Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-CABI1775.3                            2 END     1           3       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 217.0    0Xt7.1-XZG4868.5                           130 PI      80        737     1012                novel forkhead box A family protein [Xenopus tropicalis]
     3 309.0    0Xt7.1-CAAP10218.5                          79 PI      81        686     1045                forkhead transcription factor FoxA1 [Silurana tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012077255 Xt7.1-CABI12259.5 - 31 ESTs
                                                                       ..0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI12259.5   ATCATCATCCTCCTCCTCAGCAGCAGCACCCTGAGGTCTTTTTCACCCCCTGCAGCACCTCTTGCTACTTCAGTTTCCCTGAAACCCCATCCCACTCATTGAGCAGCCCCTCTGGCTGTCCATTTGTGCCCAACACTAGCCCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCCCTCACACTCTCTCTCTTTTTGTTGCTATCGCTGTCGTAGTTGTTGTGGCAGTTAAATTTTAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCGAAGCCCCCCTACTCGTACATCTCGCTCATCACCATGGCGATCCAGCAGTCCCCCAACAAGATGCTCACTCTCAGCGAGATTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGC
                                                  Xt7.1-CHK-1008228111         ATCCTCCTCCTCAGCAGCAGCACCCTGAGGTCTTTTTCACCCCCTGCAGCACCTCTTGCTACTTCAGTTTCCCTGAAACCCCATCCCACTCATTGAGCAGCCCCTCTGGCTGTCCATTTGTGCCCAACACTAGCCCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCCCTCACACTCTCTCTCTTTTTGTTGCTATCGCTGTCGTAGTTGTTGTGGCAGTTAAATTTTAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCGAAGCCCCCCTACTCGTACATCTCGCTCATCACCATGGCGATCCAGCAGTCCCCCAACAAGATGCTCACTCTCAGCGAGATTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGA
                                                      consensus depths        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     6     5     6     5     6     6     7     6     7     7     8     8     9     9    10    11    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    12    11    12    11    12    12    13    11    13    11    13    11    13    11    13    11    13    11    12    11    12    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10    10    11     9    10     9    11     9    11     8    11     8    11     8    11     9    12     9    12     9    12    10    12     6     9     6     9     6     9     6     8     6     7     6     7     6     7     5     6     5     6     7     8    11    12    11    12    11    12    11    12    12    13    14    15    14    15    14    15    14    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    13    16    12    15    12    15    12    15    12    14    12    14     9    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     6    13     6    12     4     7
                                               BLH ATG     298    1568   
                                               BLH MIN     298     254   
                                               BLH MPR     115     254   
                                               BLH OVR     298     471   
                                               CDS MIN     298     254   
                                               ORF LNG     298      31   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Br ---- 6e-017     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] -------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 9e-021     NP_009991.2 Dosage-dependent suppressor of cmd1-1 mutation; shows homology to fork headfamily of DNA-binding proteins; Hcm1p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bb ==== 7e-034     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] ===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 3e-050     NP_001041116.1 defective PHArynx development family member (pha-4) [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 3e-070     BAE06430.1 transcription factor protein [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Dm ---- 6e-071     NP_524542.1 fork head CG10002-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Cs ==== 2e-073     BAB16313.1 fork head/HNF-3 homologue [Ciona savignyi] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bf ---- 1e-077     CAA65368.1 AmHNF-3-1 protein [Branchiostoma floridae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sp ---- 2e-077     NP_001073010.1 forkhead transcription factor A [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 5e-127     NP_001080063.1 forkhead box A1 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_034576.1 forkhead box A2; hepatocyte nuclear factor 3 beta (winged helix transcriptionfactor) [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_068556.1 forkhead box A2; hepatic nuclear factor-3-beta; hepatocyte nuclear factor 3,beta [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 0          NP_571024.1 forkhead box A2; axial [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_990101.1 transcription factor Foxa2 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAA20679.1 HNF-3beta [Xenopus laevis]  ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          AAP82293.1 fork head transcription factor FoxA2 [Silurana tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI12259.5                                  TGA---------------------------------------------TGA------------------------------------------------------TAG------------------------------------TAGTGA------------------------------------------------------------------------------------------TAA------------------------ATG---------------ATG---------------------------------------------------------------------ATG---------------ATG------ATG---------ATG---ATG------ATG---------------ATG------------ATG---ATG------------------ATG------------------ATG------------------ATG------ATG------------------ATG---------------------ATG------ATG------------------ATG------------------------ATG------ATG------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------ATG------------------------ATG---------------ATG---------------------------------------------------------------------------------------ATG---------TAG---------------------------------------TAA---TAA------------------ATG---------------TGA------------------------------TAG------------------------TGA------------------------------------TGA---TGA------------------------------TAA------------------------TGA------TAA---TAA------------------------ATGTAA------------ATG---------------------------ATG------------TAA---ATG------------------------------ATG------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  0   1   1           Neu  FL                     TNeu069i04.FL-Sanger                                                                                                                                                                                                                                                                               TTTTAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCGAAGCCCCCCTACTCGTACATCTCGCTCATCACCATGGCGATCCAGCAGTCCCCCAACAAGATGCTCACTCTCAGCGAGATTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGCAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu0 FLt5                   IMAGE:6991484.FL-MGC                                                                                                                                                                                                                                                                                                                           GAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCGAAGCCCCCCTACTCGTACATCTCGCTCATCACCATGGCGATCCAGCAGTCCCCCAACAAGATGCTCACTCTCAGCGAGATTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGCAAAAAAAAAAACAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                          XZG1292.5p TCATCATCATCCTCCTCCTCAGCAGCAGCACCCTGAGGTCTTTTTCACCCCCTGCAGCACCTCTTGCTACTTCAGTTTCCCTGAAACCCCATCCCACTCATTGAGCAGCCCCTCTGGCTGTCCATTTGTGCCCAACACTAGCCCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCCCTCACACTCTCTCTCTTTTTGTTGCTATCGCTGTCGTAGTTGTTGTGGCAGTTAAATTTTAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCC
  5   1   2       bld Gas7 5x3  in                         XZG22706.5p   ATCATCATCCTCCTCCTCAGCAGCAGCACCCTGAGGTCTTTTTCACCCCCTGCAGCACCTCTTGCTACTTCAGTTTCCCTGAAACCCCATCCCACTCATTGAGCAGCCCCTCTGGCTGTCCATTTGTGCCCAACACTAGCCCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCCCTCACACTCTCTCTCTTTTTGTTGCTATCGCTGTCGTAGTTGTTGTGGCAGTTAAATTTTAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGTAAAGAGCCGCTTGTCGCTAATGGCACAATCCTTGCCTCATTCTGCCTCTTTATAGCGCACTGTTAGCCCTGGGATAATATTAACTTGGTCATCAAATATTGACTTGTGGCGCCTCCAAATCCTCCTCGATGACTGAGCCACACACTGTCCCAACAAAGTTCTGTTTGGCATGGGCAGGGGGGGCAAGGCAATGGGCACAGGCAAGGGGAATTGTATGGAAAAAAACAGATTATACTTGTGAATTTAACTAATCACACTTTCAGGAAGAACAGTTTGTACTAAATATGGACATTTTCCTGATTTTCTCCTGGAATTGTCTTTAGTAAGAACCCTTATACCAAAGAGCTTCCCAAGGCTGGCTTGGGGGGAGAGGGGCTGCTATATTCCTTAAATCATTTTATTTCGTTTTTTGTTGTTTTTAGCATTTCTGGGTCTCTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG24500.5p ...............................................................................................CATTGAGCAGCCCCTCTGGCTGTCCATTTGTGCCCAACACTAGCCCAGCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCCCTCACACTCTCTCTCTTTTTGTTGCTATCGCTGTCGTAGTTGTTGTGGCAGTTAAATTTTAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGT
  5   1   2       bld Ovi1      in                        CABI10432.5p                                                                                                                                                            TTAAGCCCNGAGTTGTTTAACATTAACAGAAGAAAACGTTCTACGAGTTGTACATGTGTCTCTACAACCTGTGACTTCCGAGCTCTTGCTGAACTACATCTTCCAGCCTTCCACGTCTGCCTCCACGGACAGTGTGTTTCAGCCAGAGCCGGAGGGCCACAGGTTGCTGTTGATTTTGCGACTTTTAGATTGTGACCCTGTCGTTTGTTCCCAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTTCAGTGCGAGAAAAAGCCCAGCCCT
  5   1   2       bld In62 5g                         IMAGE:8956725.5p                                                                                                                                                                                                                                                                              AAAAACTAGCCAAGGCACTTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCGAAGCCCCCCTACTCGTACATCTCGCTCATCACCATGGCGATCCAGCAGTCCCCCAACAAGATGCTCACTCTCAGCGAGATTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGGAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAAGCGACGAACGCTTCAGTTGCGAGAAAAGCCCAGCCTTAAAGAGGGGAGCAGAAACTCTTCAGAGGTCATCGAGTGTGCTCTGCAGCAACAGCAGACTTGGAAAGCTCAATGGCAATGATCTCCCGCAACTCTCAGGTCTGTTCTACG
  5   1   2       bld Neu  FL   in                   TNeu069i04.p1cSP6                                                                                                                                                                                                                                                                                  TAAACTGCCAGGCACTCAGCTTCCAGTATGCTCGGGGCTGTGAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCGAAGccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagaATTATCAGTGGATCATGGACCTGTTTCCTT
  5   1   2       bld Neu0 FLt5 in                       IMAGE:6991484                                                                                                                                                                                                                                                                                                                           GAAAATGGAAGGACACGAAGCCACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAAGGGGAGGCAAGANACTCTCAGAAAGGGTCATCGAGTGTGGGGCTCTGCAGCCAACAGCAGCTCTGAAGAGCTCAGTTGGGCAATNGAGTCCCCCGCACTCCAAGCTCGTTCCCCCTGCCAGGAAGCAGAAGAAGTCTCTTNTTAAATATGAAAGTCCAC
  5   1   2       bld Ovi1      in                         CABI4520.5p                                                                                                                                                                                                                                                                                                                                                 ACAGACTGGAGCAGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGC
  5   1   2       bld Ovi1      in                        CABI10854.5p                                                                                                                                                                                                                                                                                                                                                    CCATCGATTCGCTACTACGGGGAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCA
  5   1   2       bld Ovi1      in                        CABI10909.5p                                                                                                                                                                                                                                                                                                                                                                         GAACCCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAAGCCAGCACTTGCTT
  5   1   2       bld Ovi1      in                         CABI9746.5p                                                                                                                                                                                                                                                                                                                                                                             CCGAGGCTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGC
  5   1   2       bld Fat1      in                        CABC10955.5p                                                                                                                                                                                                                                                                                                                                                                                   CTTACTCCTCGGTGGGTAACATGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAG
  5   1   2       bld Int1      ?                          CAAP2280.5p                                                                                                                                                                                                                                                                                                                                                                                                        TGAACGCCGGGCTGAGCATGAACCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCGGCTCCATGAACATGTCCTATGTGAATACTGGGATGAGCCCATCGCTCACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGAATGGGCACCGGGGTAGCCAGTATGGCAAGTCACCTCAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCTATGAATGCCCTGGCACCCTATACCAACATGAACTCAATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAGACTTACAGGCGCAGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGC
  5   1   2       bld Ovi1      in                         CABI1695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTATACGCATGCgaagcccccctactcgtacatctcgctcatcaccatggcgatccagcagtcccccaacaagatgctcactctcagcgagatTTATCAGTGGATCATGGACCTGTTTCCTTTCTACAGGCAGAACCAGCAGCGCTGGCAGAACTCTATCCGCCATTCTCTTTCCTTCAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCTGACAAGCCCGGAAAGGGCTCCTTCTGGACCCTACACCCCGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGAGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGGCATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATC
  5   1   2      seed Ovi1      in                        CABI12259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAAGCCCAGCCTTAGAGAAGGGGGAGGCAAGAAACTCTCAGAAGGGTCATCGAGTGTGGGCTCTGCAGCCAACAGCAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGT
  3   1   2       chi Neu0 FLt5 in                       IMAGE:6991484                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGAAGAGGGTCAGGGGGGGCCAAGGAGGTCCCCCCGCCACTTCCCAGGTTTGGTCCCCCCTTNCCCAGGGAGGCCGAAAGGGGTTCTCCTAGTTAGGATTTGGAGGTCCCAGGCCCAAGGGCTTAAAGGCCCCAGACCCTTGCAGGCCTCCCCCAGCCTTCCCAAAGGCCCAGCCACTTGTTTTTCCCAGGCACCCACTCTGTTTTTTTTCCCCATGAAGCCCCCAGTCCCCACCTCCAAACCCAGAACACCCATTTATTCTTTTCAACCACCCCATTTCTCCCATCNCCCCCCTCCTGTTCCCTCNGAGNNNNNNNNNNNCNCCNNNTNNTNNNNNNNNCCNCCACACCCCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTAAC
  5   1   2       bld Lun1      in                        CABD14951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTCTGAGAGCTCAGTGGGCAATGAGTCCCCGCACTCCAGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATT
  3   1   2       bld Fat1      in                        CABC10955.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTCGTCCCCCTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAA
  3   1   2       bld Ovi1      in                        CABI12259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGCCAGGAGCAGAAGAGGTCTCTAGTAGATATGAAGTCCAGCCAAGGCTAAGCCCAGACCATGCAGCCTCCCCAGCCTCCCAAGCCCAGCACTTGCTTTCCCAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAATGAATGGCAAAAAAA
  3   1   2       bld Ovi1      in                        CABI10432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGC
  3   1   2       bld Ovi1      in                        CABI10854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCACCACTCTGTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGC
  3   1   2       bld Ovi1      in                        CABI10909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGC
  3   1   2       bld Ovi1      in                         CABI4520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATGTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGC
  3   1   2       bld Ovi1      in                         CABI9746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATGGC
  3   1   2       bld Gas7 5g3  in                         XZG24500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCATGAAGCCCAGTCCCACCTCAAACCAGAACACCATTATTCTTTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Lun1      in                        CABD14951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAACCACCCATTCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGC
  3   1   2       bld Gas7 5g3  in                          XZG1292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCCATCAACAACCTCATGTCCTCAGAGCAACAGCGCCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCATAAAAAAGAA
  3   1   2       bld Gas7 5x3  in                         XZG22706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATCAACAACCTCATGTCCTCAGAGCAACAGCACCACCATCACCACCACCACAACCACCATCATCACCATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGC
  3   1   2       bld Neu  FL   in                    TNeu069i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATAAAATGGACTTAAAAGCTTATGAACAGGTGATGCACTACTCTGGTTACGGGTCCCCCATGACTGGCAGCCTGGCAATGAGCACAGTAACAAACAAAAGTGGCTTAGAGTCTTCACCTATTTCCAGTGACACCTCATACTATCAAGGTGTGTATTCTAGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACACCATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAATAAT
  3   1   2       chi Ovi1      in                         CABI1695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCTATCATGAACTCCTCATAGACTTTCTACCATGGACTTGTCACCTGGGCTCTGTGTATATAATATTAAGAAGAAAAACAACATAGTATGTGTCTACATTCCTATTGAATTGTACAGTCCCCCGAGTTTGTTTCTGTATAGGAGCTTAGCTTGTTAAGCTATGTTTGATTTGGGTGCTTTTCTTTGGCAAGGAGTATATTTTTGTGAAAGTGACGGATCCTAATTTTTCTGTGTGAAATCTGTTAATTTTCCCTAAGGACCAAAATTGTGTGATATTGGTAATGTTAAAAAAAACAGAAACGGAATATATTGATGTAATTGAAAAAAAAGATGTTTTTTTTTTTATTTGTTTGGGGGAGATGCTTGAAACTGGTTAATTTATGGTTTCTGTATGTTTTATTTATGACTGCTGTATGTATTCTGGCCATAACCGGCCGGTTTAACAATCTCTATTAAAAAATGAATTGGCATTTCTGTCGGGATTTTTCTTTCCACCTCTATACACATATTTTTGTGGCTGAAGGTGAATCAGATAAGTGAGCACAAGCCAAGGTCTGGACTGTACCAAGGTGGGATACAGGGAGGCTGAAGGGTTCTGCTCTGCTGACACTTCCCTTCAATTTCTCACAAGTCCATGAAAGTTCTGCCACAATGGGATTAGATAAAGGATCCATTGTATTGGGGGGGTTTAGTTCACAGGCAAGTTTTATAACGAATTTTTATGTAACGAATTTCCATGGTACTAGAGTGCATGAAATACTACTACTGTTACTAATAATAATAATAAAGATTCGTTACTGC
  5   1   0       add Ovi1      out                        CABI1775.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGTATTGGGGGGGTTTAGTTCACAGGCAAGTTTTATAACGAATTTTTATGTAACGAATTTCCATGGTACTAGAGTGCATGAAATACTACTACTGTTACTAATAATAATAATAAAGATTCGTTACTGTATAGTCGGCTGATTTTAAAGTGACCTATTCCCTCTTACTAATATCATGTGTGCATGCCAGTGAGACCTTTATTCGGCTGAGTAGAGAGAAAATTAAGGGAGAAAAACATACCTGATAATATTCAAAATCTTTTCTTTTTTATACATATAAATGCTTAAATATTTGCCATAACACAGTAGATTCCCGACGGCGACTTTTAAGAAAGCCAGCTGCGCTCCAACCCTAATTCTTATGGTTATTTTATACATTAAATACAATAAAACGATTTTTTTTATTTAACAAATGAAAGCCAATGTCTAAGCACATTTAAACACAACAAATAAACACAACATAAAAACTAGAAGTGTGTGGGCAGGACTGGCAGCAGTCACCGGTATCAAACTAGACTTTGGCAATGTATTAAGTGGGAGCGGCCAATGATAAATTAAACAGGTGTGCCGACTTATAGGTGTTGGCCATTTGTTATTTTATATCCTATCTAAAACCATGTTATTCCCTGCTACACCAGATTTAGATAATGTGTGCAACATTATTCTCTCCATATTCTACATGTATTTATTATTGTATTATTTCCTGTCTTTTTCTGGGTCTAtgtgtgtgtgtgtatatatatatatgtgtgtgtgtgtgtgtgtgtgtttgtgtatatatatatatatgtgtgtgtgtgtgtgtgtATATATTTACTGTAGGTCACCATATCCTGGGTTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)