Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Nov 2017 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC5723.3.5                         66 END     7          33       10                TAK1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012076988 Xt7.1-CABI10913.5 - 21 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI10913.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCAC
                                                  Xt7.1-CHK-1008230302                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCACCATTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              4     4     4     4     5     5     5     5     5     5     7     8     8    10     9    12    10    12    11    13    14    15    15    16    15    16    16    16    16    16    16    16    16    16    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    18    19    19    19    18    19    19    19    18    18    18    18    18    18    18    18    17    18    17    18    17    18    17    18    17    18    18    18    17    18    17    18    17    18    17    19    16    19    16    19    17    19    17    19    16    18    15    16    12    13    12    13    12    13    12    13    11    13    11    13    11    13    10    12     9    12     7    10     7    10     7     8     7     8     7     8     6     6     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                               BLH ATG     305     589                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     305     147                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     305    1252                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     305      46                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Br ---- 4e-012     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Bf ==== 3e-020     AAM18889.1 unknown [Branchiostoma floridae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 7e-022     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 8e-023     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Sc ==== 3e-023     NP_009411.1 Promotes the exit from mitosis by directly switching on the kinase activity ofDbf2. Required for mitosis and sporulation, cell division cycle blocked at 36C.; Cdc15p [Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 7e-029     NP_001021183.1 C24A1.3b [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dm ==== 2e-071     NP_524080.1 TGF-beta activated kinase 1 CG18492-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 3e-104     BAE06720.1 mitogen-activated protein kinase kinase kinase [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 9e-104     XP_795629.2 PREDICTED: similar to TGF beta-activated kinase [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 1e-126     NP_001018586.1 hypothetical protein LOC553788 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 3e-133     NP_003179.1 mitogen-activated protein kinase kinase kinase 7 isoform  A; transforming growthfactor-beta-activated kinase 1; TGF-beta activated kinase 1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 3e-133     NP_766276.1 mitogen activated protein kinase kinase kinase 7; TGF-beta-activated kinase 1;TGF-beta activated kinase 1; transforming growth factor-beta-activated kinase 1[Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 2e-137     XP_419832.2 PREDICTED: similar to TGF-beta activated kinase 1a isoform 3 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xl ==== 3e-140     AAH49005.1 Similar to mitogen-activated protein kinase kinase kinase 7 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 1e-140     AAI36217.1 Unknown (protein for MGC:122950) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 1e-140     NP_001093731.1 mitogen-activated protein kinase kinase kinase 7 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI10913.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  0   1   1           Brn4 FL                         CAAL18454.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCACCATTAATTAAAAATTTGCCTAAGCCTATTGAAAGCTTAATGACTCGCTGCTGGTCCAAAGATCCCCCACAAAGACCTTCAATGGAGGAGATTGTCAAGATAATGACACATCTTATGCAGGTATGTTGCCATTGAAGATATGTTTTTGCCTTTAAAGGAAAAGTAACAAAAACATTTCCAATTACAAATATACTTTTGAAACACTCTTATCTACTTATATAATAGAGCCAAATTGCAATTTTATGAGTGGTTATTGAATAAATTGCATTACCTTGGCTGTATAGGGCATAGTTAAAAAAGGCGATGTGACGACTGCTTTACTTCTGGTTAAAATTGGAAGTTCATTTCCTGCATTTTCTAGCATACAAAGAGCCTGCTTTAAAAGTGATTTAAAGGTTTTTTCATGTCCATTCTGGGAGAGGGATGGGTGATGGAGGTCTTCTTATCTCCTACTCTGTTTGGATTTATGTGTGAGTGGAGCGCTGCTGTGGTTGCACTGGGAGGGGGAGGATGGGGAAGTTAGTCACGAGAGAAGCTGCAGCCTGAGCCCTATCAATATATGGTTATTTATTTAAAATCTACTTATGACATCAACATTTCAGTGATGACAAATATGATAATAAAAGTGTTTAGAAGGCATATGTTCAATGTCCTTTAAGCAACTTTCTGCAAAACTCTCAAAGGATTTGGGTTTTATAAAATAAGTGCTCAAATTTCCAGGGCAAGCACATTGGCTTCATGGTTCTTATCTCTTGACGGTGAGATTAGTCGCCATCCTACCAGCAAGAATGTAAATCGCCTATGGAATGGTTTCCTTTCAAGGCAACTTTGGCGTATGCCATCCCACCTGCAATTTACATTCTTGCCGGTGGGATGGCATTGCAGGGAGATTAGTCTCCTGCGGCAACAGAGATTTGTCGTGGGGCGACTAATCTCCCCATCTGCCCTAAACATTGTCTCAATCAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg079f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAAGCCCCGCCCTGCTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATTGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTA
  5   1   2       bld 1030 5g                         IMAGE:7092163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCGCCCTGCTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCTAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTTGAAAGTGAATCTGAAAGGAAACCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGGGTAACCATCCCAATATTGTCAAGTTGATGGAGCCTGCCTAATCCCTTATGGTTAATAAGGAAAATCAAAAAGGCGGTTCCCCGTACAAGAATTTGATGGGACCGAACACTGCCTAACAAGCACCGGCCCTGCAT
  5   1   2       bld 1030 5g                         IMAGE:7093425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCCTGCTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGANAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAAGCGGTTTCCTTGTACATGTTTTGCATGGAGCTGACCAACTGCCGTACTATAAGACTG
  5   1   2       bld Gas  5g3  out                  TGas086i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTCGCCGCCGCTCTGCATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCT
  5   1   2   14  bld Brn3 5g3  out                        CAAK5189.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATTAGGCCTGCGCTTCTTCGCCTCTACCTGTATGGTCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAAC
  5   1   2   14  bld Brn3 5g3  out                        CAAK3254.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGGATCGGAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGNCACTACAGTGAG
  5   1   2       bld Gas  5g3  out                 TGas089g09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATTGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATG
  5   1   2       bld Gas  5g                        TGas029n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGTTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATNTACATAGCATGAAGCCCAAAGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGC
  5   1   2       bld Neu  5g                        TNeu054p12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGCCAGCGCATCAGCGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATG
  5   1   2       bld Neu  5g                        TNeu144j12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGCCAGCGCATCATCGGCTGCAGTAGTAGCAAGAGAGCCCTCCCCTCTTCACCACATGCCCTGGCTCCAAGCATGCTATGCCCATCAGCCCATAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCATCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAAGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAAGAGATATATGTGGAAGATGTAGTTGGAATATGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTGTGTTTAGTAATGGAATATGCAGAATGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACATCTGCGCATGCAATGAGT
  5   1   2       bld Brn4 FL   out                       CAAL18454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCTACAGTAGTAGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAG
  5   1   2   10 seed Ovi1 5g3  out                       CABI10913.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGCAAGAGAGCCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATG
  5   1   2   20  bld Spl2 5g                             CBSS9294.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCCCCTCTTCCACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGC
  3   1   2       bld Gas8      in                         st105f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCACAGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAAGTAAGTATTGTCTTTTCTCCATATAAGTATTCTAGTAAGAGTTTTTCTTTGTGCTCTCTCAAAAAATAGCTTTTATATAATG
  5   1   2       bld Gas8      in                         st105f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCCTGGCTCCAAGCAGGCTAGGCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGGCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCNAAGGCTCTAATTCACAGGGACCTCAAA
  3   1   2       bld Gas8                                 st108f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCAGGCTAGGCCCCAGCAGCCCAGAAGGGGGTTACCTGGTCCTTGATGGNCCGGGGCCGCCCGTCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCNCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGNGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACATGGGACCTCAAACCACCAAAGTAAGTATTGTCTTTTCTCCNTATAAGTATTCTAGTAAG
  5   1   2       bld Gas  5g3  out                  TGas071i11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAAGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCT
  5   1   2   10  bld Spl1 5g3  out                       CABK11051.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACGTACAAGTATTACGGTGGCTCCTGTTAAACCCGCTCTGTTTTCCCCAGCTGTGTACCCCGGCTTCCGCCGGTGGGGTCCCCGATTTCTCTTGTAAGGGCACGGCATGTCTGCCGCCTCTGCTGACATGATTGAGACTCCACCGGTGCTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTGTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCGTACTATACAGCTGCGCATGCAATGAGTTGGTGTTTACAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCTCTAATTCACAGGGACCTCAAACCACCAAACTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGNGCTGTTCACAATGGTACTCGTCCACCATTAATAAAAATTTGCTAGCCTATTGAAGCTTATGACTCGCTGCTGGTC
  3   1   2       bld Gas8                                 st106e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTGACATGATTGAGACTCCACCGGTGNTAAACTTTGAGGAGATCGACTACAAGGAGATAGAGGTGGAAGAGGTAGTTGGAAGAGGAACCTTTGGTGTTGTCTGCAAAGCCAAATGGCGAGGAAAGGATGTGGCAATTAAACAAATTGAAAGTGAATCTGAAAGGAAAGCCTTTATTGTTGAGCTGCGGCAGTTGTCTCGTGTTAACCATCCCAATATTGTCAAGTTNTATGGAGCCTGCCTAAATCCTGTATGTTTAGTAATGGAATATGCAGAAGGCGGTTCCCTGTACAATGTTTTGCATGGAGCTGAACCACTGCCATACTATACAGCTGCGCATGCAATGAGTTGGTGTTTNCAATGTGCCCAAGGAGTCGCATATTTACATAGCATGAAGCCAAAGGCNNTAATTCACAGGGACCNCAAACCACCAAAGTAAGTATTGTCTTTTCTCCATACAAGTATTCTAGTAAGAGT
  5   1   2       bld Gas7      in                         XZG42160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAATATTTGTAAAAAAAAAAAAAAATCACTTAGTTACTTATTCAGAATAAGTTTCTTTTTCTTTGAACATATGTCATTGAATATAACATGGCAAAACCTAATGCATTATTTCTGTTATTAGGATTTTGCATAGGTTATTTTTTATAGAGCATGTGATTTGTATGTTGTTGTGTTGTTGTAGCTTGCTGCTGGTAGCTGGAGGCACTGTTCTTAAGATTTGTGACTTTGGTACAGCCTGTGATATTCAGACTCACATGACTAATAACAAAGGAAGCGCAGCATGGATGGCTCCAGAAGTTTTTGAAGGTAGCAACTACAGTGAGAAATGTGATGTATTTAGTTGGGGAATCATTCTATGGGAAGTAATAACCCGAAGAAAACCTTTTGATGAAATTGGTGGCCCAGCATTCCGTATAATGTGGGCTGTTCACAATGGTACTCGTCCACCATTAATTAAAAATTTGCCTAAGCCTATTGAAAGCTTAATGACTCGCTGCTGGTCCAAAGATCCCCCACAAAGACCTTCAATGGAGGAGATTGTCAAGATAATGACACATCTTATGCAGTATTTTCCTGGAGCGGATGTTTCCTTACAGTATCCTTGTCAGTACTCCGATGAAGGGCAAAGCAATTCTGCCACAAGTACAGGTAGGATAAACTACTTTTAGATGTTAATAATTATTCAAAGATAAAATGAGGAATATGGTTTTCTGTATTCACATAAAACTGGGAACTTGTTGGGACAGTCTCTGGTTGTATAGACATATTCTGAAGCAAGTAGCGCCTATTCCACCAGTTCAGTCCAAACTTGGCATAG
  3   1   0       add Gas7      in                         XZG42160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACAGTCTCTGGTGGTATAGACATATTCTGAAGCAAGTAGCGCTTATTCCACCAGTTCAGTCCAAACTTGCATAGAACCAGAGTGCTAAGGAGAGCATTTAGTCCTTGATGGAGCATAGCTCATAGGTAATAGTCAAATGGTAGTTTTGGTGACTTTCTCATACCAGGTAGCAAAGGATGGGCTGATAGTTTGTAAACATGAGGATTCTATTAGACCCTGTGAGGAAATTTAGATGACATTAGGCTGTCTCTAGTTTTCATTAACAGTGCTACTAAATCTTGCTGCAATACTTCCAACTGCCCAATGGTAATGTCTGGGCCACCAAAGAAGGTGGGGTGAGTCCTTTACAGCTCCCAGAAACCCTTTTATGGGACCACCTTCTTAATTAAAGAAGCCGGGTTAATGAATAAATCGCCTTTTATTAACATTAGTGGCTTTATGTTGGATACATATTTACTGGTCCACCAGGGATGCTGCAACGTAGCATGGACAGAACTTTGGCCTAGAATTGAGCATATGCATTTTTAAGGGACATAATTTTGTATGAGACTTATATTGTGGATTCTTTCACAGGTTTTAATTGATGTTATCAGTGCTTTTCTAAATGACAGGTGAAAGGAATTTCTAACGGTACATCTGTTACATAGACAAGGGAGTATTAGGCATATGTGGAATACACTTTATATGGGATGCTAGCTGGGATCTTAAGGGCCTCTTCTTTCATGAGTAGCAATTTATGTATTGGCTTTTCACCTGTGGCCTAAGTAGGGAAGGTATGAGCTATGGAGATATGTTTTTTAATTTTAGAAGGACTTTTCGCCATTTTATAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)