Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK457.5                             7 END     4          16       66                Unknown (protein for MGC:122477) [Xenopus tropicalis]
     2   2.0    0Xt7.1-THdA053d04.5                          3 END     2           8       66                Unknown (protein for MGC:122477) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012077067 Xt7.1-CABI8616.3 - 24 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABI8616.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATAAGCTTGGCCGATGTCTGCCATTCAGAAGAACAAGAAGCCCATTGGTACAACCTTTTAAGTTACCGATATCTGAAGAGGCAATCCAAAACAAGCAAGCAGAAAATCAGTTGCTGTGAAGAAAGTGGTATTGAAAATCCAGATTCAGTGAGTGCCCTCCTTAAACAGACTGCTGCTGAATTAGAGGCTGTAAGGAAGCAGATTGGGGAAAGCACAGATCCGCCTGAATATATCTGGCCAGAAAAGAAGGATAATGTCCCGGATGAAGATGGCATTAGTGAGAATGAAGGAGAGGAAGAATTTGATGGAGATGTACAGTGTGAAACAGAAGAATCAGACATGCAGGCGGCTACAGATTCAGCCTCGGTAAAGGTGGACAAGGAGACAAACACAGAAGGCCTTGCAATGTCCTTATCTTCTGTTCGCCCAAAAGATAAAAGAGCAGCCACTCCTATGCAGGCGCCATTCATAAGAGGAAACACCATTATACGCTCTAAAACATTCTCTCCAGGACCACAAAGCCAGTATATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTCAAAAAAAAAA
                                                  Xt7.1-CHK-1008229401                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTTGGCCGATGTCTGCCATTCAGAAGAACAAGAAGCCCATTGGTACAACCTTTTAAGTTACCGATATCTGAAGAGGCAATCCAAAACAAGCAAGCAGAAAATCAGTTGCTGTGAAGAAAGTGGTATTGAAAATCCAGATTCAGTGAGTGCCCTCCTTAAACAGACTGCTGCTGAATTAGAGGCTGTAAGGAAGCAGATTGGGGAAAGCACAGATCCGCCTGAATATATCTGGCCAGAAAAGAAGGATAATGTCCCGGATGAAGATGGCATTAGTGAGAATGAAGGAGAGGAAGAATTTGATGGAGATGTACAGTGTGAAACAGAAGAATCAGACATGCAGGCGGCTACAGATTCAGCCTCGGTAAAGGTGGACAAGGAGACAAACACAGAAGGCCTTGCAATGTCCTTATCTTCTGTTCGCCCAAAAGATAAAAGAGCAGCCACTCCTATGCAGGCGCCATTCATAAGAGGAAACACCATTATACGCTCTAAAACATTCTCTCCAGGACCACAAAGCCAGTATATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTCAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     5     7     8     9     8     9     8     9     8     9     8     9     8     9     8    10     9    11    10    12    11    13    11    13    12    14    12    14    11    14    12    14    12    14    12    14    12    14    12    14    12    14    11    12    11    11    11    11    10    11    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    15    14    16    16    17    16    17    16    17    16    17    16    17    15    16    14    16    15    16    15    16    15    16    14    16    13    15    13    14    12    13    10    12     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     2     3
                                                                       ...PREDICTED - Sp ---- 7e-010     XP_780710.2 PREDICTED: similar to MGC79698 protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-024     NP_001034055.1 CG33967-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 6e-032     XP_694854.1 PREDICTED: similar to CG12600-PA [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                    PREDICTED - ?? ---- 1e-066     XP_689275.1 PREDICTED: similar to KIBRA protein [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 1e-113     NP_740749.1 hypothetical protein LOC211652 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-115     NP_056053.1 KIBRA protein [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-125     XP_414499.2 PREDICTED: similar to KIBRA protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 1e-178     AAH42930.1 Similar to cDNA sequence BC037006 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI36042.1 Unknown (protein for MGC:122477) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABI8616.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATGATG---------------------------------------------------------------------------------ATG---------------------ATG------------------------------TAATAA------TAA------------------------------------ATG---------------------------------------------------------------------------------------TAA---------TAA---------------------------------------------------------------------------------------------------TAG---------------TAA------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------ATG---TAA------------------------------------------------ATG---------ATG---------------TAA------------------------TAA---------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Te5       in                        CAAO11811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTAAATGGGTTTAAGCTGCTTGGGGGTGTCCAGTCTGAGTGTGGCCGGAGTGTCGGCTGCAGTGTCAGATGAATCTGTAACTGGGGACAGTGGAGTCTACGAGGCAACGAATCAGAGAACATTGATGGAAAATGCAGTGTTTGATGGTGAAGACTCAGAGATGATGGACACCGCCAAGATCAAAATAGGGATGAAGTATGATGAGAAAAACAAGCACTTTGCTGTATTTGTCATTCAGCTGGATAATTTGGCAGCTTTGTTACTGCATCAGAATGAAAAACTGTACATCCGTGTTGCAGTTCTCCCGTGTTCTGAAAGCACGAGTTGTTTGTTCCGGACAAGAACCTTGGAGCAGTCTGACACACTTCTCTATAATGAGATGTTTCTGGTTTCTACATCCCATTCTGCTTTACGCCAGAAGACCTTAAGGGTTGATGTGTGCACAAGACAAAGCAATCATCATGAAGAATGCCTGGGAGGATCACAAATAAGCTTGGCCGATGTCTGCCATTCAGAAGAACAAGAAGCCCATTGGTACAACCTTTTAAGTTACCGATATCTGAAGAGGCAATCCAAAACAAGCAAGCAGAAAATCAGTTGCTGTGAAGAAAGTGGTATTGAAAATCCAGATTCAGTGAGTGCCCTCCTTAAACAGACTGCTGCTGAATTAGAGGCTGTAAGGAAGCAGATTGGGGAAAGCACAGATCCGCCTGAATATATCTGGCCAGAAAAGAAGGATAATGTCCCGGATGAAGATGGCATTAGTGAGAATGAAGGAGAGGAAGAATTTGATGGAGATGTACAGTGGTGAACAG
  5   1   2       bld Ovi1      in                         CABI8616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCCTGTGCCTCATTTAATGACATTTTCTTCTCCTGCAGGGAGGATCACAAATAAGCTTGGCCGATGTCTGCCATTCAGAAGAACAAGAAGCCCATTGGTACAACCTTTTAAGTTACCGATATCTGAAGAGGCAATCCAAAACAAGCAAGCAGAAAATCAGTTGCTGTGAAGAAAGTGGTATTGAAAATCCAGATTCAGTGAGTGCCCTCCTTAAACAGACTGCTGCTGAATTAGAGGCTGTAAGGAAGCAGATTGGGGAAAGCACAGATCCACCTGAATATATCTGGCCAGAAAAGAAGGATAATGTCCCGGATGAAGATGGCATTAGTGAGAATGAAGGAGAGGAAGAAATGATGGAGATGTACAGTGTGAAACAGAAGAATCAGACATGCAGGCAGCTACAGATTCAGCCTCGGTAAAGGTGGACAAGGAGACAAACACAGAAGGCCTTGCAATGTCCTTATCTTCTGTTCGCCCAAAAGATAAAAGAGCAGCCACTCCTATGCAGGCGCCATTCATAAGAGGAAACACCATTATACGCTCTAAAACATTCTCTCCAGGACCACAAAGCCAGTATATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAAACTAAAGAACAGTTAGAGCAAAGCAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTC
  5   1   2       bld In63                            IMAGE:8957444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAGACTTGAATGAAAGAATTCACAAATAAAAAATCGCGTCTATGGCCGATGTCTGCCATTCAGAAGAACAAGAAGCCCATTGGTACAACCTTTTAAGTTACCGATATCTGAAGAGGCAATCCAAAACAAGCAAGCAGAAAATCAGTTGCTGTGAAGAAAGTGGTATTGAAAATCCAGATTCAGTGAGTGCCCTCCTTAAACAGACTGCTGCTGAATTAGAGGCTGTAAGGAAGCAGATTGGGGAAAGCACAGATCCGCCTGAATATATCTGGCCAGAAAAGAAGGATAATGTCCCGGATGAAGATGGCATTAGTGAGAATGAAGGAGAGGAAGAATTTGATGGAGATGTACAGTGTGAAACAGAAGAATCAGACATGCAGGCGGCTACAGATTCAGCCTCGGTAAAGGTGGACAAGGAGACAAACACAGAAGGCCTTGCAATGTCCTTATCTTCTGTTCGCCCAAAAGATAAAAGAGCAGCCACTCCTATGCAGGCGCCATTCATAAGAGGAAACACCATTATACGCTCTAAAACATTCTCTCCAGGACCACAAAGCCAGTATATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAGCTTCAAGGACATGCATCATCAGCTCACTCAGAGATCTCTGTACTAGGACTAAAGAACAGTAGAGCAGGCAAGCGCTGGTGAGATGACCTACTCAGCGATGAGGATGATGAGACATTTAGTTCTGCTCGACAAGTGGAGAAAACAGGTACGGA
  5   1   2       bld Neu                            TNeu140g15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAAATAAGCTTGGCCGATGTCTGCCATTCAGAAGAACAAGAAGCCCATTGGTACAACCTTTTAAGTTACCGATATCTGAAGAGGCAATCCAAAACAAGCAAGCAGAAAATCAGTTGCTGTGAAGAAAGTGGTATTGAAAATCCAGATTCAGTGAGTGCCCTCCTTAAACAGACTGCTGCTGAATTAGAGGCTGTAAGGAAGCAGATTGGGGAAAGCACAGATCCGCCTGAATATATCTGGCCAGAAAAGAAGGATAATGTCCCGGATGAAGATGGCATTAGTGAGAATGAAGGAGAGGAAGAATTTGATGGAGATGTACAGTGTGAAACAGAAGAATCAGACATGCAGGCGGCTACAGATTCAGCCTCGGTAAAGGTGGACAAGGAGACAAACACAGAAGGCCTTGCAATGTCCTTATCTTCTGTTCGCCCAAAAGATAAAAGAGCAGCCACTCCTATGCAGGCGCCATTCATAAGAGGAAACACCATTATACGCTCTAAAACATTCTCTCCAGGACCACAAAGCCAGTATATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGT
  5   1   2       bld Gas                            TGas056o02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGCAGATTCAGCCTCGGTAAAGGTGGACAAGGAGACAAACACAGAAGGCCTTGCAATGTCCTTATCTTCTGTTCGCCCAAAAGATAAAAGAGCAGCCACTCCTATGCAGGCGCCATTCATAAGAGGAAACACCATTATACGCTCTAAAACATTCTCTCCAGGACCACAAAGCCAGTATATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCT
  5   1   2       bld Ovi1      in                        CABI12908.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTGTCGTCTGAATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATNNGTGTGTGTTTGCNAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAATGCAATAAAAAAAAAAA
  3   1   2       bld Ovi1      in                        CABI12908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATCGTAGTGATAGTGAAAGTTCAACTCTATCTAAAAAGCCACCTTTTGTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAAT
  5  -1   2       bld Te4       out                        CAAN6934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCACCTTTTGTCAGGGACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTA
  3   1   2       bld Brn2      out                       CAAJ15086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTCAGAAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACT
  3   1   2       bld Te5       in                        CAAO11811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTAAAG
  3   1   2       bld Ovi1      in                         CABI8616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGAACGCAATGGAGAGACGCAGCGTGAGAGTCAAACGGCCATCTGTGAAGTCCACTGGCTCAGAGCGTCTCATTCGCACATCTCTGGACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAACCTCTCGCCCTATAG
  5   1   2       bld TpA       in                   TTpA024h03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATGCAAGCAGATAAGATGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATCTCATACTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACT
  3   1   2       bld Brn3 FL   out                         CAAK457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCTTGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTATGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTACGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACTTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGGTTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACT
  3   1   2       bld Te1       out                        CBWN6090.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAATTAGATCTACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAACTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAATACGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACTAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAAAA
  3   1   2       bld HdA       out                   THdA053d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAGCTTCAAGGACATGGCACCATCAGCTCACTCAAGAGATCTCTGTACTTAGGGAATTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGACGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAAAAAAGC
  3   1   2       bld HdA       out                   THdA032d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTCACTCAAGAGATCTTTGTACTTAGGGAATTAAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGACGAGACATTTAAGGTTCTGCTCAGACAAGTGGAGAAACAGGTACAGAAGATTGAGCAGAAGTATGAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAAAAAAAGCG
  3   1   2      seed Hrt1 5g3  out                        CAAQ9630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGATGCAAGCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTC
  3   1   2       bld TpA       in                    TTpA024h03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGATAAGATGATGAGAGCAGCAGCAAAAGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCATTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTTTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTATATTTTCAACCTCAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Kid1      in                         CABA5357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTC
  5   1   2       bld Kid1      in                         CABA5357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTTTTCACTCGACCAAGAATGAACCTACCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTTTGTTTTTCTGTTCTGAGCGCCACTGCAATGCAAAGTGCAGCCCGGTGCCTCGGAAATGTCATTGTGTGGTGTAATGAAGGTACAGAGTTTCATGTCCTTTTTTATTTTGGGTTGCAATAACCAGCACAGTAACACTGGCTTCAGGTACCACAACATCAGCGAACATTTTGTTTTTTTAGTCATTATTACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTC
  3   1   2       bld Gas7      in                         XZG63105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTCAAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas7      in                         XZG63105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAAAACCAGCATTCCTTTTCCAACTTTGTATAGCGTGTATATTTAGGGCTGTATTATCAGATAAACTGTTTGAAAGAGAATCAGATGTTGTTGTGTTTGCAAAGTATCATTTTGTACAGTCCGCTGCAGAGATTTAAAATGCAATAAAATTAAATTAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTCAAAAAAAAAAAAAAAAGG
  3  -1   2       bld Sto1      in                         CABG3509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTCAACCTCAAAAAAAAAAAAAAAAA
  5  -1   2       bld Sto1      in                         CABG3509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAAGAGACTTCTACTAAAAAAAAAAAAACCACAGGAATCCTTAGTACATATATTGTGCGCTTTATTAGATTCACACCACTTTGTGGCCATTAACTATTTTGTATCAGATGTTTTAGCAAACGCATTGGAGATCATACGTGTTGTATAGACATTTTTATGATATAATACAGTTTGAAATATATTTTGAAATGCACTTACCACATTGTGGTTTCGATGGAAAGATACATGGAAAAAAAAATCGATTAAAGTTACCAGTTTCTTATATTGGTCTAAAATATTAATGTGAAGAACGTTTAGTGGTGCATAGTTACGGTCGAATGGAATTTTCGTAATAAAAGCTTATTTTCAACCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)