Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBST11946.3                          21 END     1           4        4                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012077082 Xt7.1-TEgg074c09.3 - 25 ESTs
                                                                       .....-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg074c09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCAGGGAGGGTGTGAGACACACACACACACACGTCTTTGCTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTAAAAAAAA
                                                  Xt7.1-CHK-1008229232                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGGGTGTGAGACACACACACACACACGTCTTTGCTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTAAAAAAAAGAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     6     6     7     7     7     7     8     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    11    12    11    13    11    13    11    13    10    13    11    13    11    13    11    13    11    13    11    13    11    12    12    12    12    12    12    12    12    12    12    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    13    15    15    15    15    18    18    17    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    18    18    16    16    15    15    15    15    16    16    16    16    16    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    14    15    14    15    13    14    12    13    12    13    12    13    12    12    12    12    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12     3     3
                                               BLH ATG     102     831                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      57     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 3e-008     BAA86200.1 nucleolin like protein CiRGG1 [Ciona intestinalis] ------------------==================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 9e-009     NP_014697.1 Gene whose overexpression suppresses the synthetic lethality of the hal3 sit4double mutation; Vhs3p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 1e-030     XP_688243.1 PREDICTED: similar to Wu:fc04g05 protein [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 8e-040     XP_787930.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ==== 5e-052     NP_504655.1 Short DumPY body and abnormal sensory rays DPY-11, membrane associatedthioredoxin-like protein (27.4 kD) (dpy-11) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 9e-057     NP_611838.1 CG5554-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ==== 1e-075     NP_001025330.1 hypothetical protein LOC561444 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 5e-077     NP_083424.1 thioredoxin domain containing 13 [Mus musculus] --====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Hs ---- 2e-078     NP_066979.2 hypothetical protein DJ971N18.2 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 3e-082     XP_415026.2 PREDICTED: similar to Txndc13-prov protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 4e-152     AAI08771.1 Unknown (protein for IMAGE:6859100) [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 0          AAI18715.1 Thioredoxin domain containing 13 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg074c09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TAG---TGA---------------------------ATG------------------------------TGA---ATG---TAG---------------------------------------------------TAG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Egg  FL                     TEgg074c09.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGGAATCCCCGGGGTGGTACAGAGCATCAGGGAGGGTGTGAGACACACACACACACACGTCTTTGCTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTAAAAAAAAAAAAAAAAAA
  0   1   1           Brn4 FL                         CAAL18385.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTTAAAAAAAAAAAAAAAA
  0   1   1           AbdN FL                     IMAGE:7005233.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Te5  5g3  in                         CAAO9888.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCGGGCACTGCCAACCAAAAGGCCCATACTGGAGAGGCTTATGCTTCAGTGCCGCCTCACCGCCCCCTGTGGTACAGAGCATCAGGGAGGGTGTGAGACACACACACACACGTCTTTGCTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGNGGCTCCTACGTCATCTTTGTTGT
  5   1   2   10  bld Te1  5g3  in                        CBWN17944.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCAGTGCCACCTCACCGCCCCCTGTGGTACAGAGCATCAGGGAGGGTGTGAGACACACACACACACACGTCTTTGCTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCT
  5   1   2       bld Egg  FL   in                  TEgg074c09.p1kSP6v                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATCCCCGGGGTGGTACAGAGCATCAGGGAGGGTGTGAGACACACACACACACACGTCTTTGCTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCG
  5   1   2   14  bld Brn4 5g3  in                         CAAL6160.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTACACTCCAGCAGCCTCCGCCCGCGGCACTTCCTGATACCGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCANAAGCAAAGTATGAAGTGATAAGAGAAGAA
  5   1   2   10  bld Spl2 5g3  in                        CBSS3396.fwd ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCANAAGCAAAGTATGAAGTGATAAGAGAAGAAGTANACGAAGAAGATTTGGCAAATGTAGAGGCAGA
  5   1   2       bld Brn4 FL   in                        CAAL18385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACGAGGTGTACCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGG
  5   1   2   10  bld Spl2 5g3  in                        CBSS2192.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAACATGGCAGCCTGTGTGCGGAGAGAAAGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCANAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGAC
  5   1   2       bld AbdN FL                            IMAGE:7005233                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGAGCCATGGTNGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGGAAAGGGAGCAGATAATGCTGCCCATGAAAGAGGCAGTGACAATGACAATGAANGAAGAAAATGGAGAAGAAATTAGCAATAGCCGTGGAAGATGACAGCGGAAAAAGAAAATAGCAAATGGAGGATGATAGGCGAAGAACAGCCATTGAAGATGTATGGATGAAAAAATGTTAATTGGATGGGTGAATGGCCAAACCAACGGCCCCAGA
  5   1   2       bld Eye                                  CCAX3805.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCGGAGCCATGGTGGAGCGCACACCGGCAGCTCCCTCACGGGCAGCCCTGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGGTGGGAGAGTTTTGGCAGAGAGGAGCCCATGCACCTTGGTGTAAAGGTTGGCAAAGTAGATGGTCACTGAAGAACCAGGCC
  5   1   2       bld Ski1      in                         CABJ4469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCCCTGGCTTCTTATAGCAGTAGTGCTGTGGGTGCCCGGGGAGTGCAGAGGTGCCCAGGCTGAGAGCGGGGTGAGAGCTGTCACTTCCACTAACTGGTCGGCACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGNCATGAAGATGATGATGAAGATGTAAGTGATGGTGATG
  5   1   2       bld Thy1      in                        CBST5030.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTGCTGGAGGGGGAGTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGAT
  5   1   2       bld Tbd1      in                         CBXT9097.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGGATGATTAAATTTTATGCTCCTTGGTGTCCAGCCTGCCAGCAAATTCAGTCAGCGTGGGAGAGTTTTGCAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAG
  5   1   2       bld Brn2                                CAAJ20395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGAGAGGAGCCATGCACTTGGTGTAAAGGTTGGCAAAGTAGATGTCACTGAAGAACCAGGCCTGAGTGGACGTTTTTTTGTTACAACGCTTCCAACAATATTTCACGCCAAGGATGGAGTATTTCGTAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGC
  3   1   2       bld Egg  FL   in                    TEgg074c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGATATCATGGCTCAAGAATGGTGGAAGACCTTCAGACCTTTCATCTCAGAAAAGAAGTGGGAGGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCCATCCATTCTGATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn4 FL   in                        CAAL18385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGTCTGGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAATTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTT
  3   1   2       bld Spl2 5g3  in                        CBSS3396.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGATGGCAAGTCTTTTTCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTANCAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTC
  3   1   2      seed Ski1      in                         CABJ4469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATT
  3   1   2       bld Brn4 5g3  in                         CAAL6160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGTCAGGATGGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTT
  3   1   2       bld Spl2 5g3  in                        CBSS2192.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGTCAGGATGGATGCGGCACTTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATT
  3   1   2       bld Thy1      in                        CBST5030.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATGCGGCAACTTCACAACTACTTTACAGGACCTCTGGGAATTCCAGCTTGGGGCTCNTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTT
  3   1   2       bld Te1  5g3  in                        CBWN17944.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTCTGGGAATTCCAGCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTATAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT9097.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTGGGGCTCCTACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTACAAAAAAAAAAAAAAA
  3   1   2       bld Te5  5g3  in                         CAAO9888.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGTCATCTTTGTTGTGGCCACATTGTTTATCGGCCTTCTACTGGGATTGATATTGGTGTTAATAGTTGATTGCTTTTGTCCATCAAAAGCAAAGTATGAAGTGATAAGAGAAGAAGTAAACGAAGAAGATTTGGCAAATGTAGAGGCAGACCCAAAAGTCTTACCTATGGAAAAGGAAGCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGATGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTT
  5   1   2       bld Gas7                                 XZG10964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGATAATGCTGCCAATGAAGAAGGCAGTGACAATGACAATGAAGAAGAAAATGGAGAAGAAATTAGCAATAGCAGTGAAGATGACAGCGAAAAAGAAAATAGCAATGAAGATGATAGCGAAGACAGCAATGAAGATGATGATGAAGATGTAAGTGATGGTGACGCAAACAACGCCCAGAATGTTGCCAAGGATTCTGATGAGGATTCTGCTGTTGCTGGGTCTGAAGCGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATTTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTAAAAAAAAGAAAAAAAAGGTTTAGTTGCTGCAATGAGTTATTATAGTGACCACAATCAGTATTGCAAGAGATTGTAGTTTTATTTTTGTTATGCTTTTCATTATGGTGCCTCCTTGATAAACTTTCCACTAGATAACATTAGAATAATATGTTGAAAAGTTACAGTTAAGGTGTAGCACTCCCCATAATGATTTGCCCTGTTCATTTTAGTTTTAGACCTGTAACTTCAAAAATGGAAATGCTGCTNTTGCATTTTTATTAGGGACGTGCNTAATCAAGTTTGGTCAAATATATTGTAGAGGATCGGGTATTTAG
  5   1   2       bld Te4       out                       CAAN12354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAAGAAGACAACATCACTGAAATGGCACCACAAAGCCCGCCAGAATCTGAAAGTGCCTTGAGACAGCGCAGAAGCGAGGCCACAGTGGATAACGGACACTAGACCTGACCATTCAGATGTCTTCATGGACCAAAGATGTGTGTAGACTATTTCTTGCTCAATGTCATTTGAAGCATGTTATAGCTATATTTTGCATGGATAGCTGTCCTTGTAAGACAGCATTTTCACAAAATCTAGTGCCAGGCAGGCATTTTTTTTGCAGTTTTTATTTAAAAAAAAAGAAAAAAAAGGTTTAGTCGCTGCAATGAGTTATTATAGTGACCACAATCAGTATTGCAAGAGATTGTAGTTTTATTTTTGTTAGGCTTTTCATTATGGTGCCTCTTTGATAAACTTTCCACTAGATAACATTAGAATAATATGTTGAAAAGTTACAGTTAAGGTGTAGCACTCCCCATAATGATTTGCCCTGTTCATTTTAGTTTTAGACCTGTAACTTCAAAAATGGAAATGCTGCTTTTGCATTTTAATTAGGGATGTGCTAAATCAAGTTTGGTAAAATATATTGTAGAGGATCCGGTATTTAGTTGAATCAAAAATGGATAGACTCACCTCATCCCTATTTTTTTTTTTTACATAATATGCTATTAGTTGTGGCTATGTTTTTTAATATCAAATGTATTCAAAAAATTAACAAGGTCTGTGTTTATGAATTTTATGCATGCTTATTATTTATAAGTTCTTCAAAGGTCTTTAACAAATGGGTCTGCTTCCTGCACAGCATTACAGAATTGCCTTTGAGCATCAGAACAGTTCCAAAGGGTTGGCAAACTGTATTACTCTTAGGCTAATGCCGCGTGGGACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)