Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 25 Sep 2018 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC5723.3.5                         66 END     7          33       10                TAK1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012076988 Xt7.1-CABI10913.5 - 21 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI10913.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCAC
                                                  Xt7.1-CHK-1008230302                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCACCATTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              4     4     4     4     5     5     5     5     5     5     7     8     8    10     9    12    10    12    11    13    14    15    15    16    15    16    16    16    16    16    16    16    16    16    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    18    19    19    19    18    19    19    19    18    18    18    18    18    18    18    18    17    18    17    18    17    18    17    18    17    18    18    18    17    18    17    18    17    18    17    19    16    19    16    19    17    19    17    19    16    18    15    16    12    13    12    13    12    13    12    13    11    13    11    13    11    13    10    12     9    12     7    10     7    10     7     8     7     8     7     8     6     6     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                               BLH ATG     305     589                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     305     147                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     305    1252                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     305      46                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Br ---- 4e-012     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Bf ==== 3e-020     AAM18889.1 unknown [Branchiostoma floridae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 7e-022     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 8e-023     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Sc ==== 3e-023     NP_009411.1 Promotes the exit from mitosis by directly switching on the kinase activity ofDbf2. Required for mitosis and sporulation, cell division cycle blocked at 36C.; Cdc15p [Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 7e-029     NP_001021183.1 C24A1.3b [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dm ==== 2e-071     NP_524080.1 TGF-beta activated kinase 1 CG18492-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 3e-104     BAE06720.1 mitogen-activated protein kinase kinase kinase [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 9e-104     XP_795629.2 PREDICTED: similar to TGF beta-activated kinase [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 1e-126     NP_001018586.1 hypothetical protein LOC553788 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 3e-133     NP_003179.1 mitogen-activated protein kinase kinase kinase 7 isoform  A; transforming growthfactor-beta-activated kinase 1; TGF-beta activated kinase 1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 3e-133     NP_766276.1 mitogen activated protein kinase kinase kinase 7; TGF-beta-activated kinase 1;TGF-beta activated kinase 1; transforming growth factor-beta-activated kinase 1[Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 2e-137     XP_419832.2 PREDICTED: similar to TGF-beta activated kinase 1a isoform 3 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xl ==== 3e-140     AAH49005.1 Similar to mitogen-activated protein kinase kinase kinase 7 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 1e-140     AAI36217.1 Unknown (protein for MGC:122950) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 1e-140     NP_001093731.1 mitogen-activated protein kinase kinase kinase 7 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI10913.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Egg  5g                        TEgg079f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAAGCCCCGCCCTGCTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATTGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTA
  5   1   2       bld 1030 5g                         IMAGE:7092163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCGCCCTGCTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCTAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTTGAAAGTGAATCTGAAAGGAAACCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGGGTAACCATCCCAATATTGTCAAGTTGATGGAGCCTGCCTAATCCCTTATGGTTAATAAGGAAAATCAAAAAGGCGGTTCCCCGTACAAGAATTTGATGGGACCGAACACTGCCTAACAAGCACCGGCCCTGCAT
  5   1   2       bld 1030 5g                         IMAGE:7093425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCCTGCTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGANAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAAGCGGTTTCCTTGTACATGTTTTGCATGGAGCTGACCAACTGCCGTACTATAAGACTG
  5   1   2       bld Gas  5g3  out                  TGas086i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCT
  5   1   2   14  bld Brn3 5g3  out                        CAAK5189.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAAC
  5   1   2   14  bld Brn3 5g3  out                        CAAK3254.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGNCACTACAGTGAG
  5   1   2       bld Gas  5g3  out                 TGas089g09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATTGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATG
  5   1   2       bld Gas  5g                        TGas029n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATNTACATAGCATGAAGCCCAAAGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGC
  5   1   2       bld Neu  5g                        TNeu054p12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATG
  5   1   2       bld Neu  5g                        TNeu144j12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGCCAGCGCATCATCGGCTGCAGTAGTAGCAAGAGAGCCCTCCCCTCTTCACCACATGCCCTGGCTCCAAGCATGCTATGCCCATCAGCCCATAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCATCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAAGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAAGAGATATATGTGGAAGATGTAGTTGGAATATGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTGTGTTTAGTAATGGAATATGCAGAATGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACATCTGCGCATGCAATGAGT
  5   1   2       bld Brn4 FL   out                       CAAL18454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAG
  5   1   2   10 seed Ovi1 5g3  out                       CABI10913.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATG
  5   1   2   20  bld Spl2 5g                             CBSS9294.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGC
  3   1   2       bld Gas8      in                         st105f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAAGTAAGTATTGTCTTTTCTCCATATAAGTATTCTAGTAAGAGTTTTTCTTTGTGCTCTCTCAAAAAATAGCTTTTATATAATG
  5   1   2       bld Gas8      in                         st105f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCNAAGGCTCTAATTCACAGGGACCTCAAA
  3   1   2       bld Gas8                                 st108f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCAGGCTAGGCCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGNCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCNCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGNGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACATGGGACCTCAAACCACCAAAGTAAGTATTGTCTTTTCTCCNTATAAGTATTCTAGTAAG
  5   1   2       bld Gas  5g3  out                  TGas071i11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAAGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCT
  5   1   2   10  bld Spl1 5g3  out                       CABK11051.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGNGCTGTTCACAATGGTACTCGTCCACCATTAATAAAAATTTGCTAGCCTATTGAAGCTTATGACTCGCTGCTGGTC
  3   1   2       bld Gas8                                 st106e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTGACATGATTGAGACTCCACCGGTGNTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTNTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTNCAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCNNTAATTCACAGGGACCNCAAACCACCAAAGTAAGTATTGTCTTTTCTCCATACAAGTATTCTAGTAAGAGT
  5   1   2       bld Gas7      in                         XZG42160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAATATTTGTAAAAAAAAAAAAAAATCACTTAGTTACTTATTCAGAATAAGTTTCTTTTTCTTTGAACATATGTCATTGAATATAACATGGCAAAACCTAATGCATTATTTCTGTTATTAGGATTTTGCATAGGTTATTTTTTATAGAGCATGTGATTTGTATGTTGTTGTGTTGTTGTAGCTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCACCATTAATTAAAAATTTGCCTAAGCCTATTGAAAGCTTAATGACTCGCTGCTGGTCCAAAGATCCCCCACAAAGACCTTCAATGGAGGAGATTGTCAAGATAATGACACATCTTATGCAGTATTTTCCTGGAGCGGATGTTTCCTTACAGTATCCTTGTCAGTACTCCGATGAAGGGCAAAGCAATTCTGCCACAAGTACAGGTAGGATAAACTACTTTTAGATGTTAATAATTATTCAAAGATAAAATGAGGAATATGGTTTTCTGTATTCACATAAAACTGGGAACTTGTTGGGACAGTCTCTGGTTGTATAGACATATTCTGAAGCAAGTAGCGCCTATTCCACCAGTTCAGTCCAAACTTGGCATAG
  3   1   0       add Gas7      in                         XZG42160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACAGTCTCTGGTGGTATAGACATATTCTGAAGCAAGTAGCGCTTATTCCACCAGTTCAGTCCAAACTTGCATAGAACCAGAGTGCTAAGGAGAGCATTTAGTCCTTGATGGAGCATAGCTCATAGGTAATAGTCAAATGGTAGTTTTGGTGACTTTCTCATACCAGGTAGCAAAGGATGGGCTGATAGTTTGTAAACATGAGGATTCTATTAGACCCTGTGAGGAAATTTAGATGACATTAGGCTGTCTCTAGTTTTCATTAACAGTGCTACTAAATCTTGCTGCAATACTTCCAACTGCCCAATGGTAATGTCTGGGCCACCAAAGAAGGTGGGGTGAGTCCTTTACAGCTCCCAGAAACCCTTTTATGGGACCACCTTCTTAATTAAAGAAGCCGGGTTAATGAATAAATCGCCTTTTATTAACATTAGTGGCTTTATGTTGGATACATATTTACTGGTCCACCAGGGATGCTGCAACGTAGCATGGACAGAACTTTGGCCTAGAATTGAGCATATGCATTTTTAAGGGACATAATTTTGTATGAGACTTATATTGTGGATTCTTTCACAGGTTTTAATTGATGTTATCAGTGCTTTTCTAAATGACAGGTGAAAGGAATTTCTAACGGTACATCTGTTACATAGACAAGGGAGTATTAGGCATATGTGGAATACACTTTATATGGGATGCTAGCTGGGATCTTAAGGGCCTCTTCTTTCATGAGTAGCAATTTATGTATTGGCTTTTCACCTGTGGCCTAAGTAGGGAAGGTATGAGCTATGGAGATATGTTTTTTAATTTTAGAAGGACTTTTCGCCATTTTATAAAAAAAAAAAAAAAGG

In case of problems mail me! (