Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas136n06.3.5                       95 END     1           2        1                (no blast hit)
     2   2.0    0Xt7.1-CABH11022.5.5                        25 END     1           2        4                Hypothetical protein MGC147501 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 353.0    0Xt7.1-CABC2006.3                           51 PI      74        426     1204                dystrophin (muscular dystrophy, Duchenne and Becker types) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012077081 Xt7.1-TGas143k02.3 - 36 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8    10     9    11     9    11     9    11     8    11     8    11     9    11     9    11     9    11     9    11     9    10     9    10    10    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10     9     9     9     9    10    10    10    10     9     9     9     9     8     9     8     9     7     9     6     8     4     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     7     7     7     7     7     7     7     7     7     7     7     7     9     9     8     8     9     9     9    10     8     9     8     9    10    11    10    11    10    12    10    12    11    13    11    13    12    13    12    13    14    15    14    16    14    16    16    17    16    17    16    17    16    17    18    19    18    19    17    19    16    18    16    18    16    18    16    18    16    18    16    18    16    19    16    18    16    18    15    17    16    18    16    18    16    18    16    18    16    18    17    17    17    17    15    16    16    16    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    10    13     9    11    10    11     9    10     7     8     5     7     5     7     3     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                               BLH ATG     158     560                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     143     306                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     158     570                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     158     165                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 3e-107     NP_492946.1 Dystrophin DYS-1 (417.4 kD) (dys-1) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Ci ==== 5e-124     CAA68087.1 dystrophin [Ciona intestinalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 2e-162     XP_683644.1 PREDICTED: similar to putative dystrophin [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-169     NP_001036727.1 dystrophin CG34157-PE, isoform E [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Br ==== 0          CAA68069.1 dystrophin-like protein [Branchiostoma lanceolatum] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 0          NP_999661.1 dystrophin-like protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_990630.1 dystrophin [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_031894.1 dystrophin, muscular dystrophy; Duchenne muscular dystrophy; DNA segment, Chr X,St. Mary's Hospital 9; DNA segment, Chr X, St. Mary's Hospital 7; X-linkedmuscular dystrophy [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 0          NP_004007.1 dystrophin Dp71b isoform [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAH82429.1 Unknown (protein for MGC:83347) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 0          NP_001084146.1 dystrophin [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          CAJ82628.1 dystrophin (muscular dystrophy, Duchenne and Becker types) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas143k02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------ATG---------------------ATG------------------ATG---------------------TGA------------------ATG------------------------------------------------------------------------------------------------------------TAG------------------------------ATG---------------------------------------------------------------------TAA------TAA------------------ATG------------------------------------------------------------------------TAA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Gas  5g                        TGas029g11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGTTCAATAGGTGGGAGGAGGAGCAGAGGCTGCTAGCACCACCCTGTCTAGCCTGCAGCTTTCCCTCCCCCAGATCTCCTTAGTCCTGTAGTGAGAGTATCACCGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGCCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTT
  5   1   2       bld Tbd0 FL                            IMAGE:6979993                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGTACGGCTCCGGATTCCCGGGATCTTAGTCCTGTAGTGAGAGTATCACCGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGCCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTTCAGCAGGTGGCAAGCTCCTCGGGATCTGTGACCACGGAACTGGGCCTGCTTTACATGATGCATTAATCCCCGACGCTGGAAAAGGGGCTCTTTGTCGGCATACTA
  5   1   2       bld Neu  5g                        TNeu142n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTAGTCCTGTAGTGAGAGTATCACCGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGCCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGT
  5   1   2       bld Brn3 FLsh in                        CAAK11346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGAGTATCACCGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGCCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTTACATGATGCAATTCAAATTCCCCGACAGCTGGGAGAAGTGGCCTCTTTTGGCGGCAGTAACATTGAACCCAGTGTCCGAAGCTGCTTTCAGTATGCTAATAACANACCAGAAATCGAAGCAGCTCTGTTTCTGGATTGGATGAGGCTGGAACCGCAGTTCATGGTGTGGCTGCCGGTGCTCCACAGAGTAGCTGCTGCTGAGACTGCCAAAC
  5   1   2       bld Gas  5g                       TGas083f11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGTATCACCGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGGCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCCTA
  5   1   2       bld Neu  5g                        TNeu012d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCACCGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGCCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTTACATGATGCAATTCAAATTCC
  5   1   2       bld Gas  5g                        TGas054h08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAGTGCTCTCCTCCCGCTGCCGCTACTGCCGCCGCCGCTGCTGTAGCCTGTGGAGCTGTGGCTGTGATTCAGTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCAGAGCCGGAATCGCTGCCTCTCTCTCTCCAGCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCA
  5   1   2       bld Neu  FL                        TNeu143c03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGGATTCATTGGCAGCCCTGTGAGTGCAGGAGCGTCTCCATCTCATAGCCGGAATCGCTGCCTCTCTCTCTCCATCCATGAGGGAGCTGCTGAAAGGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTATCTGACCTGAACAATGTGCGATTCTCATCATACAGAACTGCCATGAAGCTAAAGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAAGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAAGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTACATGATGCAATTCAAATTCCCCGACAGCTGGG
  5   1   2       bld Egg                            TEgg083h01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGATCCGTCAGTGATTTCTCATTTTCTAAGAATCTATTGCTGCTACAGGCGACCCATTTTTGATTCCTAGGCAGCACTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTTACATGATGCAATTCAAATTCCCC
  5   1   2       chi Egg                            TEgg117o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGCTCCTCTCCCGGCCGCCATATTGCCCCCCCCCCATTCCCGGGCCGTATTGCTGCTGTTATTGTGTCTGTGTGGGGGCCATGGAGGTGCAGGGTCTTCCAACTAGTACTTGGAACAAACGCATGACCCCAGTGCTGCTGTACCCGTGGATCTGCAAGAGTTGGCCCCGGGCTCCCTGGTGGTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCACCGGAGACTGGGCCTGCTTTTACATGATGCAATTCATATTCCCCGACAGCTGGGAGAAGTGGCCTCTTTTGGCGGCAGTAACATTGAACCCAGTGTCCGAAGCTGCTTTCCCTATGCTAATAACAAACCAGAAATCGAAGCAGCTCTGTTTCTGGATTGGAT
  5   1   2       bld Egg                            TEgg117o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCGCAGCCATGAGACACAAACCACCTGCTGGGATCATCCCAAAATGACAGAATTATACCAATCTTTAGCTGACCTGAACAATGTGCGATTCTCAGCATACAGAACTGCCATGAAGCTAAGGAGATTGCAAAAGGCCTTGTGCTTGGATTTGCTAGGGCTGTCTGCAGCTTGTGAAGCCTTGGACCAGCACAACCTGAAGCAGAATGACCAGCTGATGGACATCCTGCAGATTATTAATTGCTTGACCACAATTTATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTTACATG
  5   1   2       bld Gas       in                   TGas143k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGATCGACTGGAGCAAGAGCACAATAATCTGGTGAACGTTCCTCTCTGCGTGGACATGTGCCTCAACTGGCTGCTGAATGTTTATGACACGGGTCGAACGGGACGTATACGCGTCTTATCTTTTAAAACTGGTGTAATTTCCCTGTGTAAAGCACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTTACATGATGCAATTCAAATTCCCCGACAGCTGGGAGAAGTGGCCTCTTTTGGCGGCAGTAACATTGAACCCAGTGTCCGAAGCTGCTTTCAGTATGCTAATAACAAACCAGAAATCGAAGCAGCTCTGTTTCTGGATTGGATGAGGCTGGAACCGCAGTCAATGGTGTGGCTGCCGGTGCTCCACAGAGTAGCTGCTGCTGAGACTGCCAAACACCAAGCCAAGTGCAACATCTGCAAGGAGTGTCCGATTATTGGATTCAGGTACCGAAGTTTAAAGCACTTTAACTATGACATCTGCCAAAGCTGCTTCTTTTCTGGCCGAGTTGCAAAAGGTCACAAAATGCACTACCCAATGGTTGAATATTG
  5   1   2       bld TpA       out                  TTpA031h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACATTTGGAAGATAAGTACAGATACTTATTCAAGCAGGTGGCAAGCTCCACGGGATTCTGTGACCAGCGGAGACTGGGCCTGCTTTTACATGATGCAATTCAAATTCCCCGACAGCTGGGAGAAGTGGCCTCTTTTGGCGGCAGTAACATTGAACCCAGTGTCCGAAGCTGCTTTCAGTATGCTAATAACAAACCAGAAATCGAAGCAGCTCTGTTTCTGGATTGGATGAGGCTGGAACCGCAGTCAATGGTGTGGCTGCCGGTGCTCCACAGAGTAGCTGCTGCTGAGACTGCCAAACACCAAGCCAAGTGCAACATCTGCAAGGAGTGTCCGATTATTGGATTCAGGTACCGAAGTTTAAAGCACTTTAACTATGACATCTGCCAAAGCTGCTTCTTTTCTGGCCGAGTTGCAAAAGGTCACAAAATGCACTACCCAATGGTTGAATATTGCACGCCTACCACATCTGGAGAAGATGTTCGGGATTTTGCAAAAGTTTTGAAGAATAAATTCAGAACAAAAAGATACTTTGCTAAGCACCCAAGGATGGGATATTTGCCTGTTCAAACTGTCCTAGAAGGAGATAACATGGAAACTCCTGTTACTCTGATCAACTTCTGGCCAGTAGATTCTGCCCCAGCCTCATCTCCCCAGCTTTCACATGATGATACACATTCACGAATTGAACATTATGCTAGCAGGCTAGCAGAAATGGAAAATACCAATGGATCCTACCTAAACGATAGCATTTCACCTAATGAAAGCATAGATGACGAGCATTTGCTCATCCAGCACTACTG
  5   1   2       bld Ova1      in                         CABE7090.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAATCGAAGCAGCTCTGTTTCTGGATTGGATGAGGCTGGAACCGCAGTCAATGGTGTGGCTGCCGGTGCTCCACAGAGTAGCTGCTGCTGAGACTGCCAAACACCAAGCCAAGTGCAACATCTGCAAGGAGTGTCCGATTATTGGATTCAGGTACCGAAGTTTAAAGCACTTTAACTATGACATCTGCCAAAGCTGCTTCTTTTCTGGCCGAGTTGCAAAAGGTCACAAAATGCACTACCCAATGGTTGAATATTGCACGCCTACCACATCTGGAGAAGATGTTCGGGATTTTGCAAAAGTTTTGAAGAATAAATTCAGAACAAAAAGATACTTTGCTAAGCACCCAAGGATGGGATATTTGCCTGTTCAAACTGTCCTAGAAGGAGATAACATGGAAACTCCTGTTACTCTGATCAACTTCTGGCCAGTAGATTCTGCCCCAGCCTCATCTCCCCAGCTTTCACATGATGATACACATTCACGAATTGAACATTATGCTAGCAGGCTAGCAGAAATGGAAAATACCAATGGATCCTACCTAAACGATAGCATTTCACCTAATGAAAGCATAGATGACGAGCATTTGCTCATCCAGCACTACTGCCAAAGCTTGAACCAAGAATCCCCTCTGAGTCAGCCTCGCAGCCCTGCTCAGATTCTTATTTCTTTGGAGAGTGAGGAACGAGGAGAGCTTGAGAGGATCCTTGCTGACCTGGAAGAAGAAAACAAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCANCAGGGATTGTCTCCTCTGCCTTCTCCTCCCTGAATGATGCCATCCTCCCCAC
  5   1   2       bld Ski1                                 CABJ7185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCTGCCGGTGCTCCACAGAGTAGCTGCTGCTGAGACTGCCAAACACCAAGCCAAGTGCAACATCTGCAAGGAGTGTCCGATTATTGGATTCAGGTACCGAAGTTTAAAGCACTTTAACTATGACATCTGCCAAAGCTGCTTCTTTTCTGGCCGAGTTGCAAAAGGTCACAAAATGCACTACCCAATGGTTGAATATTGCACGCCTACCACATCTGGAGAAGATGTTCGGGATTTTGCAAAAGTTTTGAAGAATAAATTCAGAACAAAAAGATACTTTGCTAAGCACCCAAGGATGGGATATTTGCCTGTTCAAACTGTCCTAGAAGGAGATAACATGGAAACTCCTGTTACTCTGATCAACTTCTGGCCAGTAGATTCTGCCCCAGCCTCATCTCCCCAGCTTTCACATGATGATACACATTCACGAATTGAACATTATGCTAGCAGGCTAGCAGAAATGGAAAATACCAATGGATCCTACCTAAACGATAGCATTTCACCTAATGAAAGCATAGATGACGAGCATTTGCTCATCCAGCACTACTGCCAAAGCTTGAACCAAGAATCCCCTCTGAGTCAGCCTCGCAGCCCTGCTCAGATTCTTATTTCTTTGGAGAGTGAGGAACGAGGAGAGCTTGAGAGGATCCTTGCTGACCTGGAAGAAGAAAACAAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCACAAGGGATTGTCTCCTCTGCCTTCTCCTCCTGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTG
  5   1   2       bld Gas                            TGas017d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGGAAAATCCAATGGATCCTACCTAAACGATAGCATTTCACCTAATGAAAGCATAGATGACGAGCATTTGCTCATCCAGCACTACTGCCAAAGCTTGAACCAAGAATCCAGTCTGAGTCAGCCTCGCAGCCCTGCTCAGATTCTTATTTCTTTGGAGAGTGAGGAACGAGGAGAGCTTGAGAGGATCCTTGCTGACCTGGAAGAAGAAAACAAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCACAAGGGATTGTCTCCTCTGCCTTCTCCTCCTGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCA
  3   1   0       chi Kid1      out                        CABA8831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAACCACTTAATATGCATGACCAAGTCTTTTAGTCTGTATGAATATTAAACTGACAAAGGGCAAAACTGTGCATGAGAAGTAAATGTTAAATATGATTGGAACTTCATTATACTGAAATGATAATGCAGGAATGCAGATATTCTGTCATTATTGCATGTTGTGTCTAAAAACATTACTATCCAAGCACAGATCTTGGGGGGAGCACAGATTTACTGATGATGTTTGGTTAATACACATGGAACTAAATATCTTGTTGTTATTATTATTTGGGACAAATGCTATACCTAGCATTCAATGTTTAGGATGGAAATATAGAACCCAGTTATAATTTGACTGCTGTAACCTGCAAATAGAACTTTCTTTCACTTGTTTTCGTTTTAGCCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTAGGTCTTAAACATGAATGTTTTTTATACGGATATCATTGGCTTTTTTTTCCCTTCACCAACAAACTTTATGAATGCTGTGATATTAGAAATAATAACTTATTTTGTTATTCTTCAACAATGTTGAATTGTCTAAGATCTGCTGCTTTAAAAGAATATAAGTAAATACTCTCAGAAATAGTCAGAAATTAGCTTTAAACACATGCACTGTAGAAAATGATAGAAAATGTTTGATACTGCAGTGATGTAATTCGTAAGCCACTAACTCAACTAAGTATGTTAAAAATACAAAATAATTGTTTGTGTATGTATATATAATATATATTTATATAGCGAAACCCAGGGTGGCACTCAC
  3   1   2      seed Ova1      in                         CABE7090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAACAAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCACAAGGGATTGTCTCCTCTGCCTTCTCCTCCTGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTAAAAAAAAAAAAAA
  5   1   2       bld Egg0      in                         dad64f08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAACAAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCACAAGGGATTGTCTCCTCTGCCTTCTCCTCCTGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCATAAAGCATGTTTGAGGATGATCNCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGCGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTC
  5   1   2       bld Gas8      in                          st60h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCACAAGGGATTGTCTCCTCTGCCTTCTCCTCCTGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCANGTGTTTTTATATATTCTATTCGTACAACAA
  5   1   2       bld Gas8      in                          st61h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAATTTGCAGTCGGAATATGATAGATTGAAGGAGCAACATGATCACAAGGGATTGTCTCCTCTGCCTTCTCCTCCTGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTA
  3   1   2       bld Egg       ?                     TEgg042e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGATGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTTGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAATGCATGGGTGAGGGATGATCTCACTCAGCCCTCCTCATGACTCAAGACACAGTGCCTAGAAGTATGTGAATGGAACAGGCTAAGACAATTTCCTTCTCCAATCTGCAAAGAGGAACTCAATGTAGGCGAGCCTTTTCTCACATGGCATGACGACTTGGGCAGAGTCGATGGAAACCCTTAGTTACCTGTTAT
  3   1   2       bld Gas       in                    TGas143k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAATGATGCCATCCTCCCCACAGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATTACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAGTGTGCTTTATAAAATAAATGANCTTGTTTATAAAAAAATAACCCTTTGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5x3  out                   TTpA031h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGCCAGCGGGATGCTGAGCTCATTGCTGAAGCCAAGCTACTACGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAGTAAGCTTTATAAAATAAATGACTTGTTTATAAAAAAATAAAAAAAAAAAAAAAAAA
  3   1   2       chi Brn3 FLsh in                        CAAK11346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCCAGCACAAGGGGCGCTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAAGAAGTGTCCCTGGAAAGCAAATGAGAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAGTGTGCTTTATAAAATAAATGACTTGTTTATAAAAAAAAATAACCCTTTGGAAAAAAAAAAGAT
  3   1   2       bld Gas8      in                          st61h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCCAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGCGTTGNTAAAACNAATTTATNTCA
  3   1   2       bld Gas8      in                          st60h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCACAAGGGGCGCTTGGAAGCCAGGATGCAGATCTTAGAGGATCACAACAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTATAAGAAAGAT
  3   1   2       bld Brn3      out                       CAAK10540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGCCAGGATGCAGATCTTAGAGGATCTCAACAAACAATTAGAATCCCAGTTGCATCGGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCA
  5   1   2       bld Gas                            TGas033a04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGAAACAATTAGAATCCCAGTTGCATCGACTGAGACAGCTGCTGGAGCAACCGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTA
  3   1   2       bld Egg0      in                         dad64f08.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCAAGCAGAGGCAAAGGTGAATGGTACAACGTATTCTTCTCCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATTACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCTTTCTTTTTAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st55p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGAAGTAGGAGAAGAATACGTTGTACCATTCACCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATTACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAG
  5   1   2       bld Gas8      in                          st55p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGTTGTACCATTCACCTACTTCCTCGCTGCAGAGATCAGAGAGCAGCCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATTACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAG
  5   1   2       bld Neu  5x3  out                  TNeu108a07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGGTAACTAAAGTGTGCTTTATAAAATAAATGACTTGTTTATAAAAAAACAAAAAAAAA
  3   1   2       bld Neu       ?                     TNeu108o11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGCCTATGTTGCTTCGTGTAGTTGGCAGTCAGACATCAGAAAGCATGGGTGAGGATGATCTCCTCAGCCCTCCTCATGACTCAAGCACAGGCCTAGAAGATGTGATGGAACAGCTAAACAACTCCTTCCCAACTGCAAGAGGAACCAATGTAGGCAGCCTTTTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAGTTGGTTTATAAAATAAATGACTTGTTATAAAAAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       chi Brn2      out                       CAAJ14050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATTGGTTCGTCTATCATTTGCTTTCCAGGGACACTTCTTCCTCTTGCAGTTGGGAAGGAGTTGTTTAGCTGTTCCATCACATCTTCTAGGCCTGTGCTTGAGTCATGAGGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAGTGTGCTTTATAAAATAAATGACTTGTTTATAAAAAAATANACCCTTTGG
  5   1   2       bld Egg                            TEgg131a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCACATGGCAGACGACTTGGGCAGAGCGATGGAAACCTTAGTTACTGTTATGACCGATGACGAGGTGTTAGAGTGACCGTTCCAATCACGGCGCATGTGTTTTTATATATTCTATTCGTACAACAAAAGGGGATTAGACTGTAAGAGTTTACAAGAAAACATCTATTTTTGTGAAAGGGTAGTGGTACAATACTGTAGATTTCAGTAGTTTCTTAAGTCTGTTATTGTTTTGGTAACAATGGCAGGTTTTAAACGTCTATGCAATTGTACAAAAAACTATGAGAAAACTACATGTAAAATCTTAATAGCTTAAATAAAATAAAACTTGCCATTTCTTTTTATGGAGGGCAATTTTGGGTTGTTTAAAAAAATTTATATCAGTTATAAGAAAGATTGTAAACTAAAGTGTGCTTTATAAAATAAATGACTTG

In case of problems mail me! (