Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA038i23.5                         49 END     1           2        2                LOC496066 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012076981 Xt7.1-TNeu109p12.3 - 35 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                          6     8     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    12    13    12    13    12    13    11    12    11    12    13    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    11    12    11    12    11    12    11    12    10    13    10    13     9    12     9    12     9    11     9    12     9    12     9    12     8    11     8    10     9    11     9    11     9    12    13    14    12    14    13    15    14    15    14    15    16    16    16    16    17    17    17    17    17    17    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    19    18    20    19    19    19    19    18    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    17    18    17    18    17    18    17    18    17    18    17    19    16    18    16    18    16    18    16    18    17    18    17    18    18    19    18    19    18    19    16    18    17    18    17    18    15    18    16    18    16    17    16    17    15    17    15    16    14    15    14    15    14    15    13    15    14    15    14    15    13    14    12    14    12    13     4     6     3     5     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G----G----
                                               BLH ATG       0     632                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR       0     269                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG       0      16                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Br ==== 1e-015     ABD62777.1 myostatin [Branchiostoma lanceolatum] ===============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-032     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-032     NP_477340.1 glass bottom boat CG5562-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 8e-038     BAE06730.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bf ==== 1e-042     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---- 1e-044     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] -------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sp ---- 6e-047     NP_999793.1 univin [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 4e-060     NP_032134.2 growth differentiation factor 3 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 4e-072     NP_065685.1 growth differentiation factor 3 precursor [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 1e-090     NP_571023.1 decapentaplegic and Vg-related 1 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 8e-107     NP_990542.1 growth factor CVg1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAD19837.1 derriere [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001080966.1 derriere (posterior determination, TGFb family member) [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          NP_001007905.1 gdf3-prov protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu109p12.3                                                                                                                                                                                                                                                                                                                                                                                                                            TGA------ATG------ATGATG---------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------TGA---------------------------------------------------------TAA------------------------------------------------------------------TGA------------------TAG---------------------------------------TAA---------------------TAA---------------------------ATG------------------------------------------------ATG---------------------------------TAG---------------------------------------------TGA---------------------------------------------------------------TAG---------------------------------------------------------ATG------------TGA------TAA------------------------------------------------TAG------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Gas7      in                         XZG21941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGGAGCAACTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACTCGTATTATGGACAACAGTTCCATCTGCGCCTCTACCGCACCCTTCAGCTATCTCTAAAGGGTATGAGAGAGAGCAAGATGAACAGGAAGCTTCTAGTGTCACAGTCTTTCCGGCTTCTTCATAAGTCCCTCTATTTTAACCTGACCAAGGTGGCAAAGGACTGGAAAACCCCTGAGAAGAATATGGGACTGTTATTGGAGATATATGCTAGCAGTAAACTTGCAGGAGACAACAGATCATTTGCAGTGTGTGAACCAATCCAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCTCTAGACCCATCCAGCTGCAAAACTCCGCGAGCCAAGAGAAGTACTCATTCATCGCCTCCAACCCCAAGTAATATCTGCAAAAAGAGGCGCCTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTGATTGCACCCCGTGGTTACATGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGGAGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAAGTTGGCTAGGACTACTCCTCTCATT
  5   1   2       bld Gas  FLt5 out                  TGas141f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAGCAAGATGAACAGGAAGCTTCTAGTGTCACAGTCTTTTCCGGCTTTCTTCATAAGTCCCCTCTATTTTTAACCTGACCAAGGTGGCAAAAGGACTTGGAAAACCCCTGAGAAGAATATGGGACTGTTATTGGAGATATATGCTAGCAGTAAACTTGCAGAGACAACAGATCATTTGCAGTGTGTGAACCAATCCAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCTCTAGACCATCCAGCTGCAAACTCCGCGAGCAAGAGAATACTCATTCTCGCCTCCACCCAAGTATATCTGCAAAAGAAGCGCCTGTACTTGACTTCAGGATGTTGGATGGCAGAACTGGGTGA
  5   1   2       bld Gas7      in                         XZG35368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGCTTCTAGTGTCACAGTCTTTCCGGCTTCTTCATAAGTCCCTCTATTTTAACCTGACCAAGGTGGCAAAGGACTGGAAAACCCCTGAGAAGAATATGGGACTGTTATTGGAGATATATGCTAGCAGTAAACTTGCAGGAGACAACAGATCATTTGCAGTGTGTGAACCAATCCAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCTCTAGACCCATCCAGCTGCAAAACTCCGCGAGCCAAGAGAAGTACTCATTCATCGCCTCCAACCCCAAGTAATATCTGCAAAAAGAGGCGCCTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTGATTGCACCCCGTGGTTACATGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTC
  5   1   2       bld Gas7      in                          XZG5509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGTGGCAAAGGACTGGAAAACCCCTGAGAAGAATATGGGACTGTTATTGGAGATATATGCTAGCAGTAAACTTGCAGGAGACAACAGATCATTTGCAGTGTGTGAACCAATCCAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCTCTAGACCCATCCAGCTGCAAAACTCCGCGAGCCAAGAGAAGTACTCATTCATCGCCTCCAACCCCAAGTAATATCTGCAAAAAGAGGCGCCTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTGATTGCACCCCGTGGTTACATGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAAGTGCCCTTTA
  3   1   2       bld Neu0 5g3  in                       IMAGE:6991348                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGGTAGGCCCATCCCAGCTGCAAAATTCCGCGGGCCCAAGAGAGGTATTCAATTCTTCCCTTCCACCCCCAGGTAATATTTGAAAAAAGAGGCGCCTGTACATTGACTTCAAGGATGTGGGATGGCGGAACTGGGTGATTGCACCCCGTGTTAACATGGCCAATTAATGCTATGGAGAGTGCCCCTTTCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTGTGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAGGATGAAATGCTTTGCAAAATGACTAGTGCTGTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGATTGCATATTAA
  5   1   2       bld Gas7      in                         XZG57082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCAACCCCAAGTAATATCTGCAAAAAGAGGCGCCTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTGATTGCACCCCGTGGTTACATGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTTTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTCTTTATGTATGTATAT
  3   1   2       bld Gas       ?                     TGas141d11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAAAAGAGGCGCCTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTGATTGCACCCCGTGGGTACATGGCCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTACATTAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  FL   in                    TNeu109p12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATGGCAGAACTGGGTGATTGCACCCCGTGGTTACATGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTGTGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAGGATGAAATGCTTTGCAAAATGACTAGTGCTGTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAACATTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Gas7 5g3  in                         XZG52715.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGTTACATGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAAT
  3   1   2       bld Gas7      in                         XZG21941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCCAACTACTGCTATGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAGGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAACATTCTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas5      in                           XZF176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTACTGCTATGGAGAGCGCCCCTATCTACTGACAGAAATGCTCATGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGCAGTAGATGAATGTGGTTGCAAGTGACTCTGGCTAGTACTACTCTTCTCATTAAACTTATCGTCTAACGTACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCTATG
  3   1   2       bld Gas5      in                           XZF176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCAGTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGAATACTCTTCTCATTAAACTTATTGTCTAAGGGAGTGCTGGCAAGTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATGGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTGTGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAGGATGAAATGCTTTGCAAAATGACTAGTGCTGTCAATTTCTTTAGGTATGTATATATTGGGCATATGGCT
  3   1   2       bld Gas8 5g3  in                          st19f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAGTGCCCCTATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAGGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGT
  3   1   2       bld Gas7      in                         XZG57082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCCACTGACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTTTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAAC
  3   1   2       bld Gas7      in                         XZG35368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAGAAATGCTCAGGGGCACAAATCATGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATTTGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTCCAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAC
  3   1   2       bld Gas7      in                         XZG39894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGCTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCCCAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTACCCTT
  5   1   2       bld Gas7      in                         XZG39894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTTTTGCAGACTCTGGTGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAACATTAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG28235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCATTCTGTAGAACCAGAAAGCACCCCTTTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTGTGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAGGATGAAATGCTTTGCAAAATGACTAGTGCTGTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTACCCTT
  3   1   2       bld Te5       in                          CAAO481.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATT
  3   1   2       bld Gas7      in                         XZG16958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGTCTCCTATCTGCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTAGATGAATGTGGTTGCAAGTGAGTTTGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTCATTGTTGTAAATAAAATGTGATTTAACATT
  3   1   2       bld Gas7      in                          XZG5509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTGAGTTTGGGCTAGGACTACTCTTCTCATTAAACTTATTGTCTAAGGGACTGCTGGCAACTTAATCATGGAGTGATTCTCCTTGTGTGACAGTGGCTTTGACCATTAGTGTTCAGCTACAATTCCCCCCATGAAGCAAGATAGGCTTCTGTTAGCTAGAAATTGTAACATTCGTACCAGGAAATGTATTCCCATAAAAACAGAGACTATATTTTTTGTAAAACCTGTTTCTCCCCAATAACATTAATATGCACAAATTTTATGCATTGTTTTTAGCTAAAATTCAGATTCTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAGGTGGATGGGCCACTTTCATTTGTGACTTTTAACAGAGCTACAAGATGAAATGCTTTGCAAAATGACTACTGCTCTCAATTTCTTTATGTATGTATATATTGGGCATATGGCTAGGTTGGTGCCCAAGAACTGGCCTGCACTTGTTGCTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAACATTCTTATTTTCATTTATTTCATTTTTTCAGTAGGGGAAATACATTGGGTTGCCTAATTGTGAGCTGTTACTCCTCACACAAGAAGGGTGGTGGAGAGTAGTAGCAGCAGCTTTAAGGTAGCACAGCCATTGCACCATTACACTATTGCATGTCGATTTAAAGGTCACTGGTAAAAATGATGCTTTGTGCCAATGTGCTTTATACCCCCATTCAAAATAATTTAGACTTCTCATAAATACACTGATTG
  3   1   2       bld Gas7 5g3  in                         XZG40447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTATTTTTGGTAAAACCTGTTTCTCCCCAATACCATTAATATGCACAAATTTTGTGCATTGTTTTTTAGCTAAAATTCAGATTTTTTGGCATATGCTAGGCCCAGGAAGCAAAACAAAAGTTGCCCTTTAGGGGGATGGCCCACTTTCATTTGTGACTTTTACCAGAGCTACAGGGTGAAATGCTTTGCAAAATGACTAGTGCTGTCAATTTCTTTATGTAGGTATATATCGGGCATAGGGCTAGGTTGGTGCCCAAGAACTGGCCGGCACTGGTTGCTTTGTTCTTGACCTGTTAAGACTAATGTTTAAATCCAGTTGATGGTTGTAAATAAAATGGGATTTAACTTTCTTATTTTCATTTATTCCATTTTTCCAGTAGGGGAAATCCATTGGGTTGCCTAATTGTGAG
  3   1   2       bld Te1                                  CBWN2024.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGGCATATGCTAGGCACAGGAAGCAAAACAAAAGTTGCCCTTTAAGTGGATGGGCCACTTTCATTTGTGACTTTTAAAAAAGCTACAGGATGAAATGCTTTGCAAAAT
  5   1   2       bld Gas7      in                         XZG35239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGCTCTTGAACTGTTAAGACTAATGTTTAAATACAGTTGATTGTTGTAAATAAAATGTGATTTAACATTCTTATTTTCATTTATTTCATTTTTTCAGTAGGGGAAATACATTGGGTTGCCTAATTGTGAGCTGTTACTCCTCACACAAGAAGGGTGGTGGAGAGTAGTAGCAGCAGCTTTAAGGTAGCACAGCCATTGCACCATTACACTATTGCATGTCGATTTAAAGGTCACTGGTAAAAATGATGCTTTGTGCCAATGTGCTTTATACCCCCATTCAAAATAATTTAGACTTCTCATAAATACACTGATTGTTGTTGTAATTATAAAAAATGTGTGGTGTTTGTTATTTCTTGCTATTAAGCTTTCATATTCTCAAATTCCTGGCTCTTCGTAGATAATTCAACTACCAGCCTAAAGATAAACCCCCTGCAAAATGGACTTCTGCATATCTGTAAAACCGAAACAGTCACAACAAAAAGAGGGGCAGGGATTGTTTATACAGAGTTGATTGTCTCTATCTAAATTTACTCAGCTAATTGCTGGAGGGCTTTTAAGCGTGAAAGCAAAGCATGCAATTCTTCATTAATTACCTACACCCCAGTGATGTCTTTTAAATATAGCAATGTGAGAATATTTTTACACAGAAGTAAATGAAGGGCCTCTGCACAACAAGGGAATACACAATGTACACCTACCTACTTTAATTTTCTCTCCCTCACATCATCACAAAAAGTCAAATCATGTAGATTATATATATATATATATATATATATATACACGCACACGATTAAAACAGCAGCACTTCTTTAATATATATAATTATAGTTTGTAAAATCCCCCTATATG
  3   1   0       add Gas7      in                         XZG35239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGAGGGGCAGGGATTGTTTATACAGAGTTGATTGTCTCTATCTAAATTTACTCAGCTAATTGCTGGAGGGCTTTTAAGCGTGAAAGCAAAGCATGCAATTCTTCATTAATTACCTACACCCCAGTGATGTCTTTTAAATATAGCAATGTGAGAATATTTTTACACAGAAGTAAATGAAGGGCCTCTGCACAACAAGGGAATACACAATGTACACCTACCTACTTTAATTTTCTCTCCCTCACATCATCACAAAAAGTCAAATCATGTAGATTATATATATATATATATATATATATATACACGCACACGATTAAAACAGCAGCACTTCTTTAATATATATAATTATAGTTTGTAAAATCCCCCTATATGGCAATGTGTCAGAATACAAACAACCCTTCCTCAAGCCAGAGGTGCAATTATAGATCACTTGCAAATTAATATTGCTTTATTGGCTTTTAAAGGGAAAGACAGCTAAGGGCTTATTTATCAATATTTGTGTTGTTTTCATATTTTTCCTACTTTTAATACCCTAAAAATGTTAAAAAAAAATCTGTATTAGATAAATGTGATTGACCAAAACCATTAATTAATTTGAATTTCTTAAATGCTACATTTTTGCATCATTTTTAAGAGGTCATAAAGTTGGAAAGAAAAAATTCAAAAATTTGAATAGTTAAAATTTTGCAGTTCCCAATGACTTCTATGTGACCTTCTTTAGAAGATTTACATTTGCATTTTTTGTGTTCTTTTTTACTTAATAAATAGTGAAAGTTTGT

In case of problems mail me! (