Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:7022690.5                       2 END     1           1       50                actin related protein 2/3 complex subunit 1A; actin binding protein(Schizosaccharomyces pombe sop2-like); SOP2-like protein [Homo sapiens]

 This cluster: approximate FL confidence score = 90%

 1012077034 Xt7.1-TEgg069l19.3.5 - 60 ESTs
                                                                       ......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg069l19.3.5                                                                                                           TTCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTG
                                                  Xt7.1-CHK-1008224969                                                                                                                 CTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATT
                                                      consensus depths                                                                                                                2     2     5     5     9     9     9    10    12    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    14    15    14    15    14    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    16    17    15    17    17    18    17    18    15    16    15    16    16    16    16    16    16    16    16    16    16    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    16    16    17    17    18    18    18    18    17    18    17    17    17    17    17    17    17    17    18    18    17    18    17    18    16    18    15    18    15    16    14    16    15    16    13    16    14    15    13    14    14    14    14    15    12    12    10    10     8     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     7     7     6     7     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     5     7     5     6     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     8     9     8     9     8     9     9     9     9     9    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     7     9     8    10     8    10     8    10     8    10     7     9     8    10     8    12     9    14     9    14     8    15    12    17    14    18    14    18    15    19    16    19    17    20    17    21    18    20    18    20    19    21    19    22    18    21    18    21    19    20    18    20    19    20    17    21    19    22    20    23    20    23    21    23    21    24    21    24    21    23    21    22    21    22    21    22    21    22    21    22    21    22    20    22    20    22    18    22    17    22    18    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    18    22    15    22    17    22    18    22    18    22    18    22    18    22    18    23    18    23    17    23    19    22    19    22    19    22    19    22    19    22    16    21    18    21    18    21    18    21    16    21    17    21    13    19    14    19    11    18     9    16     5    13     3     5     3     5     3     3
  5   1   2  SIG                                    Xt7.1-TEgg069l19.3                                                                                                           TTCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTG
  5   1   2  SIG                                    Xt7.1-TTpA023j05.5                                                                                                                               ATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTTGCTGGAATTTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTGG
                                                                   SNP                                                                                                                                                                                   --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               G-----------
                                               BLH ATG      20     567                                                                                                           
                                               BLH MIN      20      67                                                                                                           
                                               EST CLI       1       3                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ==== 2e-013     XP_001199613.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 3e-041     NP_956640.1 hypothetical protein MGC63938 [Danio rerio] ------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PREDICTED - Gg ---- 2e-058     XP_415152.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Hs ---- 7e-061     NP_063940.1 second mitochondria-derived activator of caspase isoform Smac-alpha, precursor;direct IAP-binding protein with low pI; mitochondrial Smac protein [Homosapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Mm ---- 4e-063     NP_075721.3 diablo [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Xl ==== 2e-122     CAJ19268.1 Smac protein precursor [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === ?? ==== 2e-122     NP_001091439.1 Smac protein precursor [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Xt ==== 2e-131     AAI21213.1 Diablo homolog (Drosophila) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg069l19.3.5                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TAA------TGA------------------------------------------TAA---------------------------------------TAG---TAAATGTAA---------------------------TAA---TAA---------------------------TAG------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------TGA---------------------------ATG---------------------TAA------TAGATG---------TAG---------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---------------------------TGA------ATG---------------------------------------TAATAG---------------------------------------------------------------------------TAA---------------------ATG---TAA---------------------------TAA------------------------------------------------------------------------------TAATAATAA---------------------------------------ATGTAA------------------------------------------------------------TAA------------TAA---------------------TGA------TAG---------------------------------------TGAATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAG------------------ATG---------------------------------------------TAA------------------TGA---------------------------TAA---TAA------------TGA------------------------------------TGA------------------------------------------ATG---------------------------------------------------------------------------------------------TGA------------------------------------------------------------TAA---TGA---------ATG---------------------------------------TAG---------------------ATG------------TAG------------------------------------------------------------------------------------------------------------------TAA---------------------------TAG------------------------------------------ATG------------------------TAA---ATG------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2  SIG                                    Xt7.1-TEgg069l19.3                                                                                                           TTCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTG
                                                  Xt7.1-CHK-1008286380                                                                                                                 CTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATT
  0   1   1           Gas  FL                     TGas137b01.FL-Sanger                                                                                                           TTCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAAAAAAAAAAAAAAA
  0   1   1           Te5  FL                          CAAO6487.FL-MGC                                                                                                                              GATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAAAAAAAAAAAAAAA
  3  -1   2       ext Egg       in                    TEgg012i22.q1kT7                                                                                       GCCGCGTCGACCTAGTTCCCTTCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTACAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATT
  3   1   2       ext Gas  FL   in                    TGas137b01.q1kT7                                                                                                           TTCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGGAAGACTGAAATGCATCTTAAAATGTGTGAAGGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas  FL   in                   TGas137b01.p1kSP6                                                                                                            TCCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGC
  5   1   3   34   nb Brn3 5g                              CAAK2308.5p ............................................................................................................CCTGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAATACCTGAAGCTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTANCAGAGAAAGAAGAGACAATGTGAACTTTTAATACATTACTTTATCTT
  5   1   0       chi 1030 5x                         IMAGE:7026097.5p                                                                                                               GGCTTCCGCCTGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAAGAACAGTAATCTGAAAAGTATGAATTCTAGCCTGGGCAGAAAAAGCCAGTGAGCCCCTATTCCGAAGAATGGGGCAGCAAAAAACCAAGCCATTCCCAGTTCAGGGGGGGCAAAAACCAAGGGCTTTCCAGTTGGACCGGGGGTGCCGAAAAATTCCCCCATTTCCCCGGAAAAAAGTTCCCCAGAAAAACCCCAAAAGTGTGGCAAGCCCAAAGGGCCCCCGCGGCCAAAATTTCAGGGGGGCCCCCCCACATTAATTTTGTGGCCACAAAAAAGGGGGGTTTCCCCCAAAACCTTTTGGGGGGGCCCGGGGCAT
  5   1   3        nb 1030 5g                         IMAGE:7093560.5p                                                                                                                         GGTAAGATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAGAACTATTACAGAGGA
  5   1   2       ext Te5  FL   in                         CAAO6487.5p                                                                                                                                TGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTANAATGTGTGAAGTGAAAAATGCTATCAGAGAAAGAAGAAGACATGTGAACTTTAATACATTACTTTTATCTATTCATGGGATGCGTATTGTCCATAGACATAAATGT
  5   1   3        nb TpA       in                   TTpA002m16.p1kSP6                                                                                                                                  GCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTANCAGAGAAAGAAGAGACNATGTGAACTTTAATACATTACTTTATCT
  5   1   3        nb Gas7      in                         XZG53590.5p                                                                                                                                              CGGACGCGTGGGTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTACAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGTAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAAGAGGTACA
  3  -1   0       chi Lun1                                 CABD5138.3p                                                                                                                                                         TTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGGTATAATTGTTAGGCTTGGGCCGTATGGGTAACTATATTACCTAGGGTGGCCTTTTCAAGTAGGTACTTGCAGATGTGTAGCTTATTCCAATCTCAGTGTGTTCATGTACAGATTTTAACCATGTACTTATAGGTACCCTATAGCTcaggggtccccaaactttcttactcgtgagccacagtcaaatgtaaaaatacttggagagcaacacaagcgccataaaagttaatggaggtgccaaataagggctaagattggctattaggcagcctctatgcacactatcagcttacagggggctttatttggtagtaaatcttgtttttattcaaccaatttgataataactacctggnttggggacacagagagcaacatccaaggggttggtgagcaacatgttgctcacaaaccact
  5   1   2       ext Brn3      in                         CAAK9074.5p                                                                                                                                                          TGGAGCTTCTCTTACATACTCAGAGAAAGCTTTACAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTANAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGT
  5   1   2       add Lun1      in                         CABD8430.5p                                                                                                                                                           gtaaatgtaattgctatagagaacagcatttacagaactcctggttgttactttttaaacaatgttgcaagtgccaggctcctccagcaagtcagggctgtccatctgctgccttgtgttacattgtttcaaacgcctgagccaccagggcagggaatagaataggccaggcaaacactgctttaatagcacttatatatacaagtggctttaaaaacattacaaattagtaaaatgtaaattgcaaagttgcaaattatgttttcttttattaggaaaaTTTTGGGGTTAATAGGTCCTTTACTGGATGTTATAGTGTGTCAGACTGCTAGCAATACTTTGAAATGTGAATATAAGCCTTGTCTTTCCCTTCATAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTANAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGANCATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTG
  5   1   4      seed Tad5      in                         XZT12129.5p                                                                                                                                                                         ATACTCAGAGAAAGCTTTACAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACA
  5   1   0       chi Neu                            TNeu013i11.p1kSP6                                                                                                                                                                                                                                                                                                                         AAGAGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTNTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGC
  5   1   3        nb HdA       in                   THdA017a01.p1kSP6                                                                                                                                                                                                                                                                                                                               TCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACTGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTGTACTCTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCCTGATAAAATGAATTCAAATGAAGAAAGCGCCGTCTGGCAAGTGATCATTGGAGCTCGTGTA
  5   1   2       ext Egg       in                   TEgg018m06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                    GTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGA
  3   1   2       ext Te5  FL   in                         CAAO6487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTAAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGT
  5   1   3        nb HdA       in                   THdA012i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGCATGTGATCCTTGGAGCTCGTGTACGCATAAACCTGTTTTAGGAGCAGTATCTGAATTATCAATCTATCTGGAACAGAGCAGTGAACCTCTCATAGATGGCCTCGAACCCAACATACCAGTCGCGTGCATACCAGTCTTCAGTGACGGTGCGATATCACATCCAGATAGTCCATACCCAAGTGCAGCAAGCCCGCGTTCAGGCTCATATAGCATAGGTCCAGCTGGCGGCATGTCAGACAGACGAGATCTGAGGAACTATTACAGAGGATAAAGGGAACCCACCCATTGGAGGAAGCCCTGGAAGCAGCCTGTCGGAGGAACACGAAATACCTGAAGCTTACCTGCGTGAAGACTGACATGCATCTTATAATGTGTG
  5   1   3        nb Tad5                                 XZT57438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTTGTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTT
  5   1   2       ext Eye       in                         CCAX4646.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCAT
  5   1   2       ext TbA       in                   TTbA041a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAGCANAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGA
  5   1   3        nb Egg                            TEgg065d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATT
  5   1   3        nb Gas7      in                         XZG27873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACA
  3   1   2       ext Eye       in                         CCAX4646.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATTAAACTAAATAGATGATTTGTAATTAGCACTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTA
  3   1   2       ext Egg       in                    TEgg018m06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG27873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACCCACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCGGT
  5   1   2       add Hrt1      in                         CAAQ1540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGAGGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTGCTGGAATTTGCCATGTGATTCCAAAAAAGTGAAGAAGGCCAAAGCTGAGTAACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATTAGGGT
  5   1   3        nb Egg       in                   TEgg069l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTACCATGTGTCCTTGTACTACTGATTGTGCTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAAGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATA
  5   1   2       ext Lun1      in                        CABD14074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTAATTGTATACTTATAATAGGAACAGGTGCCAAAGAGTGCATATACTGCTGTTTCCTGTGTAGCAGCAGTGACACACAGGGCAATTTTTAACACTTAAAAGTCACAGAGAGAAAATAAAATGCCCTAAGCTGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCCATTTTGTAGCTTATTGGGCAGCCT
  5   1   2       add Abd0      out                      IMAGE:7000240                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCCTGTTTGTAAACTGTTGCTTTTAGGGGGTAGATCACCATTTAGACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACACAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAAGTGAACCCAATTATTGAACACTTTACGTGAGGCGTGCTAAATTTGGCTTTGGATTTCCTTTTGTTTTGGAATGAAAAAAATCCCGGGTAAACAATGGTAAAAGGGAAAAGGGTTTTCCTTTTCTGGCCCTTTTGTTTCTGGCTCCCCCCCTTTAGGGAAGGGGGGAAAATTTAAAATTGGAGGCGTTCACGCCAAAAAGAAAAAAAACCCTTTTTAAACGGGGGGAAATTTTAGGGGGGCGGTGTGTTTAAAAGGAGGAAACCCCCCCCCCCACGAATTTTTTTTTTTTTTTTTTTGGCCCCCCCCCCCCCTTAATAACCCCCCCTTTTTTCCCCCCCCCCCCGGGGGGGGGAGGAGGGTTTTTTTTTTTTTTTTCAACAAAAAAAAAAGCCCCCCCAAGGAAGAAATATTTTTTTTTGGGGGAAAAATTTGTGAAAAAAAAAAAAAATCCTGCGGT
  5   1   2       add AbdN      in                       IMAGE:6997913                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCCCTGTTTGTAAACTGTTGCTTTTATAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAANCCTGTGCCTATCTTGNCCAGCATTATNCCGCAGAATGCTCCCTGCGTGAAGTCACGTATCTTTCAGGAACTGCATANGGATTAGTTGACATTGTTCCG
  5   1   2       add AbdN      in                       IMAGE:6998680                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCCCTGTTTGTAAACTGTTGCTTTTAAAGGGGTAGATCACCTTTAACTTTTAGTATAACACTGACATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCNNTGTGCTATCNTNNGCAGCAATTTATCCGCAGAANATGCTCCCTGCGTGAAATACACGTATGCTTTCAGGAACTGCATAGGGATAG
  5   1   3        nb TpA                            TTpA047n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATATCAACCAGGCAGTGGGTTAAATGAAAGACATTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCCTCAACTGACACCTAATTTGTATGTCAA
  5   1   0       chi Gas                            TGas012f24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACCAGGCAGTGGGTTAAATGAAAAACTTATCAATAATAATAAAATAGTAAGCTGCTGGGATCATTCACCCCCATATGCTGGATGTAACAGAGAAAAATAAATCTTCATTGTTTATTTTTTATAAAGTTTTTGGAACCGGACATTCTATAACACACTAAAAGTTAACTGAAAGGTGAACCCAATTATTGAACACTTTAGGTGAGGCGTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTCTAACAATGTTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCACTACAGTATGTAGAATGCATCATTTTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAAACATTTGCAGGGCA
  5   1   2       add Tad0      in                       IMAGE:6983264                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCTAAGTTGTCTTTGGATTTCCTTTTGTTTTGAATGGAAATATTCAGGTATAACAATGTGAAGGTGAAAGGTGTCCATTCTGCACATCTGTCCTGCTACCCCAGTAGGAGAGGGAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGGTGGAACAGTNCTCTGTTTGGTATTTCTTNNNACACAGTCTTT
  3   1   2       add Tad0      in                       IMAGE:6983264                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTAAAAAGTGGAGGGGCTGAAAGGGAAAAAGGGAAAAAGTTCAGGTAAAATGGGATTTTTAAAGGTGGTTGGTTAATTAAGGAAAGCCGCTCCCAGGCATAATCCTTTATTTTTTAAATCTCTTAACCTTTTAATCTCTTTATTTTAGCCCAGTAACAGTATGTAGAATGCATCATTTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACTTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAAATAAA
  3   1   3        nb Egg       in                    TEgg069l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTAGGAGAGGAAAAGTGAAAGTGAGGCTGAAGGAAAAGGAAAAGTCAGTAAAATGGATATTAAGGTGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTCTTGGTTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAGATAAAATATTTGATAATTCTGTTCTGATATGAAAAAAAAAAAAAAAAAA
  3   1   2       add Lun1      in                         CABD8430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCTGGTTAGTAGGGAAGCGCTCCATGCATATTCTTTATTTTTTAATCTCTTNACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGAAAAAAGCCTCTCGCCN
  3   1   2       add AbdN      in                       IMAGE:6998680                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCTGTAGTAGGGAAGCGCTCATGCATATCTTATTTNTAATCTCTTTACCTTTAATCTCTTATTAGCNCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACNTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATAGCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAATTTGAATACGGN
  3   1   2       add AbdN      in                       IMAGE:6997913                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGGTAGTAGGAAGCGCTCATGCATATTCTTATTTTTAATCTCTTACCCTTTAATCTCTTTATTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACNTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGAGGGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATAGCTAGCTGGCATTTCCAATTTTCTACATTCTGACACCTTGCAGATCACACTACGCTTATAATATCGTCC
  5   1   2       ext Tbd1      in                         CBXT2683.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCTCCATGCATATTCTTTATTTTTTAATCTCTTTACCTTTTGATCTCTTTTTTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCACAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATCATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGTTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGC
  3   1   2       ext Brn3      in                         CAAK9074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCTCCANGCATATCTTTATTTTTAATCTCTTACCCTTTAATCTCTTTATTTAGCNCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTGNCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGT
  3   1   2       add Hrt1      in                         CAAQ1540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTTACCTTTTAATCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGT
  3   1   3        nb Egg       out                   TEgg070l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAATGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTGCTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTTTTGGTTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTGTGGCAGGAGCAATGTATAGGTTTCCTTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACAGAAGTTTCAGGTTTTTAAGGAATGAGCTCATTGCATTTATACCTAGAGGGCATTTCCAATTTTCTACATTTTGATTTGCTGATTATAAAAGGTAAAATATTATGATAATTCTGTTATGATAAGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Lun1      in                        CABD14074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCTTTATTTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTGGACTAAAAAAAAAAAAAAAAATCTGCCGCTC
  3   1   2       ext TbA       in                    TTbA041a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGCCCAGTACAGTATGTAGAATGCATCATTTTTTTTTTAGCTGTATAACATATCCTCAAACTGACACNTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGGTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTTTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTTTTTTTTTGGTTATTTCTTTAACAACCAGTCTTTTTTTGCGGTTTGTTGCCTTTGGATAGGCGGCATTTTATTTAAATCAATACCATAAAGCCCACTTTTTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTTTACATTTTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTGTGATATTAAAAAAAAAAAAAAAAAAAAAAGC
  5   1   2       add Tbd1      in                        CBXT11226.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCCGAATTTCCGTCCGACCCACGCGTCCCGCTCAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCACAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATCATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGTTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCT
  3   1   3        nb HdA       in                    THdA012i02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATAACATATCCTCAAACTGACACTTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAATTGAAAGAAACTCAACTCAAAATCACCCATTGTGTCATTGTCATAAACAACTGCATTCAGTAAGGATGAACACTTATAATGATATATAACACAGATTTCAAGTTATTTTGGCAATAACAGGTAGTTTTTAAAGTACCACTCGTACATGGTCCTTTATAAATAGTGGATTTCCACTCGGTGGGTTGGAACAGTTTTCTAAAGGTTATTTCTTTAACAACCAGTTTTTTTTTGTGGTTTGTTCCCTTTGGATAGGCGGCATTTTTTTTAAATCAATACCATAAAGCCCACTTTTTGGCAGGAGCAATGTATAGGTTTCCCCTCACAGTGCAGGTGCATAAGTACAGGTTTAACATTTATGGCGTTGAAAGAAGTTTCAGGTTTTGAGAGGAATGAGCACATTGCATTTATACCTAGTTGGCATTTCCAATTTTTTACATTTTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Gas7      in                         XZG53590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTAAAAAAAAAAAAAAAGG
  3   1   4      seed Tad5      in                         XZT12129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTCCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTG
  3   1   2       add Tbd1      in                        CBXT11226.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCACAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATCATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGTTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTGGACAAAAAAAAAAAAAAA
  5  -1   2       ext Egg       in                   TEgg012i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCTGAAAGAACCTGTTGCCTATCTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACCCTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTTTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATTCCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTTTACATTTTGATTTGGTGATTATCCAAATAAAATATTTGATAATTCTGCTCTGAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Tbd1      in                         CBXT2683.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTATCTTGCCAGGCAATTATCCCACAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGCTGAACACTTATAATCATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGTTATTTCTTTAACAACCAGTCTTTTTTTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAACCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTTTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTTTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTGGACTAAAAAAAAAAAAAAAATCTGCCGCTCATTCAAAAAAAAAAAAAAA
  3   1   3        nb HdA       in                    THdA017a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAAGTACAAGAATGCTTTCTGGGGACTGCATTAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGTAAGGATGAACACTTTTAACGATAATAACCCAGATTTCAAGTTACTATGGCAATAACAGGTGGTTTTTAAAGTACCACTTGTACAGGGTCCTTTTTATATAGTGGATTTCCCTCGGGGGGTTGGGGCAGTTTTTTGTTGGGTATTTTTTTAACAACCAGTCTTTTTTTGCGGTTTCCCGCCTTTGGATAGGGGGCATCCCCCCCAAATCAATCCCATAAAACCCACTTTCTGGCAGGAGCA
  3   1   2       add TpA                             TTpA007j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTCTTTTTGTTCGGTTCGAGACCATTGGATACGGCGGCGTGTTATTTAAGTCAATGGCCATAAAACCCTCTTTTTGGCAGGAGCAATGTATAGGTTTCCTTTAAGAGCAGCAGCATAAGTACAAGTGTACCATTTAAGGGGTTGAAAGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTCATCCTTAGTTGGCATTTATCAATGTTCTACATTTTGATTTGAAGAGTATCCAAATAAAAAACTTGATAATTATAGTTGGTGATATGCATAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA       in                    TTpA002m16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTT
  5   1   2  SIG                                    Xt7.1-TTpA023j05.5                                                                                                                               ATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTTGCTGGAATTTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTGG
                                                  Xt7.1-CHK-1008286376                                                                                                                                     TCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTTGCTGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTG
  5   1   4      seed TpA  5g3  in                   TTpA023j05.p1kSP6                                                                                                                               ATGGCGTCGCTCCCTAGACGTTTGATTTGGAGCTTCTCTTACATACTCAGAGAAAGCTTTCCAATTGTAAGTAGGAGAAACTGTGTCAGCTTACTGCGAGCTTCATGGCGTAAAGTGCTCTCAGTAGGTGTTGGGACAAGCGTATGTGCAATTCCAGTTGGACAGAGGTCAGAGCCCACTCTCTCCAGTGAGTCCCTTATAAAGAGGGCAGTGTCTTTGGTAGCAGACAGTTCATCTACATTTTTATCTCAGACAACTTATGCTCTTGTTGAATCCCTCACAGAATACACTACGGCTGTGTATACACTGATTTCTTTGCAGCAGAAGTACACCTCCCTTCTTGATAAAATGAATTCAAATGAAGAAAGCGCCATCTGGCAAGTGATCATTGGAGCTCGTGTACAGATGAAGCAGTTAAAAGAACAGTATCTGAAGTATGAATCTAGCTGGCAGAGAGCAGTGAGCCTATCAGAGATGGCAGCAGAAGCAGCATACCAGTCAGGTGCAGACCAGGCTTCAGTGACGGTGCGAAATCACATCCAGATAGTCCAGACCCAAGTGCAGCAAGCCCGCAATCAGGCTCATATTGCAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTANAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCCATAGACATAATG
  5   1   2       ext Fat1      in                         CABC5683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAGGTCCAGCTGGCGGCAAGTCAGACAGACGAGATCAAAAGAACTATTACAGAGGATAAAGGGAACCCACCCAGTGGAGGAAGCCCAAGAAGCAGCCTGTCAGAGGAAGAGGAAATACCTGAAGCTTACCTGCGTGAAGACTGAAATGCATCTTAAAATGTGTGAAGTGAAAAATGCTACAAGAGAAAGAAGAGACAATGTGAACTTTAATACATTACTTTATCTTATTCATGGATTGCGTATTGTCCATAGACATAAATGTAAGGGAGATGCACAAAGAAGGTACATTTTTAAGATTAATTTATCAGCTGTATTGGGATTCCTGGTTAGACCAGGTGGTATGCCTCCTCAGCCACTAGCATACCCACGCTTCCTGTTCTGCTTGGTCTTTGTTCTAAGAAATGACCTGAGTGGATTTCAGCTAATGACAAAAGAAAGTTTCCGCCGACAGTGTTCATCTCGCAGCCGAGTGTTACAGATACATGGAGGCAAAATGGTTTGCTCATTTCATGAGCAAAGCAGACTGCTGTAAAGCTCTTGATGGTTGTCTCTGTCTGTGCACATTAAACTAAATAGATGATTTGTAATTAGCACTTTCCTGTACCAATAATAATTCCCTTTAATTTTTGCTGCCACAAAGGAAGTGGTTTCAGGCCTTCTATTTACCGTATATAGAATTTTGCATTGTTAGTGTATTATAATGGACACATTTTGTATTGTAAGTATTTTAAAAGTTACCTAAGACTTCTATTTCTTAAGTTAACTAACAAAATAACACTTTCTTTGAGAAAAGAAGCAAAGGATTGTGCTAAGAAGCTTTCATTTGCTGGAATTTGCATG
  3   1   2       ext Fat1      in                         CABC5683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAACTGACACCTAATTTGTATGTCAAAATTTGTGAAAAAAATACATTTGCAGGGCACGTCTATAAGGGTAACGGCACACAGGGTGACAGTCACCCAGCCATTTTGTAGCTTATTGGGCAGCCTGAAAGAACCTGTTGCCTATCTTGCCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTCTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATATGTAACGCTTTCTCTGAATGCTTTTCTTTATTGTGTTGGACTAAAAAAAAAAAAAATCTGCCGCTCATT
  3   1   4      seed TpA  5g3  in                    TTpA023j05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGCAATTATCCCGCAGAAATGCTCCCCTGCGTGAAAGTACACGTATGCTTTCAGGGAACTGCAATAGGGATTAGTTTGAACATTGTTTCACTGCCTGGGGAGTCTGTAACATTGTGAACTGAAAGAAACTCAACTCAAAATCACCCATGTGTCATTGTCCTAAACAACTGCATTCAGCTGAACACTTATAATGATAATAACACAGATTTCAAGTTACTATGGCAATAACAGGTAGTTTTTAAAGTACCACTTGTACATGGTCCTTTCTATATAGTGGATTTCACTCGGTGGGTTGGAACAGTCTTCTGTTGGGTATTTCTTTAACAACCAGTCTTTTTTTGCGGTTTGTTGCCTTTGGATAGGCGGCATCTTATTTAAATCAATACCATAAAGCCCACTTTCTGGCAGGAGCAATGTATAGGTTTCCCTTAAGTGCAGCTGCATAAGTACATGTTTAACATTTATGGCGTTGACTGAAGTTTCAGGTTTTTAAGGAATGAGCACATTGCATTTATACCTAGCTGGCATTTCCAATTTTCTACATTCTGATTTGCTGATTATCCAAATAAAATATTTGATAATTCTGTTCTGATAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)