Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012077063 Xt7.1-CABJ8861.3 - 21 ESTs
                                                                       ....-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ8861.3                                                                                                                             ATAATGAATTCACCATTGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCA
                                                  Xt7.1-CHK-1008230121                                                                                                                                   AATTCACCATTGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCACAGAAA
                                                      consensus depths                                                                                                                                  2     4     3     4     5     6     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    11     8    10     8    10     9    11     9    11     9    11     9    11    10    12     9    11     7    10     9    11    13    15    13    15    13    14    14    15    14    15    14    15    14    15    14    15    13    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    12    13    12    13    11    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     8     8
                                                                                            PROTEIN --- Ci ---- 1e-031     BAB00620.1 Not2 [Ciona intestinalis] ----------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Ce ---- 3e-035     NP_504890.1 serpin (srp-6) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Dm ---- 1e-049     NP_524953.1 Serine protease inhibitor 6 CG10913-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 4e-062     XP_797023.1 PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                  PROTEIN --- Br ---- 1e-068     CAD68157.1 serine protease inhibitor [Branchiostoma lanceolatum] ---=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Dr ---- 1e-075     NP_001002653.1 zgc:91981 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Mm ---- 5e-079     NP_035589.1 serine (or cysteine) proteinase inhibitor, clade B, member 8; serine proteaseinhibitor 8 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PREDICTED - Xt ---- 2e-080     AAH88021.1 Hypothetical LOC496899 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- ?? ---- 2e-080     Q5I0S8 Leukocyte elastase inhibitor [(unknown)]  =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Hs ---- 3e-081     NP_005015.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PREDICTED - Gg ---- 6e-084     XP_426040.1 PREDICTED: similar to heterochromatin-associated protein MENT [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- Xl ---- 1e-178     AAH82925.1 LOC494797 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ8861.3                                                                                                                                                                                                       ATG------ATG------------ATG------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATGATG------ATG------------ATG---------------------ATG------------------------------------------ATG------ATG------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------ATG------------------------------------TAA------ATG------------ATG---ATGTAA------------------------------TAA------------------------------------------------------------------------------------------------TGA------TAA------------------------------TAA------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAA
                                                                   ORF                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Limb                                CBSU1687.fwd                                                                         GAACAACAGCAGGAAGCAAGCAAGCTATTTCATCATGGATATATGTACAGCAAATAATGAATTCACCATTGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACTCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGA
  5   1   2       bld Limb PIPE in                        CBSU6211.fwd                                                                             ACAGCAGGAAGCAAGCAAGCTATTTCATCATGGATATATGTACAGCAAATAATGAATTCACCATTGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTCACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGG
  5   1   2       add Ski1      in                        CABJ12120.5p                                                                                                                CGATTCAATTCGGCACGAGGATTCACCATTGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGTACGTTACAAGAACAAATTATTTATTACCACATAATGGATAATAAGAAAACTAGTAACATTATGTATTTATTAAAGCTATTTAAGATATAATGACAGTTTCCACCAAGTCAAATTTCTAGTTTTGTGGATGCAACATCTCTTTCTCTAAACCTGGAGAATCTATGGGATGAATGCAACAGATGGAGACAGATATTCTTTCTCATGCATTTACAGGTATCATATTTGCCATAAATGCTCATTTATTATTACGGATGCAATTATGGTTTGTAGATTTATATAGGGGAATCCTGGAGCTACTGCCACCCTGAAGGTGGTGGTAATCACAGGCTTCACACTGCAGGCTGTATCAATGGGAGCATCAGACTTACCCCTAAAGAATTATGTGCAGATGCAATTTTAAGCCAAGCAGTATAAATGAGTCTTGAGAGTAATTGTGTCTGAATCATACAAATGTGCAACTGAACACAGCTGGAATTAGACTGGAATTGAATGCATAATGGGTAAAAAAACTTAGCAATTTGCATTTGTTCACTGCACTTGCCACACTAATGCACTTTATCACTTTAATGATATCCTGTGAGATAATACCACTCAGACTGCAACTTCTTAAAAAAACAAATGCAATAAATAAATAATTATCACACATCTATGTAAGGCTCAAAACCAGTATGTGTCATTGCATCTCCAACAAAGGGTCTTTTCTCCATACCAAAAATATGTTAGTA
  5   1   2       bld Ski1      in                        CABJ12101.5p                                                                                                                          CAAATAATGAATTCACCATTGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTC
  5   1   2       bld Ski1      in                         CABJ8861.5p                                                                                                                                             TGATGTTTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTNCAGANAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGT
  3  -1   2       bld Ski1      in                         CABJ1309.3p                                                                                                                                                   TTTAAGAGAAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGA
  5   1   2       bld Ski1      in                        CABJ11390.5p                                                                                                                                                           AAATCAGTAAAACTGCTGCTGGCCAAAATGTAGTATTTTCATCTATGAGCATCATGATTTCCCTGGCAATGGTGTACCTGGGAGCACACGGTAACACAGCAGCAGACATGGGTAAGGCTCTTCATTTTGATGAGGTTGAAGATGTACATGCTCAGTTCCGAGTACTTCTGAAAGAATTGATGAAAAATGGAAATGATTACACCCTAACCACTGTCAATAAACTGTTTGGTGAAAAAAAATACTACTTTCTTCCAACTTTTCTAAAAGCTATTAACGCTTTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTAAGCAAAGAACACAATACCTGGTATACTTGTAGGAACCTCATATACTGTAGCATGGATGCAACAATTAATATTCATATTTGAGGGGAAAACAATTAATTATCTGTAAATTCTTGGTAAAACATGCTGGGATTTTGTCTAACCCTGCAGAAAATGCTGGGTTCAGGCCATCACTCCTAAACAGTTTTTTATACTGCTAATGCAAAATTAACAGCATCATCTGCTGTCAGGTGACTCTTGTTTA
  3  -1   2       bld Ski1      in                         CABJ9179.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTATGGTGCGCCGCTGGAAAAGGTTGATTTCAGTTCAAACCCTGAAGCTACACGGAGCTACATTAATGCCTGGATTCAGGAGAAGACTAAAGGAAAGATCCAAAACCTGTTGCCTGAAAATTCTATATCACCGAATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTTATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAA
  5   1   2       bld Ski1      in                         CABJ6661.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACTGTTCTGATGGTTGCCAACACACTGTACTTTCTAGCAAATTGGACAACACAATTCAGTGAACACGCCACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTTCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATT
  5   1   2       bld Ski1      in                         CABJ1558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAGCAAGGCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAAT
  3   1   2       bld Limb PIPE in                        CBSU6211.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTCCTTTCACACTAATAACGAATGAACAAATCAAGGTAAATATGATGGCAACAATGAATACTTTTAATATGAAGAGGATAAAGAACCCTGGAATGAGTGTTCTTGAGCTTCCATATGGGGACACCAAAGACCTGAGTATGGTTATAATGCTACCTGATAACAGCACAGTTTTAACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATT
  3   1   2       bld Ski1      in                         CABJ8861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCAAGGTTGACAGGGAGATTTCATATGAAAACCTTAGCAAATGGACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTCCACAGAAAAAA
  3   1   2      seed Ski1      in                        CABJ12101.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTAGAAGTGAAAATATGAGTTCAAACTACCTAGCAGTGTACCTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCACAGAAAAAAA
  3   1   2       bld Ski1      in                        CABJ12120.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCCACGTTTCCGAATGGAGAAGAGTTTTTCTCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACA
  5  -1   2       bld Ski1      in                         CABJ9179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCAAGAAAGTTCTATCTTCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCC
  5  -1   2       bld Ski1      in                         CABJ1309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCACAG
  3   1   2       bld Ski1      in                         CABJ1558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTCCACAGAAAAAA
  3   1   2       bld Ski1      in                         CABJ6661.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTTAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCACAG
  3   1   2       bld Ski1      in                        CABJ11390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGGATGTCAAGTGCATTCAGTCAGAGCAGGGCCAATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCAC
  5   1   2       bld Ski1      in                        CABJ10665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCTCAGGAATGGGGAAACAGAAGCAGCTCTATGTATCTGATGTCCATCACAAAACATTCATTGAAGTGAATGAAAAAGGCACTGAAGCTGCCAGTGCTACTGGTTCTGTAATGTCAATCCGCAGCTTGGCAAATGAAGAATTTAAGGCAGACCGTCCTTTCCACTTTTTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                        CABJ10665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATAAGACACAACAAGACTAACTGCATACTGTTATATGGAAAATTCTACAGTCCTTAAAAATGTGAGATGGTGAAAGACAATACATTGTTTAGGAATCCAAACCAATAAACTTTAATGATCTATTTTTATATGAGCATGTAAATTTATCTTCTAAATAAAATACATAGATATTAACTTAAAGTACAGTTTTATGATTTAAAAAATATTTTGCACAAAAAAAAATTAAATGACATCAGCGATTTTCAGATCTTCCAGAAGACTAACCCCGCATGACTAACCTAAGGTGGAGCAGCAGCAGTCACATATAAACTCTAATTTCTTCTTTTTTGTCTCACATGGTTAAATCTGGGCTAATACTGGCAATACTGGCATCAAGGAAGCTTACAGAAAGTGGAATCCTGTTACTCTAGAAATCACCTAATAGTAAAACAAGTATCTCAAAGAACATTAACATTTACAAAACTGCGGACTTTACTGAAAAAGATTAGCAGAATTTTCCTTGTTTCCTTATTTTTCCTCTCATCTGTTACAACCTGCAAACCATTCTACTCAATTGCCTTTTTCATGTTGGTCTAAATAAAAGAACACATTTCCACAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)