGCTAAAGTTGTCTAATGTGCAACAATTTGTAGAGGGCATGAAGATTTTCTATGATAAAAATATTTCTATTTTTTATTCTTCCTCTCAAAAAATGAAATTAAACTATGTAAATAGCATATATATATATATATATGCATATGCCATATTAAACTTAAATAATCACCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)