Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012077062 Xt7.1-TGas113c07.3 - 49 ESTs
                                                                       ....-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas113c07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGCAGCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAATCCATTTGCGGGCGTGCCGGTGGGCAAAGGCTCGAGCGAGGAGAGGGCTACCCCATTAACGCCGGCGTTTCAGTTCAGCATGGATATCGAAGTCGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTC
                                                  Xt7.1-CHK-1008225770                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAATCCATTTGCGGGCGTGCCGGTGGGCAAAGGCTCGAGCGAGGAGAGGGCTACCCCATTAACGCCGGCGTTTCAGTTCAGCATGGATATCGAAGTCGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     5    11    13    12    16    14    16    15    16    15    16    15    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    18    18    17    17    17    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    15    16    15    16    15    16    16    17    16    17    15    16    14    15    11    12    11    11    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     8     8     8     8     7     7     7     7     7     7     7     7     6     6     6     6     5     6     5     7     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     5     4     5     4     5     4     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9    13    14    13    14    13    14    12    14    15    15    15    15    15    15    16    16    16    16    16    17    16    17    16    17    16    17    16    17    15    17    16    17    17    18    17    18    18    20    18    20    19    21    19    21    20    21    20    22    20    22    20    22    20    22    20    23    20    23    20    23    20    23    20    23    20    23    21    25    22    25    20    23    21    23    19    23    18    23    18    23    17    23    16    22    16    22    16    22    17    22    17    21    17    21    17    21    16    21    15    20    15    20    19    19    14    19    14    19    14    19    14    19    14    19    14    19    13    18    13    18    13    19    10    19     8    19     8    18     6    16     5     9     4     8     4     8     4     8     4     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                               BLH ATG      95    1069                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-017     NP_491368.2 C41D11.3 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-053     NP_608673.1 CG4272-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 7e-060     XP_795517.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 3e-113     NP_695019.1 AXIN1 up-regulated 1; AXIN1 up-regulated; TGF-beta induced apoptosis protein 3[Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 2e-115     NP_955913.1 Unknown (protein for MGC:66340) [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 7e-121     NP_149016.1 AXIN1 up-regulated [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 0          XP_418530.2 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH82856.1 LOC494755 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = ?? ==== 0          NP_001088060.1 hypothetical protein LOC494755 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          AAI21868.1 AXIN1 up-regulated 1 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas113c07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------TAAATG---------TGA---------------------------------------------------TGA---------------------------------------------------------TAA------------------------------------------------TGA---------------------------------------------------------TAA---TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Brn4 FL                          CAAL7726.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCAGCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCATCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTTAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAATCCATTTGCGGGCGTGCCGGTGGGCAAAGGCTCGAGCGAGGAGAGGGCTACCCCATTAACGCCGGCGTTTCAGTTCAGCATGGATATCGAAGTCGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTATTTCAGGCGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAAAAAA
  5   1   2       chi Neu  5g                        TNeu041f19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGCTTCTTGGTGATTGCTGTAATGGGTTTCGGCGATCTCAAATCCCCTGCAGGCCTTAAGGGTCCTGAATGAGTTCCTGGCCGACAAGAGCTACATCGAGGGGTCAGTGTGGTAAATGCTATATTATAGTTGTGCTAATGTTCGAAAGGACAAGGAATGTGTAATATGAATGAACGTGTTGGCTTCCAACGCGTTCATTCATACCCGGGGATTCCCCTGGCCCCGGGGCGCCTCCAGCGCCCCATTGTGCAGCAAGAGCCCGGGCAAAGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGAC
  5   1   2       chi Neu  5g                        TNeu141d20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCATGTAAATTGCAGAGAGAATGTATCCCCCCAAGGCTTCCCTGGCATTTATTATTATTATTATTGTTTCTGTTTCCCTCTGTCAATGAGCTCCCCATCAGGTGAATGAGGGACCCATATACACTCATATACTAAATATCATTATCCTATTGCTCCAACAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCATCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTGTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTT
  5   1   2   12  bld Gas7 5g3  in                         XZG53211.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGCGCAGGGAGCACATCGCTACCGTCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAAGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGC
  5   1   2       bld Egg  5g                        TEgg097d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGCAGCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTC
  5   1   2       bld Neu  5g                        TNeu003a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGCAGCGCAGGGAGCACATCGCTACCGCCGGGCTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCC
  5   1   2       bld HdA  5g3  in                  THdA027g20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAATGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACGAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAAGTGT
  5   1   2       bld Neu  5g3  in                   TNeu079i04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTG
  5   1   2       bld Brn4 FL   in                         CAAL7726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCATCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTTAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCAT
  5   1   2       bld Gas  5g3  in                   TGas120d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTC
  5   1   2       bld Gas  5g3  in                   TGas126a02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTGGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAA
  5   1   2       bld Neu  5g                        TNeu141g07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACG
  5   1   2       bld Egg  5g                        TEgg144a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGAAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGGGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGG
  5   1   2       bld Gas  5g3  in                   TGas119a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGGAGCACATCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACG
  5   1   2   22  bld Gas7 5g                              XZG13575.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGNCGATGTAC
  5   1   2       bld Gas8      out                         st32j21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTACCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCATCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCANCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGGTAATTGTCTATTATTATTATTATTATTATTATTAACATTCATTTATGAAGAGCCAACATATCCCGCAGCGCTGTACAATAAGTGGGTTTCAAACACTG
  5   1   2   10 seed Spl1 5g3  in                        CABK11055.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGATTCGCCGGACTATGAGCAGCAACTAGCGCCGCCAGCGCCCCATTGTGCAGCAGGAGCCCGGGCAAGGCCTATGAAACGCGCAACCATGAGCGGGGTCCTGAAGCGCAAATACCAGGCGTTGGAAGAGGACTCCAACTACTCATCTTCCTCTGCGTCGCCGTCTTCTTCCCTGACGTCGTCGGGCAGCGACTCGGACGAGGATTACAGCCACGATGCCAAGCTCTTCATCACGGATTTTACCCCCACATCCATATTAAAGAAAGAGAAGCGCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTG
  5   1   2       bld Neu       in                   TNeu086c17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTTAAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTGAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGCGGATGTACA
  5   1   2       bld Gas7      in                         XZG56621.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTTTAGAAGAACAAGGTTTTGTTCGACCGGGTGGTGGTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAA
  5   1   2       bld Egg                            TEgg097k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTTTTACTTCCAGCGATGTCAGGGGTTCACCAGCGTCCCCAGCCGAGGCGGCTGCACGCTCGGAATGAAGCGAAGGCACAGCTACAGCAGGCAGTACACGTTGGAAGAGTTCTCCAAGGAGCAGCTGAGCCGGCGGAGGGAAAAACTGAAAGAGAGGTTAAAAGAGGAGAAACTCGAGTCTTTAAGGAACATGCTAACGTTGAATGGTACCATAGTGTCTCAAAAAGCCAACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAAGTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCTGGGATTAAGTGCCAGAGAGACCATTCGATGTTCCCTTGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAAC
  5   1   2       chi Gas       in                   TGas051i12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAAAGCCACAACCTCTCCATCGACGACATCTGCGACGAGGACATTGACATGAACGGCGCCGAAGTTGAAGACGGTTTCTCTCCGCGGATGTACCCACCCAGGGAACGGCGGGCTTTGCTCAAAAGGGAAGGTGTCAAGAAGATTGACAAATCGGAGAAACATGAGCTCAATGAGATCCGACGCTCCAGGGAAGACTGCGGCTGCAACTGTCAGGATTTTTGTGAGCCGGAGACCTGCAGCTGTACCATAGCCGGGATTAAGTGCCAGGTAAGGGCGGATCAGTTTGGTGGCTGTAGATCTACTCTAGCACTTAAGGTGTTTGCAGCCTCCTACAAATCTTTCCCTGCTCTTTGTTTCAGAGAGACCATTCGATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAATCCATTTGCGGGCGTGCCGGTGGGCAAAGGCTCGAGCGAGAGAGGGCTACCCCATTAACGCCGGCGT
  5   1   2       bld Gas       in                   TGas072l12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGTTCCCATGCGGATGTACAAAAGACGGTTGCGGCAACCGGAATGGAAGAGTGGAATTTAATTCATCCCGGGTTCAAACCCACTTCCTCCACACGGTCATGAGGCTGGAGCTGGAGGAGAAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAATCCATTTGCGGGCGTGCCGGTGGGCAAAGGCTCGAGCGAGGAGAGGGCTACCCCATTAACGCCGGCGTTTCAGTTCAGCATGGATATCGAAGTCGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACT
  5   1   2       bld Gas       in                   TGas053c23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGCATCAAAACAACGACCGCAAATTAGAAGCCGAGGATTCTGCGAACGAGCGGCTGAATCCATTTGCGGGCGTGCCGGTGGGCAAAGGCTCGAGCGAGGAGAGGGCTACCCCATTAACGCCGGCGTTTCAGTTCAGCATGGATATCGAAGTCGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCT
  5   1   2       bld Gas7      in                         XZG55064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGAAGTCGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTTCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAA
  5   1   2       bld Gas7                                 XZG12035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCGGGGACGACAGCTGCAGCAGCGACATGACCGATACCTCTTCTTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCCGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGNGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGA
  3   1   2       bld Brn4 FL   in                         CAAL7726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTATTTCAGGCGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTG
  3   1   2       bld Gas7 5g3  in                         XZG53211.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGTCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCCGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTATTTCAGGCGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTG
  3   1   2       bld Gas       in                    TGas072l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCAATCAGAGCGAAGACTCTGAAGAGCCATACGAAGCTGCTTCCTCGGATAAATCCCAGCTGGACGTCGACGACGACTACCTGGCGAGGATTCTTCATTTCAACGACTCCGAATACGAGGAGAATAGCAGTGACTGTCAGGATAACCTGAGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTTTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTAAGAAAGCATGTCTTTTGAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu056c15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTTTTTCCACCCGACAGATTTCTTTTGCGACAACGTTTACCAGCCAATCTCCGGCACGGACAAACCTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCCGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTTC
  5   1   2       bld Gas                            TGas030f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTTCCGGCCCCTACTCGAGCTCTTTCCCCAATGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGT
  3   1   2       bld Spl1 5g3  in                        CABK11055.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCGAGCTCTTTCCCCAAGTGCATCGATGATAATGCCAACCAAGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTAC
  3   1   2       bld Gas       ?                     TGas113c07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATGTTAGAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas119a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATGTTAGAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu079i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTTCTGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACNTTTATATGTATTTATGTTAGAAAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg                             TEgg048l15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTCTCCGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTGGTACAAATATACCATTGGAATACTTTTCGATGCTTTTAAAAGCAAACNTTTATATGTATTTATTGTTAGAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu086c17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCAAGTGCATCGATGATAATGCCAACCAGGACGCCAGCTGTTTTTCCGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATGTTAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu029d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGCGACGAGGTGGCATCTTTAACCACTTCTGATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTA
  3   1   2       bld Gas  5g3  in                    TGas120d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGGACCTTCTGACTATAGTTCCTCGCAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTTTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG55064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCGGAGTCGCACTCCAAGAGCTACACGGATATCAGCCTCTCCTCGGATTCCTTGGATTTGTTTCAGGTGTTCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTTCAAAAAAAAAAAAAAAGG
  3   1   2       bld HdA  5g3  in                   THdA027g20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTCCTTGGATTTGTTTCAGGTGTATCCAGACTACAATCTTGGACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTTTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTTTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATAATGCCGCCTCGCCCCCCCCGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTACAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas  5g3  in                    TGas126a02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCCCTTTACAACTCCTTGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTTCAAAAAAAAAAAAAAA
  3   1   2       bld Egg                             TEgg028n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGCCCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATAATGCCGCCTCGCCCCCCCTGCGTCGGATTGAAGAAAATACCCGCAATTTTTTTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTTACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas051i12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAATATGAAAATTTGGATAACTTATCCTTTCAGCTACCTACCTTCCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGCCCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTGGTACAAATATACCATTGGAATACTTTTCGACGCTTTAAAACAAACTTTATATGTATTT
  3   1   2       bld Gas7      in                         XZG56621.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTCAGCTACCTACCTTCCCCGGAATTGCTCCATCCGGAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAAGGGAAACGATGCCCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAAATAAAGGGGGGAAATTTCGGGTTTAAAAAAAATTCTATATATTGATAGGGGGATGGGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTGGTGGTGGTACAAATATACCATTGGAATACTTTTGGACGCTTTTAAAACAAACTTTATAGGTATTTATGGTTGGAAAACCAAAAAAAACAAAACCACCAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTTCC
  3   1   2       bld Neu       in                    TNeu056c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGACCAGACTACTTGCTTTCTGGAATCCTTAATTGGCCTGTCCGAGTCCTTTCCCGATACCTCCGTCCCTTTTACAGACGATTCAGCTTTTGGAAGATGCCTTCAAGTTCGTCTCTTAATGGAGAACGATGACTCGTCTAAAATGAGGAGAGGGGTGAAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAAATTCTATATATTGATATGGGGATGTGCGAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCGATTTTTTTTTTTTCCTATCCGAAAGACTTTGTACTTAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCGAACCTATTCTTGTGGTGGTACGAATATACCGTTGGAATACTTTTCGACGCGGCTGTTACGAACTTTATATGTATTTATTGTAGAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu                             TNeu066j21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTCCATTCCCGATACCCCCGTCCCTTTTACAGACAATCAGCTTTTGGAAGATGCCTTCAAGTCGTCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAGAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas072i15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTCGACGCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAAC
  3   1   2       bld Gas       in                    TGas072i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTTAATGGAAACGATGACCGTCTAAATGAGGAAGGGGTGAAAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCCCCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAAATTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCATTGGAATACTTTTGGACGCTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas053c23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAAAAAATAAATGGGGGAAATTTCTGGTTTAAAAAAAATTCTATATATTGATATGGGGATGTGCAAGGAACAATTCTCACCTTTTTTTCCAGTGGAGTTTTTTTTCTATAAAGACAATGCTTTTTGGAATACTGCCGCCTCGCTCTCCCCTGCGTCCGATTGAAGAAAATACCCGCAATTTTTTTTTTTTCCTATCCAAAAGACTTTGTACATAAGACGTTAAAGATGAATTTCTTTATTTATTTGTAGACCTTTGCAAACCTATTCTTGTGGTCGTACAAATATACCGTTGGAATACTTTTTCGACGCTTTTAAAACCAAACTTTATATGTATTTATTGT
  5   1   2       bld Tad5                                 XZT42391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATATACCATTGGAATACTTTTCGACGCCTTTTAAAACAAACTTTATATGTATTTATTGTTAGAAAAACAAAAAAAACAAAAACAACAGCAAAATCCGCAAATCACGAGTTGGTAGTGTGCACTACTCCCGTTTACAAAAAAAGAAAAATATACTTTTAACGGAATTTGTTGTTTTTTTTTTATAATTTATTGCAAAATTTAGGAAGGAGTCGAAAGCTTGAACTTTTTTTTTTTTTTTTTTATTATTACCCTTCTGAGCAGCGTAAGGAGTGGCCAAACTCCGCAGCTTCCAAAGGGTTAAATAATAAAAAAAAAAAACCTCAGATGAGTACAATCGTCTACTTTTTTTTTTCCCATAAAATTTCTGTATTTATAGACTTTTTTTTTTCGTTTCTACTAAAACTGAAACCTACACAGGAATCCTTGCCTCTTTGTTTCTAAAAAGTGCAATAAACAAAATCGCATTATAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)