Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012077223 Xt7.1-TNeu104d22.3.5 - 44 ESTs
                                                                       ...-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu104d22.3.5                                  GGGAGAAGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAACCCAGTGTCCTGTCGCCCCCTAACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226322                                        AGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGxTxxxCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAxxCxxGTGTCCTGTCGCCCCCTAxxxxxxCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCxxxxGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAA
                                                      consensus depths                                       2     2     2     2     3     3     4     4     4     4     9    10     8    10    10    12    12    15    15    15    15    15    16    16    17    17    17    17    16    17    17    18    17    18    16    17    17    18    17    18    16    17    17    17    17    17    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    16    16    16    17    16    17    17    18    17    18    16    17    18    18    18    18    18    18    18    18    18    18    17    17    17    17    18    18    18    18    16    16    14    14    14    14    14    14    14    14    14    14    13    13    13    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    14    15    14    16    12    15    12    15    10    15    10    15    10    15     8    13     7    12     7    12     6    11     6    11     6    10     4     8     4     8     4     8     3     7     3     7     2     7     2     6     2     6     2     6     2     6     2     5     1     3     2     4     2     4     2     4     1     3     1     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     5     4     8     5     9     7     9     6     9     7     9     8    11     8    12     8    12    10    14    10    14    10    16    10    16    10    16    10    16    10    16    10    17    10    17    10    17    12    18    12    18    12    19    12    19    12    20    12    20    13    21    13    21    13    21    13    21    13    21    12    19    12    19    12    19    12    19    12    19    12    19    13    20    13    20    13    20    12    19    12    19    12    19    12    19    12    19    12    19    12    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     9    19     8    18     8    18     8    18     8    18     6    17     6    16     5    14     5    14     2     6     3     3
  5   1   2  SIG                                    Xt7.1-TGas122j12.3                                  GGGAGAAGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAACAAAAAAAAA
  5   1   2  SIG                                  Xt7.1-EC2BBA21CA09.3                                                                   GGGAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATCCTGCGTAATGTGAAGGAGAAAAAGCTGGAGAAGAAGAAGATGAATGAGCAGGAACAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCAATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATCTGTACTGTTCTACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCCGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATAGCCATTTTTTTTTTTACTGCCTCTCCTTATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAAAATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTTTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCCCTGAACGAAACAAGGAAGGGCCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTGTAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu104d22.3                                                                                   GTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                          ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------G-----
                                               BLH ATG     127     721                                  
                                               BLH MIN     124     102                                  
                                               BLH MPR     118     102                                  
                                               BLH OVR     127      22                                  
                                               CDS MIN     127      15                                  
                                               EST CLI      48      15                                  
                                               ORF LNG     127       1                                  
                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 3e-081     XP_785243.2 PREDICTED: similar to LOC495507 protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PREDICTED = Dr ==== 8e-110     XP_687446.1 PREDICTED: similar to CXYorf1-related protein isoform 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PROTEIN --- Hs ---- 4e-113     NP_945181.1 CXYorf1-related protein [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PREDICTED - Mm ---- 5e-114     NP_081109.1 hypothetical protein LOC68767 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PROTEIN === Gg ==== 2e-116     NP_001006245.1 similar to CXYorf1-related protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PROTEIN === Xl ==== 1e-149     AAH85201.1 LOC495507 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PREDICTED = ?? ==== 1e-149     NP_001088612.1 hypothetical protein LOC495507 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PROTEIN === Xt ==== 5e-157     CAJ83032.1 novel protein [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu104d22.3.5                                                           ATGTGA------------------------------------------TGA---------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATGTGA------------TAG------------TGA------------------------------------------TGA---------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------TGA------------------------------------TAG---------------------------TAG---------------------------------------------------------------------------------TGA---------------------------------------TAG------TGA---------------------------------------------------------------------------------------------------TAG---------TAG---------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2  SIG                                    Xt7.1-TGas122j12.3                                  GGGAGAAGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAACAAAAAAAAA
                                                  Xt7.1-CHK-1008289988                                        AGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGCATGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAACAAAAAAAAAAAAAAA
  5   1   2   14  ext Te5  5g3  in                          CAAO668.5p .................................GGGAGAAGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTC
  5   1   4      seed Gas  5g3  in                   TGas122j12.p1kSP6                                                  ATCCCCGGGATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATG
  3  -1   2       ext Int1      in                        CAAP14163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCGAGAGGCGGCCCCGGAACACCTTCGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCA
  3   1   4      seed Gas  5g3  in                   TGas122j12.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGGGCATGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAACAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ova1      in                         CABE4459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCACAGGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATAT
  5   1   3        nb Ova1      in                         CABE4459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAA
  5  -1   2       ext Int1      in                        CAAP14163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTTTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGGGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTATTTTT
  3   1   2       ext Te5  5g3  in                          CAAO668.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACNCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATT
  5   1   2  SIG                                  Xt7.1-EC2BBA21CA09.3                                                                   GGGAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATCCTGCGTAATGTGAAGGAGAAAAAGCTGGAGAAGAAGAAGATGAATGAGCAGGAACAAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCAATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATCTGTACTGTTCTACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCCGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATAGCCATTTTTTTTTTTACTGCCTCTCCTTATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAAAATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTTTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCCCTGAACGAAACAAGGAAGGGCCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTGTAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008289994                                                                         TGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATCCTGCGTAATGTGAAGGAGAAAAAGCTGGAGAAGAAGAAGATGAATGAGCAGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACAAGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCAATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATCTGTACTGTTCTACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCCGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATAGCCATTTTTTTTTTTACTGCCTCTCCTTATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAAAATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTTTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCCCTGAACGAAACAAGGAAGGGCCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTGTAAAAAAAAAAAAA
  5   1   4      seed BrSp 5g3  in                     EC2BBA21CA09.g1                                                                   GGGAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATCCTGCGTAATGTGAAGGAGAAAAAGCTGGAGAAGAAGAAGATGAATGAGCAGGAACAAGTGCGAG
  3   1   4      seed BrSp 5g3  in                     EC2BBA21CA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAACAAGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCAATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATCTGTACTGTTCTACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCCGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATAGCCATTTTTTTTTTTACTGCCTCTCCTTATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAAAATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGCCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATG
  5   1   2       ext BrSp      in                    EC1CBA002ZD01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATCTGTACTGTTCTACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCCGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATAGCCATTTTTTTTTACTGCCTCTCCTTATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAAAATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGCCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATG
  3   1   2       ext BrSp      in                    EC1CBA002ZD01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAAATCCGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATAGCCATTTTTTTTTACTGCCTCTCCTTATTAGCCCTGGGAATAGGCAGGTATTTATCCCTGTGATAAAATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTTTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCCCTGAACGAAACAAGGAAGGGCCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTGTAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu104d22.3                                                                                   GTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAA
                                                  Xt7.1-CHK-1008289996                                                                                         AAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGxxTxCxAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAxxCxAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu121a17.FL-Sanger                                                                                                AGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAAA
  0   1   1           Ovi1 FL                          CABI9074.FL-MGC                                                                                                                                CGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAA
  0   1   1           Neu0 FLt5                   IMAGE:6994149.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   22  ext Gas7 5g                              XZG12617.5p GAAGTGACTGGCTATGAGTGGGCGCGGCCAGCTGGGAGAAGAAGTATTGTGGCTGGTCATGTGACGGTCAGATGACCGAGGAGTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGTTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTATTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCAC
  5   1   0       chi Tbd0 5x                            IMAGE:6978388                                                                                  GATCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGCTCCAGTGCGGTGGGCTTGCCCAGCAAGGGTGGCGGATACCATGCCACATAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGAAACAGCCAGACCTGCGCAGGGAGGAGGCCATACATCATATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAAAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACAGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCATGAAACACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCTAGATGAAGAGAGCGCACAACAATGGTTGGGCATCCTCACGATATACATTGCCTCTGGCAACTCCGTGCTCCGTTTCTACAAAGTAGAGAATCGCCTGACTAACTCGTGTTATCCGACCTGATTGTGGGTACTCTTTGTTACCCAGCAGAATGAAAATGTGCGTGAATCAAGGAAAATTGTGCTATGTTGCCTGACATTGAAAGAAATGGCACACTGATCATCCCTCCTGGAAAGATTAGAATACCGATGCCAAGTTCCCTTGTN
  5   1   2   12  ext Gas7 5g3  in                         XZG47421.5p ..................................................................................GTCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCT
  5   1   0       chi Brn3      in                         CAAK2698.5p                                                                                    TCAGGAAGAGAGAGAGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTAATCGCTCTCACCGACCCCCTTGTACCTTTTAACCCTATGTTCTTGAACCATTTATGTCTGGCTTTAACCTGTACGTATCCCAGTACATGAACCCATTTGGTCCCCTTTAGGGCGAAGACACTCGGGGTGATTTGTCGCCGCAACTTCACCCTTAAAGATGGAGTAGCCATTAAAATTAACTGTTTACTATGCTATTCACCCTAGCAACTGTCACCAGGGTCGAACTGGGGGGTGCAGGGCCCACCGGGGCTCCCGCCCCAGGGCCACTGCAGGTACCCCCGCCGGCCCTGTCTCCTAACAGGGC
  5   1   3   22   nb Gas7 5g                              XZG52094.5p ....................................................................................CAGGAAGAGAGAGCGACGGGGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGATCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTTAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCT
  5   1   3        nb Neu  5g3  in                   TNeu127d23.p1cSP6                                                                                        GAAGAGAGAGAGACGGGGGCTGAAAGGCCAGTGGTCCGGCCGCGGTGGGCTTGCCCCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTGTGCGGTGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTGTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAAGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCG
  5   1   2       ext Neu  FL   in                   TNeu121a17.p1cSP6                                                                                              AGAGACGGGTGCTGAAAGGCCAGTGGTCCGGTGCGGTGGGCGTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGC
  5   1   3   22   nb Gas7 5g                              XZG12182.5p ...........................................................................................................TGAAGGCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGC
  5   1   3   14   nb Brn2 5g3  in                         CAAJ6322.5p ................................................................................................................GCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGTTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTATTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCA
  5   1   2   10  add Liv1 5g3  in                         CAAR1136.5p ................................................................................................................GCCAGTGGTCCGGTGCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTGTAAGTCCATAAGGATAATGAATGTATTAAACCAAGTGATGCCTGGGGTACATTGGCACTGCCCTGTAGAATAGGTTGATGAATCTCCAAATGGTTGGTGGCTTTGGTTCCTGGAACTGGGAATGTGGTTGGAACATGGGAGAGGGGGGCTCAGGGCTTGGGAGTGGTGTACTACTTACTGAGATGGACCTTAGAAATGGTTCTCTATAGGAAGGTGTAGGGATCTGGT
  5   1   2       ext Ovi1 FL   in                         CABI9074.5p                                                                                                                       CATCGATTCGCGGTGGGCTTGCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCAC
  5   1   4      seed Lun1      in                         CABD9087.5p                                                                                                                               GCGGTGGGCTTGCCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCAACCTTCATC
  5   1   2       ext Spl1      in                          CABK679.5p                                                                                                                                           CCCAGCAGGGGTGGCGGATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGC
  5   1   2   10  add Thy1 5g3  in                        CBST6014.fwd ...........................................................................................................................................................ATACGATGCCACAGAATCGTTCAATGGAGAGCCAGGCTTATTCCCTTCCCCTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACCTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATCAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGT
  3   1   2       ext Spl1      in                          CABK679.3p                                                                                                                                                                                                      CCCTTCCCNTGATACTGCCAGACCTGCGCAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAACACNTGCAGACTGTATCCAATGACATATTCAGCAGGATTCTGCAGAGGGTGGAGACCAACAGAGGCCAACTACAGAGAATCAATGGCCGACTGAGCCTTGCGCAAGCAAAGATAGAACGACTCAAAGGCATTAAGAAAGCCATTAAGGTGTTTTCCAGCGCTAAGTACCCGGCCCCGGAACACCTTCAGGAATACAGTTCCGTGTTTGCTGGTGCTGAAGACGGCTGGTTGGCAAAAAAGCTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTC
  5   1   0       chi Tad5      in                         XZT30312.5p                                                                                                                                                                                                                                                                                                                                                                                   CCTTGCTCCTTTTCAACACAACAGAGAATCTGTAAGTCCATAAGGATAATGAATGTATTAAACCAAGTGATGCCTGGGGTACATTGGCACTGCCCTGTAGAATAGGTTGATGAATCTCCAAATGGTTGGTGGCTTTGGTTCCTGGAACTGGGAATGTGGTTGGAACATGGGAGAGGGGGGCTCAGGGCTTGGGAGTGGTGTACTACTTACTGAGATGGACCTTAGAAATGGTTCTCTATAGGAAGGTGTAGGGATCTGGTACCACAAATGGTGGAATATGATCAAGGTCAATCAAAGTCCTCTCATTGTATCACCCCTATTAACAGCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGGTAAGGCAGTTGGTCACTTGATGTTCCAAAAGGCGAACTCCGGTTAACATAGACAACTCCTTTCCCTTTAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGTTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCT
  5   1   2       add In62                            IMAGE:8952966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAGTTTCATTAACGGATAAGATCGCATTCGAATTCGTCCCGGCTGGTTGGCAAAAAAGTTGCGGCACAAAATCCAGAGTAAGCACCGACCACTGGATGAGCAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGGCAAGATGAGGAGAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAGTTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAGAAGTACGTGTTCCTTGACCCACTTGCTGGGGTCGTGACTCGTACCAACCCGGCATTAGAAGGAGAGGATGAGGAGAAGCTTTTCGATGCACCCCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGGTAAGGCAGTTGGTCACTTGATGTTCCAAAAGGCGAACTCCGGTTAACATAGACAACTCCTTTCCCTTTAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGATGGTCGACTTCTCCACTCCGCCGCCACCCCTCCTCTCCACTCCCCACCCCTCTGAACCCAGTGTCCTGTCGCCCCTACATCTCTGGCCCCACTTGCTATACCTGCCCTGCAGGTTGGCAGCAGCGATGTTGGAGACCAGTTCTCTACGGGGGCTCCAAAGGATGTCAATCCCTCTGACGAGAGCATCTTGCTGGATCCATTCGCAAGCTTGGGGGCATGGAGGCAACTGCTTAGTTGAAGGAAAAGCTAGAGAGAAGATG
  5   1   2       ext Int1      in                        CAAP14848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGGGCTTTTCGATGCACCCNCTTTCCATCACAAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACGGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCANAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCCAGGATTTGTACTGTTCCACATTCTAAATCAAGCACAGTCCATTAG
  5   1   2       add Neu0 FLt5                          IMAGE:6994149                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGCTTTTCGATGCACCCCTTTCCATCACGAAGAGGGAACAGCTGGAGCGACAGACTGCGGAGAACTACTTCTATGTCCCAGACCTTGGGCAGGTTCCCGAAATAGATGTCCCGTACTCTCTGCCGGACCTGCCGGGGGTGGCTGATGATCTCATGTACAGCGCCGACCTTGGGCCTGGCATCGCTCCTTCTGCACCTGGAGTTCCTATCCCCGAGCTTCCAACCTTCATCACAGAGGACATCACAGAAAACTCTAGGACAGACAGTCAGGATGGTCGACTTCTCCCACCTCCGCCGCCACCCCCTCCTCCTCCACCTCCCCCACCCCCTCCTGAACCCAGTGTCCTGTCGCCCCCTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCANAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGGAGATGGAAGATGAGGAAAGACTGGGGAGTCTTTAGCCCGTGGGTGTCCCCATTCCTGGAAGGAACCCCCTGGCCCAGGGATTTTGTACCTGTTTCCACCAATTCCTAGAA
  5   1   2       ext Neu       in                   TNeu104d22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACATCTCTGGCCCCACCTTTGCCTATACCTGCCCCTGCCAGGGTTGGCAGCAGCGATGTTGGAGACCCAGGTTCTCTACAGGGGGCTCCCAAAGAAGTGGTCAATCCCTCTGACGGAAGAGCATCCTTGCTGGAGTCCATCCGCCAGGCTGGGGGCATTGGGAAAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTT
  3   1   2       ext Neu       in                    TNeu104d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCCAAACTGCGTAATGTGAAGGAGAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Int1      in                        CAAP14848.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCAAACTGCGTAATGTGAAGGAGAAAAAAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAA
  3   1   4      seed Lun1      in                         CABD9087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAAACTGCGTAATGTGAAGGAGAAANAGCTAGAGAAGAAGAAGATGAAGGAGCAGGAACAGGTGCGAGCACAGGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAA
  3   1   2       ext Ovi1 FL   in                         CABI9074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAATGTGAAGGAGAAAAAGCTAGAGAAGAGAAGATGAAAGGAGCAGGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATAT
  3   1   2       add Brn3      in                         CAAK2698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAACAGGTGCGAGCAACAGGAGGCGGTGGCGACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATT
  3   1   2       add Liv1 5g3  in                         CAAR1136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTAATTTGCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATT
  3   1   2       ext Gas7 5g3  in                         XZG47421.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGATGTCCGATCTCTTTAATAAGTTGGCGATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAGCCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATT
  3   1   2       ext Neu  FL   in                    TNeu121a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAGACGCAAAGGCATATCGGGAAAGGGTCCAGCTGCCGGAGAAGCAAGTGGGGACGGTCCTACAGGCGCCTTTGCTCGCATTTCCGACACCATTCCCNCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Brn2 5g3  in                         CAAJ6322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCGCTACCCCCACCGGATCAGGCCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATT
  3   1   3        nb Neu  5g3  in                    TNeu127d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGGCTCGGGAGATGGAGATGAGGAAGACTGGGAGTCTTAGCCGTGGTGTCCCATCCTGAGGAACCCCTGCCAAGGATTTGTACTGTTCCACATTCTAGATCAGGCACAGTCCATTAGCACAGGCCTAGAGGTCTTCTGATGGACTGGAACCTGTCAGATCAGCACCACCATTGACACCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGAGGAGCAGCTGCTTGTATTGATGCCCCTTTATCATTTTCCTCTGCTTCCATTGGCTGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTAGCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAGCCCCATTGTTTATTATTCCGTCTATAATTCATTATCGTTGCCGGTATTCTACTGGGTGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGCACTGAACGAAACAAGGAAGGGTCCCATATAACTTCAGTCTTCATTTTCCCTGTGGGTATGTGCCTAATGGAAAGATTAAACTCTGAATATTAAAAAAAAAAAAAAAAAA
  3   1   2       add Tad5      in                         XZT30312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCCCCTCCTGAGGAACCCCTGCCAAGGATTTGTAGTGTTCCACATTCTAGATCAGGCACAGTCCATTGGCACAGGCCTAGAGGTTTTCTGATGGACTGGACCCTGTCAGATCAGCACCCCCATTGACCCCAAGGAAAATCAGCTTCAGATGTTGCTGGTTATGAAGGAACTTTTTTGCATCTTTTTTCATTTTTATAAACGTTTAGAGCTTTTGGGGAGCAGCCGCTTGTATTGATGCCCCTTTATCATTTTCCTCCGGCTTCCATTGGGGGGCACCAACCATAGCCATTTTTTTTTTTACTGCCTCTCCTCATTACCCCTGGGAATAGGCAGGTATTTATCACTGTGATAACATAAGCAATGTCCGACTTACTATCTCACTACAACCCCATTGTTTATTATTCCGTCTATAATTCATTATCATCGCCGGTATTCTACTGGGGGCATTCATGGTCCTATCAAGTTCTCGGAGCTTTAGTCGC
  3   1   0       add Thy1 5g3  in                        CBST6014.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCAGTCCCTTTGCCCAGGCCTAGAGGTTTTTTGGTGGGCGGGGACCTTTCAGTTCAGCCCCCCCCTTGGCCCCAAGGAAAATCCCCTTCCGATGTTGCCGGTTTTGAAGGAAATTTTTTGCCTCTTTTTTCATTTTTAAAAACGTTTAGGGCTTTTGGGGGGCCCCCCCTTTTTTTTAAGCCCCTTTTTTATTTTCCCCCGGGTTCCATTGGGGGGGCCCCACCAAAACCCTTTTTTTTTTTTTCCGCCCCTCCCCCTTAGCCCCGGGAAAAGGCGGGTTTTTTTCCCCGGGGTAAAATAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)