Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA040b05.3                         24 END     5          13       20                (no blast hit)
     2   2.0    0Xt7.1-CAAJ17024.3                          10 END     6          16       60                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012077286 Xt7.1-CAAJ12781.5 - 36 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ12781.5 TTGCTTGGACACGAACGAGGTTGTTTTGGAGGAGGAACAAAACCTTCGTGTGGGCGGGGCTTATGAGCGGAGGAGGCGGGGCTAGTTGGAAGGTTTGCCTGTCTGTATTTAAGGAGTCCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACCTGGTGCCAAGCCTCTGCCTGTTCCTCCAGAGCTAGCACCTTTTGTAGGAAGGATGTCTGCACAGGAAGGAGCTCCAATTATGAATGGGATCTCAGGTCCACACAGCAACAGTTATGACCCCTGGGGAGAAATAAAGCCTGTCCTGCCCAAAGCCTCACCTTCCCAACCACACAAACAGATCAGTGATTCCTACTCTAATACCCTTCCTGCTCGCAAGAGTGTTCCTCCCAAAAACAGCTACACAGTCGCTGAGAATAAGACCTTGCCCCGTTCCAGCTCCATGGCAGCTGGTCTTGAAAGGAATGGTAGAACGCGTGTTCAGGCAATCTTCTCTCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGTCTGGAAGCTGAAGTTGCGAGGTTTTGAGAGGTGCCTCCAGTTAAAACTTTTTTACTGAAGTCCGACTGAAACCGACAGTGACAAATGACAGATCAGCTCCGCTTGTGAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTACAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTGTCACAGGCAGCTCGGCTTCGGCTCTCTCATATACTTCCTAGTCTGGAGTGAGCTCCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTAACTGTAAAGATGGTGGAGGAGGTGTCTACTGTACATGCCTGATTGATTTCCATTGCAGCAGTGTGGCAAGCATGGGTGTCAGACACCTCTTCGGCCATCTTATTAGGCAAAGAGAGAAGGAGGGCTTAGCAAAGACGGGGGGGCAGAGCTTCACGCTGGGCTGGGGGGTGGCTGGGAGGGCTGCAGTTGAGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTTGTGTTTTAATAAATTATTTGATGTTCAAAAAAAAAAATATTACCTTTAAACAGCGAATGCAATATGACATTAGCCAGCACATACAGTCATTGGGGATACAAAGATGGAATGCAAAATAACAATTGTATATAGGTGCACACTGGCTCTTTAGTGTCTGCAGTAATGTATATAGGGATATAATCCACACAGGTTCTCTTTGTACACAAATCCAGGGAATGGGCTCTACAATGGTAATACTGTC
                                                  Xt7.1-CHK-1008227218       GGACACGAACGAGGTTGTTTTGGAGGAGGAACAAAACCTTCGTGTGGGCGGGGCTTATGAGCGGAGGAGGCGGGGCTAGTTGGAAGGTTTGCCTGTCTGTATTTAAGGAGTCCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACCTGGTGCCAAGCCTCTGCCTGTTCCTCCAGAGCTAGCACCTTTTGTAGGAAGGATGTCTGCACAGGAAGGAGCTCCAATTATGAATGGGATCTCAGGTCCACACAGCAACAGTTATGACCCCTGGGGAGAAATAAAGCCTGTCCTGCCCAAAGCCTCACCTTCCCAACCACACAAACAGATCAGTGATTCCTACTCTAATACCCTTCCTGCTCGCAAGAGTGTTCCTCCCAAAAACAGCTACACAGTCGCTGAGAATAAGACCTTGCCCCGTTCCAGCTCCATGGCAGCTGGTCTTGAAAGGAATGGTAGAACGCGTGTTCAGGCAATCTTCTCTCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGTCTGGAAGCTGAAGTTGCGAGGTTTTGAGAGGTGCCTCCAGTTAAAACTTTTTTACTGAAGTCCGACTGAAACCGACAGTGACAAATGACAGATCAGCTCCGCTTGTGAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTACAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTATCACAGGCGGCTCGGCTTCGGCTCTCTCATATACTTCCTAGTCTGGAGTGAGCACCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTAACTGTAAAGATGGTGGAGGAGGTGTCTACTGTACATGCCTGATTGATTTCCATTGCAGCAGTGTGGCAAGCATGGGTGTCAGACACCTCTTCGGCCATCTTATTAGGCAAAGAGAGAAGGAGGGCTTAGCAxxGACxGGGGGGCAGAGCTTCACGCTGGGCTGGGGGGTGGCTGGGAGGGCTGCAGTTGAGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTTGTGTTTTAATAAATTATTTGATGTTCAxAxxAAAAAAxAxxAxCTTTAAACAGCGAATGCAATATGACATTAGCCAGCACATACAGTCATTGGGGATACAAAGATGGAATGCAAAATAACAATTGTATATAGGTGCACACTGGCTCTTTAGTGTCTGCAGTAATGTATATAGGGATATAATCCACACAGGTTCTCTTTGTACACAAATCCAGGGAATGGGCTCTACAATGGTAATACTGTCCAGGAA
                                                      consensus depths      2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     6    12    14    13    14    13    14    13    16    13    16    13    16    13    16    13    16    13    16    13    16    13    16    13    16    13    16    13    16    14    16    14    16    14    16    14    16    15    17    16    17    16    17    16    17    17    17    17    17    17    17    17    17    17    18    17    18    18    18    18    18    18    18    18    18    18    18    17    17    17    17    17    17    16    16    16    16    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    10    10    10    10    10    10     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     8     9     9     9     9     9     6     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     5     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     5     7     6     8     6     8     3     8     3     8     3     8     3     8     3     8     3     8     3     9     3    10     3     9     4     9     5    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     7    10     7    10     7    10     7    10     8    11     8    11     8    11     8    11     8    11     8    11     8    11     7    11     7    10     6    10     6     9     6     9     4     8     6     8     6     8     5     8     5     8     6     8     7     9     6     9     3     8     5     8     5     8     5     7     5     7     6     7     6     7     4     7     5     7     5     6     2     6     4     6     5     6     5     6     6     7     5     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     6     8     7     8     5     8     6     8     6     8     5     8     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                               BLH ATG     192     640 
                                               BLH MIN     213     186 
                                               BLH MPR     138     186 
                                               BLH OVR     192      36 
                                               CDS MIN     192      38 
                                               EST CLI     158      38 
                                               ORF LNG     192      10 
                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 2e-039     NP_729679.1 Alpha 3 glucosyltransferase CG32082-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 4e-066     XP_785898.2 PREDICTED: similar to BAI1-associated protein 2 [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 6e-092     AAI35451.1 Unknown (protein for MGC:121460) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 3e-097     AAH61676.1 Unknown (protein for MGC:68822) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PREDICTED = ?? ==== 0          XP_683246.1 PREDICTED: similar to BAI1-associated protein 2 isoform 2, partial [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 0          NP_001035335.1 hypothetical protein LOC678518 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PREDICTED - Gg ---- 0          XP_420080.2 PREDICTED: similar to Brain-specific angiogenesis inhibitor 1-associated protein 2 (BAI1-associated protein 2) (BAI-associated protein 2) (Insulin receptor substrate p53) (IRSp53) (Insulin receptor substrate protein of 53 kDa) (Insulin receptor tyrosine ki [Gallus gallus]  =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_570932.2 brain-specific angiogenesis inhibitor 1-associated protein 2 isoform b [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_006331.1 BAI1-associated protein 2 isoform 3 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ12781.5                                                                TGA------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------TGA---------TGA---ATG------------------TGA------------------------------------------------------------ATG---------------------TGA---TAGATG------------TAATGA---------------------------------------TAA---------------------------------------------------------------TGA------------------------------------TAG---------------TGA---------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------ATGTAG------------------------------------------------------------------TAG---TAA------------------ATG------TAA---------------------------------------------------------TAA---------------TGA---TAG------------------------------ATG------------------------------------------TAG---------TAA------TAG
                                                                   ORF                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   1           Egg  FLt3                   TEgg009c24.FL-Sanger                                                                                                                                                                   ATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg055i17.p1kSP6 TTGCTTGGACACGAACGAGGTTGTTTTGGAGGAGGAACAAAACCTTCGTGTGGGCGGGGCTTATGAGCGGAGGAGGCGGGGCTAGTTGGAAGGTTTGCCTGTCTGTATTTAAGGAGTCCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAGAGCCAGGGAAGCAAG
  5   1   2       bld Egg  5g                        TEgg107i24.p1kSP6 TTGCTTGGACACGAACGAGGTTGTTTTGGAGGAGGAACAAAACCTTCGTGTGGGCGGGGCTTATGAGCGGAGGAGGCGGGGCTAGTTGGAAGGTTTGCCTGTCTGTATTTAAGGAGTCCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAA
  5   1   2   14  bld Te3  PIPE out                        CAAM6864.5p ...................................................................CGGAGGAGGCGGGGCTAGTTGGAAGGTTTGCCTGTCTGTATTTAAGGAGTCCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGA
  5   1   2   14  bld Brn2 5g3  out                       CAAJ12781.5p ...................................................................................................................................................CCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGGAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGCGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACC
  5   1   2       bld Egg  5g                        TEgg098h21.p1kSP6                                                                                                                                                        CCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCT
  5   1   2       bld Egg       in                   TEgg016i18.p1kSP6                                                                                                                                                          TGGGATTACACGGCTTGTGTAGCCACCCTCGGGGTATGGCACTGACAGGAGCCATGATGTCCCGATCAGATGAAGAGAACCGAGCTCACCAGAAAATGTCTACAAAACAATTATGGAACAGTTGAACCCCTGCCTTATGAACTTCATTGCCATGGGAAAGAACTACGAGAACGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTAGGCCAGCTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCCGATGGCAGAAGATCATAAACAGATCCGGAATCAGTGACAACAGATGCTGAAATCTTTGCACACTGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGATATCTACATGCTGCACT
  5   1   2       bld Egg  5g3  in                   TEgg041d12.p1kSP6                                                                                                                                                               TGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ17024.5p ..............................................................................................................................................................TGGGATTACCGTCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGCGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACC
  5   1   2       bld Egg       in                   TEgg013e20.p1kSP6                                                                                                                                                                  GATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ18857.5p .................................................................................................................................................................GATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGCGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACTTACTACAGCAAGGGTAA
  5   1   2      seed Brn3 5g3  in                         CAAK8716.5p                                                                                                                                                                  GATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGCGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATC
  5   1   2       bld Egg  FLt3 in                   TEgg009c24.p1kSP6                                                                                                                                                                    TTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCT
  3   1   2       bld Egg  FLt3 in                    TEgg009c24.q1kT7                                                                                                                                                                    TTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn2 5g3  out                         CAAJ693.5p ......................................................................................................................................................................CCGGCTTATGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATC
  5   1   2       chi Te4       out                        CAAN9809.5p                                                                                                                                                                                                  CCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGGTGTAACGTTTGCTGCAAAAGGCTACTTTGATGCCCTGGTAAAAATGGGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTC
  5   1   2       chi Te4       out                        CAAN9856.5p                                                                                                                                                                                                            TCCCACTGCACGGATTTGCAGTAAATCTGCTCCAGCCGGCTGTGGGATTACCGGCTTGTGTAGCCACCCTCGGTGTATGGCACTGACAGGAGCCAGGATGTCCCGATCAGATGAAGTGAACCGGCTCACCGAAAATGTCTACAAGACAATTATGGAACAGTTTAACCCCTGCCTTAGGAACTTCATTGCCATGGGAAAGAACTACGAGAAGGCTTTGGCAAGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCCGCTACATCTTCAAAATCTAGTCTGTCCATATC
  5   1   2       bld Brn3      ?                          CAAK3735.5p                                                                                                                                                                                                                                                                                                                                                                                                 GGAGAGTTGGCCAGTGAAAGCCAAGGCTCTAAAGAACTTGGGGATGTTCTATTTCAGATGGCAGAAGTTCATAGACAGATCCAGAATCAGTTAGAAGAGATGCTGAAATCTTTGCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGTGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACCTGGTGCCAAGCCTCTGCCTGTTCCTCCAGAGCTAGCACCTTTTGTAGGAAGGATGTCTGCACAGGAAGGAGCTCCAATTATGAATGGGATCTCAGGTCCACACAGCAACAGTTATGACCCCTGGGGAGAAATAAGCCTGTCCTGCCAAAGCCTCACCTTCCCACCACACAAACAGATCAGTGATTCCTACTC
  5   1   2       bld Brn2      out                       CAAJ11455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGATGCTGAAATCTTTGNCACAATGAGCTTCTCACACAACTTGAACAGAAGGTGGAGCTGGATTCCAGGTATCTAAATGCTGCACTGAAAAAATACCAGGTTGAACATAAAAACAAAGGCGAAGCCCTGGAGAAATGTCAGGTAGAGCTAAAGAAACTGAGAAAAAAGAGCCAGGGAAGCAAGAACCCCCAGAAGTATTCAGACAAAGAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACCTGGTGCCAAGCCTCTGCCTGTTCCTCCAGAGCTAGCACCTTTTGTAGGAAGGATGTCTGCACAGGAAGGAGCTCCAATTATGAATGGGATCTCAGGTCCACACAGCAACAGTTATGACCCCTGGGGAGAAATAAAGCCTGTCCTGCCCAAAGCCTCACCTTCCCAACCACACAAACAGATCAGTGATTCCTACTCTAATACCCTTCCTGCTCGCAAGAGTGTTCCT
  5   1   2       bld TpA       in                  TTpA018n14.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGAACCCCCAGAAGTATTCAGACAAATAAATGCAGTATATTGAAGCAATTAGCAACAAGCAGGGTGAGCTGGAAAGCCATATTTCCGACGGTTACAAAACCGCACTTACTGAAGAGAGGAGAAGATACTGCTTCCTTGTCGAGAAACAGTGTGCAGTGGCAAAGAACTCGGCCACCTACTACAGCAAGGGTAAAGACCTTCTCGCTCAAAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTCTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACCTGGTGCCAAGCCTCTGCCTGTTCCTCCAGAGCTAGCACCTTTTGTAGGAAGGATGTCTGCACAGGAAGGAGCTCCAATTATGAATGGGATCTCAGGTCCACACAGCAACAGTTATGACCCCTGGGGAGAAATAAAGCCTGTCCTGCCCAAAGCCTCACCTTCCCAACCACACAAACAGATCAGTGATTCCTACTCTAATACCCTTCCTGCTCGCAAGAGTGTTCCTCCCAAAAACAGCTACACAGTCGCTGAGAATAAGACCTTGCCCCGTTCCAGCTCCATGGCAGCTGGTCTTGAAAGGAATGGTAGAACGCGTGTTCAGGCAATCTTCTCTCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCT
  5   1   2       bld Te1       in                         CBWN7487.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGATTCCATCTTGGCACCAGGCCAGCGCCGATCCAAGCAAAATTCCAGACAGAGCCATGCAGATCATGCAGCAGATGGCTACTAGCAGCAATGGCACCATTATGTCTGGTACCCTTTCTGGACCGCTAACATCTTCAAAATCTAGTCTGTCCATATCAGATCCTATACCTGGTGCCAAGCCTCTGCCTGTTCCTCCAGAGCTAGCACCTTTTGTAGGAAGGATGTCTGCACAGGAAGGAGCTCCAATTATGAATGGGATCTCAGGTCCACACAGCAACAGTTATGACCCCTGGGGAGAAATAAAGCCTGTCCTGCCCAAAGCCTCACCTTCCCAACCACACAAACAGATCAGTGATTCCTACTCTAATACCCTTCCTGCTCGCAAGAGTGTTCCTCCCAAAAACAGCTACACAGTCGCTGAGAATAAGACCTTGCCCCGTTCCAGCTCCATGGCAGCTGGTCTTGAAAGGAATGGTAGAACGCGTGTTCAGGCAATCTTCTCTCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAA
  5   1   2       bld Egg                            TEgg105g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGATCAGTGATTCCTACTCTAATACCCTTCCTGCTCGCAAGAGTGTTCCTCCCAAAAACAGCTACACAGTCGCTGAGAATAAGACCTTGCCCCGTTCCAGCTCCATGGCAGCTGGTCTTGAAAGGAATGGTAGAACGCGTGTTCAGGCAATCTTCTCTCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGCGGCAATGGCACAATGATATCCACTGTGTGAGGAGAGACTTGCACAGGCACCTGCTGCTTTGGAGAATATTCGTCTTTCTTACCCTTTTCTTTTCTTAT
  5   1   2       bld Tad5      out                        XZT68913.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAACGCGTGTTCAGGCAATCTTCTCTCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGTCTGGAAGCTGAAGTTGCGAGGTTTTGAGAGGTGCCTCCAGTTAAAACTTTTTTACTGAAGTCCGACTGAAACCGACAGTGACAAATGACAGATCAGCTCCGCTTGTGAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTACAAAGACTATACA
  5   1   2       chi Egg                            TEgg141k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGCTTCCGCTGCCGGTGACACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGCAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGAGACAAACACAGTAGGATTGGAGTTAATGGCTACCTGTATTGCTTCCTCACATACTGATATCATGGGATGTGGGATTTAGCGGGGCCTTCTACCCAGACTTAGCTCCTGTCAACTCTCGCCAGTGCCAAAATTCTCCATAGCTGCTGTGATAGAACCTCTAACGCTACATTATGAAAAAATGCCTTTTTTTCCTTTATAGCATTGCTGGCAATATACTTGTAACCATATACATTATACACCAAAGCGTTTTGTTAATGGAACAGAACATGGACAAATGAGAATCCGTTTGCATTTATGATGCCATAACTGTGCTAGCGATCTCTTAGACTCACTTTGTTCAGTGATGAACGGAATAGAGACTCCTGTAAACAATGTACAGTGCTAAGCACACTTTTTTTTCTCAAGGTGAAGAAAAATGTGCCCTGTAATGATGTTATTGTATGAATAAGTTTTCTTTAT
  3   1   2       chi Te1       in                         CBWN7487.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCACGCTGCCGGTGACAACACTACCTTGTTAAGCTTCAAAGATGGTGACTACATCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGCATTGCTGGCAATATACTTGTAACCATATACATTATACACCAAGCGTTTTGTTAATGGAACAGAACATGGACAAATGAGAATCCGTTTGCATTTATGATGCCATAACTGTGCTAGCGATCTCTTAGACTCACTTTGTTCAGTGATGAACGGAATAGAGACTCCTGTAAAAACAATGTACAGTGCTAAGCACACTTTTTTTTCTCAAGGTGAAGAAAAATGTGCCCTGTAATGATGTTATTGTATGAATAAAGTTTTCTTTATTGCATTAAAAAGAAAAAAAAAAAAAAA
  5   1   2       bld Tbd0                               IMAGE:6978246                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCACCTTACTTGTTCCCGAGGCCAGAGATGGGTGGCATTACGGAGAATGCGAGAAGACCAAACTGAGGGGATGGTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGGCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGTCTGGAAGCTGAAGTTGCGAGGTTTTGAGAGGTGCCTCCAGTTAAAACTTTTTTACTGAAGTCCGACTGAAACCGACAGTGACAAATGACAGATCAGCTCCGCTTGTGAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATGCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCANATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTTTCAAGACTATACAGCCCCCAGAATACACAGATTTTTCTCTCATGTAGATGCTGTATCACAGGN
  5   1   2       bld Brn2      out                       CAAJ22702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCCCATTTTCCTACACTCGAGTGTTAGATACAGGCACTGATCGGACACAAACAAGCTTACAGCCTGGGAAAAGCAGCAGCACTGGAAACCTGCTGGACAAAGATGACCTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGCCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGCAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGCGGCAATGGCACAATGATATCCACTGTGTGAGGAGAGACTTGCACAGGCACCTGCTGCTTTGGAGAATATTCGTCTTTCTTACCCTTTTCTTTTCTTATTTATAACTATGGAGTTTATTTTATTTATTTTTTTTTAACTCTTGTACTTTCTGTAATTCATTTCCTTTTGGTATTTGAATGATCTCTGTGCTCAGTAACCTTTGCTTTGCTGGAGGTATCTGTAATCTGTTGCATAGCAGTAATTGGAGGTCATTCCAGCATCCCATTGGTTAGGCATTTCTGGTGCTGCTTGGTTTTTATCTTCCTGATGCTTTTTTTGGGCTTATTTGTTTTTAGGAAGGGGTTTTCAGTGCAGGAACTGCCAATCAGTGTGGCTGTAATTACTGAACATAAAGAGCTGTTTTCTTACTGGCTTTTATACCAATTTTTAAATAGCATTGCTGTCACATTTTTGGGGCTTAACACAAGGCCTTACCTACAAAGAGGGGGGCATGTACCTCTTGCGGTGTCCCCTCTGTGCAGGTGTACTTGTGTGTTGTGTGTGCATGCGGCTGTGGTTTAAAAGGGACTGTTA
  3   1   2       bld Brn3 5g3  in                         CAAK8716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCTGCTGGACAAAGATGACTTTTCCATACCTCCTCCAGATTACAATATGGCTTCAAGGGCCTTTCAACCACCTGGGAGCACATTCAAGCCCAGACCTTACAGTGTGGCTGCACCGGTTTTCTCACAGGGTATAGAAGATTATGGAGCAGCACGTCCCACAAACAGCGGCAATGGCACAATGATATCCACTGTGTGAGGAGAGACTTGCACAGGCACCTGCTGCTTTGGAGAATATTCGTCTTTCTTACCCTTTTCTTTTCTTATTTATAACTATGGAGTTTATTTTATTTATTTTTTTTTAACTCTTGTACTTTCTGTAATTCATTTCCTTTTGGTATTTGAATGATCTCTGTGCTCAGTAACCTTTGCTTTGCTGGAGGTATCTGTAATCTGTTGCATAGCAGTAATTGGGGGTCATTCCAGCATCCCATTGGTTAGGCATTTCTGGTGCTGCTTGGTTTTTATCTTCCTGATGCTTTTTTTGGGCTTATTTGTTTTTAGGAAGGGGTTTTCAGTGCAGGAACTGCCAATCAGTGTGGCTGTAATTACTGAACATAAAGAGCTGTTTTCTTACTGGCTTTTATACCAATTTTTAAATAGCATTGCTGTCACATTTTTGGGGCTTAACACAAGGCCTTACCTACAAAGAGGGGGGCATGTACCTCTTGCGGTGTCCCTCTGTTGCAGGTGTACTTGTGTGTTGTGTGTGCATGCGGCTGTGGTTTAAAAGGGACTGTTATTCCATCTTTAAGATCATCACCAGACCTTTACCTGTATGAGCGAATCGGAGAATCCAATCAGAACCGAGAGAATCTCTTTCCAAATTTCTTTTTTAGCTGCAGCATCC
  5   1   2       bld Egg       in                   TEgg071d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGATTATGGAGCAGCACGTCCCACAAACAGTCTGGAAGCTGAAGTTGCGAGGTTTTGAGAGGTGCCTCCAGTTAAAACTTTTTTACTGAAGTCCGACTGAAACCGACAGTGACAAATGACAGATCAGCTCCGCTTGTGAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTTCAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTGTCACAGGCAGCTCGGCTTCGGCTCTCTCATATACTTCCTGGTCTGGAGTGAGCTCCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTGACTGTAGAGAATGGTGGAGGAGGTGTCTACTGTACATGCCTGATTGAT
  3   1   2       bld Egg       in                    TEgg071d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTGAAACCGACAGTGACAAATGACAGATCAGCTCCGCTTGTGAAGTGATACATTAGGCCTTTATTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTTCAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTGTCACAGGCAGCTCGGCTTCGGCTCTCTCATATACTTCCTGGTCTGGAGTGAGCTCCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTGACTGTAGAGATGGTGGAGGAGGTGTCTACTGTACATGCCTGATTGATTTCCATTGCAGCAGTGTGGCAAGCATGGGTGTCAGACACCTCTTCGGCCATCTTATTAGGCAAAGAGAGAAGGAGGGCTTAGCAGGGACAGGGGGGCAGAGCTTCACACTGGGCTGGGGGGTAGCTGGGAGGGCTGCAGTTGGGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGGTTGTGTTTTAATAAATTATTTGATGTTCATAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg041d12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGTGACAAATGACAGATCAGCTTCCGCTTGTGAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTACAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTATCACAGGCGGCTCGGCTTCGGCTCTCTCATATACTTCCTAGTCTGGAGTGGGCACCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTAACTGTAAAGATGGTGGAGGAGGTGTCTACTGTACATGCCTGATTGATTTCCATTGCAGCAGTGTGGCAAGCATGGGTGTCAGACACCTCTTCGGCCGTCTTGTTAGGCAAAGAGAGAAGGAGAGCTTGGCAGAGACAGGGGGGCGGGGCTTCACGCTGGGCTGGGGGGTGGCTGAGAGGGCTGCAGTTGAGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTTGNTGTTTTAATAAATTATTTGATTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg055i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTGATACATTAGGCCTTTATTTGCTTCTACAGACTCTTTATAGCAGTGTATCCTTAGGGATGTCATTAGCCTGTACTGGCGCATGAAATTAGATGGATGCCAGGCAGTAATGACTGATAAGAGACTTGCTCCATATAGCGCTGCTCAAGCTTTAACCAGATTTAAGGGTATCAATCCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTACAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTATCACGGGCGGCTCGGCTTCGGCTCTCTCATATACTTCCTAGTCTGGAGTGAGCACCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTAACTGTAGGGATGGTGGAAGAGGTGTCTACTGTACATGCCTGATTGATTTCCATTGCAGCAGTGTGGCAGGCATGGGTGTCAGACACCTCTTCGGCCATCTTATTAGGCAAAGAGAGAAGGAGGGCTTAGCAAAGACGGGGGGGCAGAGCTTCACGCTGGGCTGGGAGGTGGCTGGGAGGGCTGCAGTTGAGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTTGTGTTTTAATAAATTATTTGATGTTCAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA018n14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTATCAATGCCAGTGCCTTTATCCTTCGAGGCACGTGTAAGTCCAGTCTATTGACCGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTTCAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTATCACAAGCGGCTCGGCTTCGGCTCTCTCATATGCTTCCTAGTCTGGGGTGAGCTCCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTAACTGTAAAGATGGTGGAAGAGGTGTCTACTGTACATGCCACACTGCTGCAATGGAAATCAATCAGGCAAGCATGGGTGTCAGACACCTCTTCGACCGTCTTATTAGGCAAAGAGAGAAGGAGAGCTTAGCAAGGACAGGGGGGCAGAGCTTCACGCTAGGCTGGGAGGTGGCTGAGAGGGCTGCAGTTGAGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTTGTGTTTTAATAAATTATTTGATGTTCATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg013e20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGTCATGGGCTGAGCTGGTTCAAATGTATAATTTAGGGATTGGGGCGGTTCTGAAAGGATAAGTATGCCTTTTATCATATAAGCCCTTACAAAGACTATACAGCCCCCAGAATAACACAGATTTTTCTCTCATGTAGATGCTGTATCACGGGCGGCTCGGCTTCGGCTCTCTCATATACTTCCTAGTCTGGAGTGAGCACCTCCCCCTTTTCTTTGCTGAGCTCTCCTCTCTCTAACTGTAAGGATGGTGGAGGAGGTGTCTACTGTACATGCCTGATTGATTTCCATTGCAGCAGTGTGGCAGGCATGGGTGTCAGACACCTCTTCGGCCATCTTGTTAGGCAAAGAGAGAAGGAGGGCTTGGCAGGGACAGGGGGGCGGAGCTTCACGCTAGGCTGGGGGGTGGCTGGGAGGGCTGCAGTTGAGTTACTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTCGTGTTTTAATAAATTATTTGATGTTCAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7                                 XZG52289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGAGCTCTCCTCTCTATAACTGTGATGATGGTGGAAGAGGTGTTTACTGTACAAACATGATTGATTTTCATTGCAGCAGTGTGGCAAGCATGGGTGTCAGACACCTCTTGGGCCATCTTGTTAGGCAAGGGGGGAGGGAGACCTTGGCGGAGACAGGGGGTCAGAGCTTCACGCTGGGCTGGGGGGTGGCTGGGAGGGCTGCAGTTGGGTTGCTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATCCTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCGCTTTTATGCTTATATAATCTAAAAGTTTGTGTTTTAATAAATTATTTGATGTTCATATTCCACATTATTACCTTTAAACAGCGAATGCAATATGACATTAGCCAGCACATACAGTCATTGGGGATACAAAGATGGAATGCAAAATAACAATTGTATATAGGTGCACACTGGCTCTTTAGTGTCTGCAGTAATGTATATAGGGATATAATCCACACAGGTTCTCTTTGTACACAAATCCAGGGAATGGGCTCTACAATGGTAATACTGTCCAGGAAAGC
  5   1   2       bld Tad5      out                        XZT54900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTGAGGGGGCTGCAGTTGAGTTACTTGTCATACAGTATTTACACAAGACTGAATAATGTGAGAAATATGTTATTCTGGGCACTATGTAGAGTCATTTTAGAAATAGTAAAAACAGGTTTATTTATACTTTAAAAGGTGGCTGCTGTCAGGGAGTTTAGCTATAACACAGAAATTTCACTTTTATGCTTATATAATCTAAAAGTTTGTGTTTTAATAAATTATTTGATGTTCATATTCCACATTATTACCTTTAAACAGCGAATGCAATATGACATTAGCCAGCACATACAGTCATTGGGGATACAAAGATGGAATGCAAAATAACAATTGTATATAGGTGCACACTGGCTCTTTAGTGTCTGCAGTAATGTATATAGGGATATAATCCACACAGGTTCTCTTTGTACACAAATCCAGGGAATGGGCTCTACAATGGTAATACTGTCCAGGAAAGCAATGATGCCCCGAGCTGGCTGTGTTCATGTCTTTGGTGCAGTGTTAACTCCCTACATGTTACTGGACTTGTCCTTCCAGCAGGAGCCATTATTATTCTAATGTCCTGTATAATGTAATAGCATGGAGCTTGTTGCTGGGCAACACTTGCAATAGAAAGGGAAGGCCTCCACTGGGAGGTATACAGAATATTTTTTATTTAAATGACATTATTTTATATACTAAGAAAGGAAGTGGGGAGGGTTCAGTAGGGCTATCATTACTTTTGCTGCAAGGTTACAGTAACCAGCTTTTACATAttanaggaaaactaaaccctaaaaataaatatggttataaatgtcatattttatatactgaCTGCACCAGCCCAAAGGTTCATCATCTCTATATT
  3   1   2       add Egg       in                    TEgg016i18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATATGTTATTATGGGCATTATGTAGAGTCATTTTAGAAATAGTAATAACAGGTTTATTTATCCTATAAAAGGCGGCTGCTGTCAGGGAGTTTAGTTTTAACACAGAAATTTCTCTTTTATGCTTATATAATCTAAAAGTTAGCGTTTTAATAAATTATTTGATGTTCATAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)