Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ12618.3                          55 END     15         44       27                Neurotrophic tyrosine kinase, receptor, type 2 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABK3505.3                           41 END     1           2        2                guanine monophosphate synthetase [Homo sapiens]

 This cluster: approximate FL confidence score = 98%

 1012077129 Xt7.1-CAAJ18371.5.5 - 34 ESTs
                                                                       .....-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAJ18371.5.5                                                                                                                                                                                                                                                                                                                                                                    GAGTGCGGGAATATTGCAGCAGAGCTCCGATGTGAATAATAAGGCCACACGTGAAACGATGAGTCAGTGGGATATTTTCTACCTGATGAATATGGAAGTGTGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTA
                                                  Xt7.1-CHK-1008227487                                                                                                                                                                                                                                                                                                                                                                          GGGAATATTGCAGCAGAGCTCCGATGTGAATAATAAGGCCACACGTGAAACGATGAGTCAGTGGGATATTTTCTACCTGATGAATATGGAxGTGxGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGxxTxxTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACxxxxxATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                         2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     3     5     3     5     3     5     5     7     6    10     8    12     8    12     8    12     8    13    10    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    16    16    16    17    16    17    16    16    16    16    16    16    17    17    15    15    15    15    14    14    14    14    14    14    14    14    13    13    11    11     9    11    10    10     9    11     9    11     7    10     8     9     7     8     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     8     7    10     7    10     7    10     8    11    10    13    10    13    10    15    10    15    10    14    10    14    10    15    10    15    11    16    11    16    11    16    10    15    10    15     7    16     7    16     6    16     6    15     6    14     6    14     6    14     6    14     6    14     6    14     6    14     6    14     6    14     6    14     6    14     6    14     6    14     5    14     5    14     5    14     5    14     5    13     5    13     5    13     5    13     5    12     5    12     5    12     5    12     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     4    11     4    10     4    10     4    10     4    10     4    10     4    10     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     8     4     7     4     6     4     4     4     4     3     3
  5   1   2  SIG                                     Xt7.1-CAAN10894.5                                                                                                                                                                                                                                                                                                                                                                                                                        GCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCANACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGATTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACTGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTCCCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAJ18371.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTGTGTAAAAAAGCCAATATCGAAGACCGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCCGAGCACCATGGCTGTTTGCAACTGACAGCCCAACACATTTAAACAACCGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGGATGAGCTGCTTGGGCTGTAAATGCCACACATTTCTATTACCCTATGTTTGTTTCTTCCCTAACAGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATTATGAAACCACTTCCAATGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTAT
                                               BLH ATG     536    1645                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     527     156                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     536    1057                                                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI     140       8                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     536      93                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---= 4e-010     NP_523891.2 Peroxidasin CG12002-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 8e-012     NP_499897.1 leucine-rich repeats immunoglobulin-like domains (83.3 kD) (4B39) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-020     XP_793428.2 PREDICTED: similar to MGC140769 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bf ---- 3e-045     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 2e-078     XP_698789.1 PREDICTED: similar to BDNF/NT-3 growth factors receptor precursor (Neurotrophic tyrosine kinase receptor type 2) (TrkB tyrosine kinase) (GP145-TrkB) (Trk-B) [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 1e-138     NP_032771.1 neurotrophic tyrosine kinase, receptor, type 2 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 2e-138     NP_001007098.1 neurotrophic tyrosine kinase, receptor, type 2 isoform b precursor [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN -== Gg ==== 2e-150     NP_990562.1 tyrosine kinase receptor [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          AAH87462.1 Unknown (protein for MGC:99292) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 0          NP_001090267.1 neurotrophic tyrosine kinase, receptor, type 2 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          AAI23937.1 Neurotrophic tyrosine kinase, receptor, type 2 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAJ18371.5.5                                                                                                                                                                                                                                                                                                                                                                                                 ATGTGA------------------------TGA---------------------TGATGA------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------TGA---------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TAG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TGA---TGA------------------TAA---------------------------------------------ATG------TAA------TAA---------------------------------------------------------------------------ATG---ATG---------------TAA---------------------ATG------------------TAA------TAA---ATG------------------ATG---------------------TAGTGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2  SIG                                     Xt7.1-CAAN10894.5                                                                                                                                                                                                                                                                                                                                                                                                                        GCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCANACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGATTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACTGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTCCCAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008292430                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGATTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACTGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTCCCAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Te4       in                        CAAN10894.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCANACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACT
  5   1   2       ext Spl1      in                         CABK5149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGATTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGNGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTC
  5   1   2       ext Gas       in                   TGas120g18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCA
  5   1   3        nb Brn2      out                       CAAJ19218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCTTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGANACCACTTCCATGATNAT
  5   1   2       add Brn4      out                       CAAL11003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTCCATCCTCCGTGATAAGCAATGATGATGATTCAGCCAGTCCCCTCCATCATATTTCCAATGGCAGCAATACCCCATCTTCATCAGAAGGTGGTCCTGATACAGTAATCAT
  3   1   2       ext Spl1      in                         CABK5149.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACTGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTAC
  3   1   2       ext Gas       in                    TGas120g18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCNCCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGTTCTGACTTGGAGCAGTAGCTTTTTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Spl1      out                        CABK2641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACTGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTACAGT
  3   1   4      seed Te4       in                        CAAN10894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTT
  5   1   2  SIG                                     Xt7.1-CAAJ18371.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTGTGTAAAAAAGCCAATATCGAAGACCGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCCGAGCACCATGGCTGTTTGCAACTGACAGCCCAACACATTTAAACAACCGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTT
                                                  Xt7.1-CHK-1008292428                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAAAAAAGCCAATATCGAAGACCGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCxxxxxxCCATGGCTGTTTxxAxxxGACAGCCCAACACATTTAAACAACxGxxTTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTAC
  0   1   1           Brn3 FL                          CAAK7994.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTCCATCCTCCGTGATAAGCAATGATGATGATTCAGCCAGTCCCCTCCATCATATTTCCAATGGCAGCAATACCCCATCTTCATCAGAAGGTGGTCCTGATACAGTAATCATTGGCATGACCAAAATCCCTGTCATTGAAAATCCACAGTACTTTGGAATTACAAACAGCCATCTTAAATCTGACACATTTGTCCAGCACATAAAGAGACACAACATAGTCCTGAAGAGAGAGCTGGGAGAAGGAGCCTTTGGCAAAGTTTTTCTAGCAGAGTGTTACAACCTCTACCCTGAGCAAGATAAAATACTGGTTGCAGTAAAGACATTAAAAGATGCCAGTGACAATGCCCGAAAAGACTTTCATCGGGAAGCAGAGCTGCTCACAAATTTGCAACATGAGCATATTGTGAAGTTTTATGGTGTTTGTGTGGAAGGTGACCCGCTCATCATGGTCTTTGAATATATGAAGCATGGCGATCTTAACAAATTCCTTAGGGCCCATGGACCAGATGCAGTCCTCATGGCAGAAGGGAACCGTCCTGCTGAACTAACTCAGTCCCAGATGCTTCATATAGCACAACAGATTGCTGCAGGAATGGTGTACCTGGCTTCGCAGCACTTTGTACATCGAGATCTTGCAACGCGGAACTGTCTAGTTGGAGAAAACCTCTTGGTGAAGATTGGAGATTTTGGCATGTCAAGAGATGTGTACAGTACCGATTACTACAGGGTTGGTGGGCACACAATGCTGCCAATCCGCTGGATGCCCCCTGAGAGTATCATGTACAGGAAATTCACAACAGAAAGCGATGTTTGGAGTTTGGGAGTTGTATTATGGGAGATTTTCACTTATGGAAAACAGCCTTGGTATCAGCTTTCAAACAATGAGGTAATAGAGTGCATAACCCAAGGGAGAGTTCTCCAGCGTCCTCGCACGTGCCCGAAGGAAGTCTATGACCTCATGCTGGGTTGTTGGCAGAGGGAGCCTCATATGAGGCTTAATATCAAGGAAATACACAGCCTCCTTCAGAACTTGTCAAAAGCATCTCCTGTATACCTTGATATCCTTGGCTAAGAGATCAACGTGTTAGTTGTTCATGCTCGATAAATGAATGTGGTGAACTACTGCAGAACTCCATGAAATGTGTTATAACCTCTGACAGTATTATTGACAAAGATTCTGAGAAGCTTTCAAAGGGCAAGCTACATAAACTACTCCATTTCTACAATGCACAGTATTGACTATTTGCCATGACTATGTTGTATCTTTTTCTCCCAAGCTTATGTCTACTTTAGCATTGTTCCTACTCGCCTTCAGTTTTCCTTTGGTTCTCTCTTATATTACCCACCACTGTATGCTTCTGCCCTTACGTAATACAGAATAATTAGACAAAAGGCCTTAAAACCTTCTCTGTTAATCAGCAGGCAAGCATGTCTGTTTACCACATCTAACAATGCCTTGTATTTCCTGCCTTCGATGTGGATCAAAAAAAAAAAAAAA
  5   1   2   15  add Brn3 5g3  out                        CAAK4524.5p ........................................................................................................................................................................................................................................................................................................................................TGCTGCTAAGTTGTTGGGAAATGTGGGGAGTGCGGGAATATTGCAGCAGAGCTCCGATGTGAATAATAAGGCCACACGTGAAACGATGAGTCAGTGGGATATTTTCTACCTGATGAATATGGATGTGCGATGCATTGGACTAGCTCGGATCGACAGCTTCTGGGTCTGCCCCAGGGATGAGCTGCTTGGGCTGTAAATGCCACACATTTCTATTACCCTATGTTTGTTTCTTCCCTAACAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACAGCGATCATTGGCAAGTATCAATGATGACG
  5   1   2   15  ext Brn2 5g3  out                       CAAJ14436.5p ...........................................................................................................................................................................................................................................................................................................................................GAGAATTGGCTTGGAGTTTCTGCCCCTGCCCTGCGTCACTGCTCGCGTCACCGCTCCTTGCCCAGCTATTGGCATGGCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATATCGAAGACCGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTAT
  5   1   2   14  add Brn2 5g3  out                       CAAJ19888.5p ...............................................................................................................................................................................................................................................................................................................................................................TGGGGAGTGCGGGAATATTGCAGCAGAGCTCCGATGTGAATAATAAGGCCACACGTGAAACGATGAGTCAGTGGGATATTTTCTACCTGATGAATATGGATGTGCGATGCATTGGACTAGCTCGGATCGACAGCTTCTGGGTCTGCCCCAGGGATGAGCTGCTTGGGCTGTAAATGCCACACATTTCTATTACCCTATGTTTGTTTCTTCCCTAACAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTCAAGATTTACACTGCACTGAGAAATCTAACTGTGGTGGA
  5   1   2   14  ext Brn2 5g3  out                       CAAJ13545.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGTGTGTAAAAAAGCCAATATCGAAGACTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTA
  5   1   3   14   nb Brn2 5g3  out                       CAAJ19657.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTA
  5   1   3   14   nb Brn2 5g3  out                       CAAJ14091.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCCTCCGGCGGCCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTC
  5   1   3   14   nb Brn2 5g3  out                       CAAJ12766.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGTGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAAATAGCTGACATCTTTA
  5   1   2   14  add Brn2 5g3  out                       CAAJ23405.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGGGATGAGCTGCTTGGGCTGTAAATGCCACACATTTCTATTACCCTATGTTTGTTTCTTCCCTAACAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTTCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTAT
  5   1   4      seed BrSp 5g3  in                      EC2BBA8DC06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGCAGAGCCAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCCAGAAGCTTTT
  5   1   3   14   nb Brn2 5g3  out                       CAAJ18371.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCCAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGGCAA
  5   1   3        nb Brn3 FL   out                        CAAK7994.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACTCTCCATCTCTGTTTGTCTCTATCGGGCAGGAGCTGAAATCCCTGCAGCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACTCCAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCCTTTCAGTGCTCGTGCGATTTAATGTGG
  5   1   3   14   nb Brn3 5g3  out                        CAAK8862.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAAATCCCTGCAGCCCCCCCCCAGAAGGAGCAGCTGGGAGAGGGAATCAGCATCCTTTCTGTGCCGGACCTTCTGGGATCACATCACCAATAAAGCTGCACTGGTACTGAGGAGGCAGAAGAGGTGAGAAGCTTACAGTGAATGAGCCCTTTCTCCTACCTTTGCTTGCTCGCCAACGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTGAACCGACGCCTCGTCACTGACTCCCACAGATTCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCNCAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGGTAAAGTATTATTGGAGACTAATTCC
  5   1   3   14   nb Brn2 5g3  out                       CAAJ11164.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGGGGATCCCCTCTCCATTCTAGGGGGATCCACTGGACCGGAGATCCACCATGCGCCTCTGGAAAGGCTCCCACGGACCTGATTTAACTCAGGTGTGCGGCGCTCTATGGATCCTACTTGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGCAACTCCACCAGGATTTGGTGCACTTTAGAGGGCAAAGGGATTGTGGCTTTCCCGGTGCTGGAGGACAGCGCACTGGCGGAGAACATTACTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCTTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATT
  3   1   3        nb HeRe                             EC2CAA32DC10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGACAGCGCACGAGCGGAGAACATTAATGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATAATCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCT
  5   1   2       ext AbdN                               IMAGE:7022802                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGACATTTATATTGCAAACCAGCGATCATTGGCAAGTATCAATGATGACGATGTAAAGATTTACACTGGACTGAGAAATCTAACTGTGGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCAGCAAGAACCCTAAACTTACATACATAAACTTCTCCAAAAATAAGCTGACATCTTTACCCAAGAAGCTTTTTCGTCATCTAACTTTATCTCAGCTATTTCTAGGTGGCAATCCTTTCCAGTGCTCGTGCGATTTAATGTGGGTTAAAGTATTATTGGAGACTAATTCCCTAAATCAGAACCAGAACATATACTGCTTCAATGACAACAAAAAGAAGATACCTCTCTTCACTATGCACATCCCCAACTGTGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGGTTCATGAAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAAACAAGTAACATACAAGCGAGCACCAGGGCTGTTTGCAACTGGGA
  5   1   2       add AbdN      in                       IMAGE:6998733                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTTGAAATCTCAGCCTCCCTACAGCTCTGATCTGAAGTAAAATAAAAATGCACTGTTACAATCGTAATAGACAATTTTCTATTACATGCAATAGGTATAGTGCCACATCGTAATTTATCTCCAGAAGGTATCTTCCATAATGGATTGCATTTTCCAGGTGGATATACAGAGGGTTGCCTATAGTAAATGTGAGTACATTAAATATCACAGTTCTTGAAGGTAATGAGACAACCTTGTTCTGCGATGCCAATGGACTCCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCCATAGCGCTCTTTTCATGGAACGTCCAGACGAATGGTATGATCCGATTACTGACCCNTGATTTATGATATGAAACACTTCN
  5   1   2       ext Spl2      in                        CBSS6110.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGACCCAAATGTTTCCTGGGATATCTCACAGATCATTTCAAAAAGCTTGAAAGAAACTACAAAGCGTCCAGCCTTGCTTACCCTGAAAAATGTAACATCGATGGACAACAAAAGAGTCATTGTATGTGTGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCC
  5   1   3        nb Brn4      in                        CAAL21415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGCAGAAAACAGCGTGGGTGAAGATCAAGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGNGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGC
  5   1   3        nb BrSp      in                     EC2BBA19BE01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTCTCTGTGGAACTCAATGTACACTTTCCCCCAGTGATCACTTTTATTGACTTGCCAACACTGGACCATCATTGGTGCATACCTTTCAGTGTGAGGGGTAATCCGAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCT
  3   1   4      seed BrSp 5g3  in                      EC2BBA8DC06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCCTACACTGCAATGGTTCCATGAAGGGAGTATGCTCAGTGAAACAGATTTCATTTGGAGCAAGATTCATGAAACAAGTAACAATACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTAT
  3   1   2       add AbdN      in                       IMAGE:6998733                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATTTGAGCAGATTCATGTAACAGTAAACTATACAGNCGAGCATCATGGCTGTTGCTAACTGGACAGCTCACACATTTGAGACACTGGATTTTATACATTNCGGGCTGAGACATATACTGGAAGGGATGAACGATCCATAAGCGCTCTTNTCATGGAACGTCCAGACGATGGTAATGATCCGATTACTGACCCTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACTGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTGAACTACCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATATGAATGTGTTTTTCTGTTCTGTGGTTCTAGGCAGGAATCCGACCATACCCCACACCCAACTT
  3   1   3        nb BrSp      in                     EC2BBA19BE01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACAAGCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGT
  3   1   3        nb Brn4      in                        CAAL21415.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGAGCACCATGGCTGTTTGCAACTGGACAGCCCAACACATTTAAACAACGGATTTTATACATAAGGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTACAGT
  3   1   2       ext Spl2      in                        CBSS6110.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGGATTTTATACATTAAGGGCTGAGAACAAATATGGAAGGGATGAACGATCCATAAGCGCTCTTTTCATGGAACGTCCAGACGATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTTTTGTTTTGTTTCATTCGGTTTCTCTGGATGGGTAGGTGACCTAAGCCCAGAGGCAGAAAGAGGCTCTGACTTGGAGCAGTAGCTTTCTGAACTAGTGCATCCTGGGAGTGGAATACAGTGTCTTTGACTATGACCTTATTTTTGTCGCATATAAGCTTCCTGGGACAACCTGTTATTGACCTGTATTTGGTACATATTAATGTACAGTTAATGGACATAACAGACTTATTTTGAAACTAACTCCCACTCTGTGCCTTAATTCAATGCTGATGTGTCAAAAAGTAAAATAAAACGTGAAAACATATTACAGGATGTTACAGTACTATCAAACATAACAAAACTAAAACATGCAATATCATTTTATTTTAATGTGTTTTTCTGTTCTGTGGTTCTAGTGAAGTTATTTATTGTTGTATTGTGCTTTAATAAATGATCATTTACTTACAGT
  5   1   2       add Te1       out                        CBWN7519.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGGATTTTATGATTATGAAACCACTTCCAATGATATTGGTGGAACAAGTACAGATATTGGAACAGGCGTCACTTCTACAGATGTTTCTAAAGAAGGAAATGAAGACAGTATTACTGTTTATGTCGTAGTGGGCATTGCAGCATTAGTTTGTACCGGCCTGGTAATAATGCTGATCATCCTAAAATTTGGAAGACACTCCAAGTTTGGGCTGAAGGGTCCATCCTCCGTGATAAGCAATGATGATGATTCAGCCAGTCCCCTCCATCATATTTCCAATGGCAGCAATACCCCATCTTCATCAGAAGGTGGTCCTGATACAGTAATCATTGGCATGACCAAAATCCCTGTCATTGAAAATCCACAGTACTTTGGAATTACAAACAGCCATCTTAAATCTGACACATTTGTCCAGCACATAAAGAGACACAACATAGTCCTGAAGAGAGAGCTGGGAGAAGGAGCCTTTGGCAAAGTTTTTCTAGCAGAGTGTTACAACCTCTACCCTGAGCAAGATAAAATACTGGTTGCAGTAAAGACATTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)