Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 216.0    0Xt7.1-EC2CAA43CC05.5                        2 PI      100       507      619                Pax6 [Branchiostoma floridae]

 This cluster: approximate FL confidence score = 98%

 1012077348 Xt7.1-CABG11449.3.5 - 45 ESTs
                                                                       ....-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABG11449.3.5                                                       AGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGT
                                                  Xt7.1-CHK-1008226260                                                             TTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTG
                                                      consensus depths                                                            2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    10    10    11    11    12    12    11    11    10    10    10    12    10    12    11    13    11    13    11    13    11    13    11    13    12    14     9    12     9    12     9    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9    10    10     9     9     8     8     7     7     5     5     5     6     5     6     5     6     6     7     6     7     6     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     5     8     4     7     4     7     5     7     5     7     4     7     4     7     4     7     4     7     6     9     6     9     6     9     8    10     8    10     8    10     8    12     8    13     8    13     8    14     8    14     8    14     8    15     9    16     9    16    10    17    10    17    12    18    11    19    11    20    12    20    12    21    13    21    16    23    16    23    16    23    16    22    17    22    17    22    18    22    17    22    18    22    18    22    18    22    18    23    16    23    17    24    17    24    17    24    16    23    17    24    17    24    17    24    17    24    17    24    16    24    17    24    17    23    15    22    16    22    16    22    16    22    15    22    16    22    14    21    14    20    13    19    11    17    11    17    11    17     7    14     6    13     6    13     6    11     6    11     6    11     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     8     5     7     5     7     5     7     5     6
  5   1   2  SIG                                    Xt7.1-TTbA062p17.3                                           TACAGACTGATTAGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTT
  5   1   2  SIG                                     Xt7.1-CABG11449.3                                                                                                                                                                   GGGGATTCAACCTGCCAGGTCTCAGCCGTCAAGCAAAGAAAGTGCTGGGAAGCCCAAGGCCATGTGAATCTCTTTCTCCCGGGCTTCAACAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGT
  5   1   2  SIG                                       Xt7.1-CCAX446.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCAGGCTAATATATGTATATTTTATTCTGGCCATTACAATTCGTGGGATATTTATCGCGAAATAACTGTGAGAATGGCAAATTACCTTTCAGGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATACCAAACTTTTATTCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCCCTTATACCGATTAAAGTGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------A-----
                                               BLH ATG     382    1567                                                       
                                               BLH MIN     382     293                                                       
                                               BLH MPR     382     293                                                       
                                               BLH OVR     382     794                                                       
                                               CDS MIN     382     293                                                       
                                               ORF LNG     382     111                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 5e-007     NP_010177.1 Regulation of phosphate metabolism; Pho2p [Saccharomyces cerevisiae] -----------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN -== Br ==== 5e-048     CAB42656.1 amphipax1 protein [Branchiostoma lanceolatum] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ==== 8e-051     XP_800234.2 PREDICTED: similar to paired box protein Pax-2 alpha isoform [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ==== 3e-100     NP_001024570.1 Variable ABnormal morphology family member (vab-3) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 5e-106     BAB85207.1 Pax6 [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 4e-120     NP_524638.3 CG11186-PA [Drosophila melanogaster] -------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bf ---- 3e-146     CAA11364.1 Pax6 [Branchiostoma floridae] ------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bb ==== 1e-147     ABK54278.1 Pax6 [Branchiostoma belcheri] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 0          NP_571379.1 paired box gene 6a [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_038655.1 paired box gene 6; small eye; Dickie's small eye [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 0          NP_990397.1 PAX6 protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_000271.1 paired box gene 6 isoform a; Paired box homeotic gene-6; paired box homeoticgene 6 (aniridia, keratitis) [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          NP_001006763.1 paired box gene 6 (aniridia, keratitis) [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001079413.1 similar to paired box gene 6 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAB36681.1 paired-type homeodomain Pax-6 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABG11449.3.5                                                  TGA------------------------------------------------------------------------------------ATGATG------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------ATG---------------ATG---------------------------------------ATG---------------------------------------------------------ATG---------ATG------------ATG---------------------------------------------------------------------------------ATG------------------------TAA---------TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------TGA------------ATGATG---------------------TAGATG---------------------TGA------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------------------------------------TAATAA---------------------------------------------------------ATG------------------------------------------------TAG---------ATG------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2  SIG                                    Xt7.1-TTbA062p17.3                                           TACAGACTGATTAGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTT
                                                  Xt7.1-CHK-1008289688                                                 CTGATTAGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTGT
  5   1   2       ext TbA  5g3  in                   TTbA062p17.p1kSP6                                           TACAGACTGATTAGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCANGTGTCCAACGGCTGTGTGAGTAAGATCTTANGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAG
  5   1   4      seed Gas8 5g3  in                         st114h05.5p                                                                    AGGCAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCNAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAANAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTG
  5   1   2       ext Gas8      in                          st54k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACC
  5   1   2       ext Eye       in                         CCAX8928.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAAATTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATAT
  3   1   2       ext TbA  5g3  in                    TTbA062p17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCTAGTTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGANTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTAAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas8 5g3  in                         st114h05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTNCAAGTG
  3   1   2       ext Gas8      in                          st54k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTG
  3   1   2       ext Eye       in                         CCAX8928.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTGTA
  5   1   2  SIG                                     Xt7.1-CABG11449.3                                                                                                                                                                   GGGGATTCAACCTGCCAGGTCTCAGCCGTCAAGCAAAGAAAGTGCTGGGAAGCCCAAGGCCATGTGAATCTCTTTCTCCCGGGCTTCAACAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGT
                                                  Xt7.1-CHK-1008289686                                                                                                                                                                         TCAACCTGCCAGGTCTCAGCCGTCAAGCAAAGAAAGTGCTGGGAAGCCCAAGGCCATGTGAATCTCTTTCTCCCGGGCTTCAACAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTG
  5   1   1           Neu0 FL                     IMAGE:6992220.FL-MGC                                                                                                                                                            GGTGTGTGCACTGTGTAGCCGGGCTCTCTCCACTCCCATACACTCTGCTGCTCCCCCACTGACAGCCCATCTTATTGTCAGTCTCTGTCTCCTTCCCAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGAAAAAAAAAAAAAAAA
  5   1   0       chi TbA       in                   TTbA022f07.p1kSP6 TACAGACTGATTAGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGAGCACGTCCCTGCGACATTTCTCGGATTCTGCAGAGCCATGCAGATGCAAAAGTCCCAGTGCTGGATAGTCAAAACGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTA
  5   1   2   13  add Tad5 5g3  in                         XZT68349.5p ...........................................ACAGACTGATTAGTGGGTTTGAAAGGCAAGGCCATTCTCAGCCTCATTTCCCGCTCTGGGGAAGGAGCAGGGAGGAAGTGTTTGTGCAGGAGGATGATGACAGGGGTCAGTCTCTGCTAATGGGCCAGTAAAGAAGATTGGAGGCGAGGCACAGGGAGCAGACACACACACACACACACTAATACTCTCCAACCATCACCAATCAGCCAAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGT
  5   1   2       ext HdA  5g                       THdA030b06.p1kaSP6                                                                                                                                              CAGATCCTTCTGTAAAGAACTGGGGATTCAACCTGCCAGGTCTCAGCCGTCAAGCAAAGAAAGTGCTGGGAAGCCCAAGGCCATGTGAATCTCTTTCTCCCGGGCTTCAACAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGAGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCGATCGGTGGCAGTAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGNGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGC
  5   1   2       add Neu0 FL                            IMAGE:6992220                                                                                                                                                             GGTGTGTGCACTGTGTAGCCGGGCTCTCTCACTCCCATACACTCTGCTGCTCCCCCACTGACAGCCCATCTTATTGTCAGTCTCTGTCTCCTTCCCAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGGACCTGGGGGACCCCCCTAN
  5   1   4   12 seed Tad5 5g3  in                         XZT48236.5p ..................................................................................................................................................................GGGGATTCAACCTGCCAGGTCTCAGCCGTCAAGCAAAGAAAGTGCTGGGAAGCCCAAGGCAATGTGAATCTCTTTCTCCCGGGCTTCAACAGGATCCAGACACCCAGCCTCCCTGGGAGAAACTGCCATTTCTTTGCCTTTTCTGCCCACTGGAAGGGAAGGGGGGAATCAGCTCTGCAGATCAGACTCTCCCCCGGCAGCTGCACAGAGGATCTAGCGAAGAAGGGATGCACCAAGTAGTCCTAGGGGGAAATCACTAGGCGCACATCGACAGATGCTGGGAATTACACAGGCCCTTGGAAGAGAAGCAGAAAAGCTATCCAGAATCCCATCCATAAACCACGTGGGACCCGGCGGCGACTCAGAGATGCAGAACAGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCT
  5   1   2       add Tad5                                 XZT31505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGCTCGAACAAGTCGATTTGTCAGGAGTCTGCGAGAGAGAGAGGATCTCCCCAGATTTGGGCTTAATATAAACCCTCCAGGTCACAGCGGAGTCAATCAACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAANATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAA
  5   1   2       ext Tad5      in                         XZT12658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCACTCGGGGGAGTGTTTGTGAACGGCCGACCCCTGCCCGACTCCACCAGGCAGAAGATCGTGGAACTGGCGCACAGCGGCGCACGTCCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAGATCTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAAACAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCCATAGCAGTAGTTTCAGTACGAGCGTCTACCA
  5   1   2       add Tbd1      in                         CBXT2205.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTAGGGAGATATTACGAGACTGGATCGATCCGACCCAGAGCGATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGATAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAGTGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTG
  5   1   2       ext Eye       in                         CCAX7914.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGACTGGATCGATCCGACCCAGAGCAATCGGTGGCAGCAAACCCAGAGTAGCCACCCCAGAAGTGGTTAGCAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCT
  5   1   2       ext Eye       in                         CCAX5726.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGATAGCCCAGTATAAAAGAGAGTGCCCTTCCATCTTTGCATGGGAAATCCGAGACAGGTTGCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTATCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACA
  5   1   3        nb Tad5      in                         XZT10671.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTATCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGNGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCA
  5   1   3        nb Eye       in                         CCAX1673.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTTATAAAGACGGACAGACTGGCAACAAAGGACTTGTTCACGC
  5   1   2       ext Sto1      in                        CABG11449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCCACANGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTT
  5   1   2       add Neu                            TNeu019p17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAACTTCGAAACCANANAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCNCCCATTGGTCATG
  3   1   0       chi Tbd1      in                         CBXT2205.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGCTTTACAATGGGCAACAACCTACCTATGCAAGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATATTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAAAAAAAAAAAAA
  3   1   2       ext Sto1      in                        CABG11449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTAAAA
  3   1   0       chi HdA       out                   THdA013o08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATAAGTGGATTTCCGTCAACCTCCCCTCCTTGGAGGTGGGGACCGAAGAGGAGGACCATCCCCTTATGATGATAATGGGTTGGAGCATGAAAAGGTTGAGGTCTTTTTTGGGGATATTGGCGGGCCGGCTTTTACAACACAAGTAGCCTTTCCCAAAGATTTAGGCGGGTAGGTATTTGGCAAAGCTGTTGTCAGAATACAAAAGTTTTTTTCCAATATGGGGCCCATCCTCAAAACAAGAATTTCCAGAGATAGGCTAGAGATATCAATTCATTCCCCAATTTTTCTTTTTAGGTACAAGGATCAACGTTCCATTTTTGTTTCAAACCCTTTGGTAGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTTAGAAATCTCCCAGAACGATTTCTTTAATAAAGTTCATTTCATTTTTATCTGAAAAAAAAAAAAAAAAAAGCGCC
  3   1   4      seed Tad5 5g3  in                         XZT48236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCAAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCCCGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGG
  5   1   3        nb Neu                            TNeu100d15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATG
  3   1   2       ext Eye       in                         CCAX7914.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGAC
  5   1   3        nb Neu                            TNeu012c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCC
  3   1   2       add Tad5 5g3  in                         XZT68349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGTTTTTTTTAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGAATGCATCATGGACTTTTTGCCCATGGAAGGCGTTATATCAGTTGGAACAAATTTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGGCTGCATAGATGGATTTTCCCCCCCCTTGGTCATGAAACAGAATTTTTTTTTCTTAAGGAACCCATGATCAAGCCCAGAATTTAAAGAGATAGCCAAGGGATATCAATTCCTTTTACAATTTTTTTTTTTTGGTACAAGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTGGGGGCCTTTAACCACCACCCCCTCCTAAATTTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTTGACCCTTCTTTTCAAAAACATTAAAATAAGACAAAGAAGAAAACCCCGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTTTTCGATATAATCCAAATTGTTTTATGTCGGGAAAAGTATGTTTTTGTTTTCCCTAGAAATCTCCCA
  3   1   2       add TbA       in                    TTbA022f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCNCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATGAAAAAAAAAAAAA
  5  -1   3        nb Neu                            TNeu118o10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGAAAAAAAA
  3   1   3        nb Gas8                                  st52c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAAGGCGTTATATCAGNTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAACA
  3   1   3        nb TbA                             TTbA042p03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAATCTTCATTTTGATATCCAAACTTTTATCCATTGGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGAGGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTTTTCGATATAATCCAATTTGTTTTATGTCGAGAAAAGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTTTATAATAAAGTTCATTTCATTTTTATCTGACGAGGAATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTGGGTCGGGGAATCGTTTAATGGTTCCTGGATAGTGGTAGGATAGGTTCAGGGTCCAATCATCCTGGGGCATGGGGCTCATCCCTTATACCGATTAAAGGGCTGGGGGGGGTTTTCATCTTAAGGGTTTTCAAGTGGTTTACGGGGACATATGGGGATTAACC
  3   1   3        nb Tad5      in                         XZT10671.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTACTATTTGTAAATTGACATTTGCATGGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGGTCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTT
  3   1   3        nb Eye       in                         CCAX1673.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTGTA
  3   1   2       ext Eye       in                         CCAX5726.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTTAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTGTA
  3   1   2       ext Tad5      in                         XZT12658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTGCAATTTTTCTTTTTTGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTGGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCCTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTCCAAAAACATTAAAATAAGACAAAGAAGAAACCCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATTTAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCC
  5   1   3        nb Neu                            TNeu023h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTGT
  5   1   2  SIG                                       Xt7.1-CCAX446.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCAGGCTAATATATGTATATTTTATTCTGGCCATTACAATTCGTGGGATATTTATCGCGAAATAACTGTGAGAATGGCAAATTACCTTTCAGGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATACCAAACTTTTATTCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCT
                                                  Xt7.1-CHK-1008289690                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTAATATATGTATATTTTATTCTGGCCATTACAATTCGTGGGATATTTATCGCGAAATAACTGTGAGAATGGCAAATTACCTTTCAGGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATAxCxAAxTTTTATCCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTG
  5   1   2       ext Gas8 5g3  in                          st20a03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGATTCGGTGGTAGCCTCTGTTTCAAACAAGCGTCTCTCAGGCTAATATATGTATATTTTATTCTGGCCATTACAATTCGTGGGATATTTATCGCGAAATAACTGTGAGAATGGCAAATTACCTTTCAGGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTG
  5   1   4      seed Gas8 5g3  in                          st19a03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATTCGGTGGTAGCCTCTGTTTCAAAACAAGCGTCTCTCAGGCTAATATATGTATATTTTATTCTGGCCATTACAATTCGTGGGATATTTATCGCGAAATAACTGTGAGAATGGCAAATTACCTTTCAGGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGAAAAGCAACAGATGGGCGCCGATGGCATGTACGACAAGCTCAGGATGCTGAATGGGCAAACTGGGACCTGGGGGACCCGGCCAGGGTGGTACCCCGGCACCTCGGTACCTGGCCAGCCAGCACAGGACGGGTGTCAGCCGCAAGAAGGAGGAGGAGGAGGAGAAAACACAAACTCAATCAGCTCCAATGGCGAAGACTCAGACGAGGCCCAAATGAGGCTTCAGCTGAAGAGAAAATTACAAAGGAACAGAACATCTTTTACCCAGGAACAAATAGAGGCCCTAGAAAAAGAATTTGAACGAACACATTACCCCGACGTGTTTGCCAGGGAAAGATTAGCTGCCAAAATCGACCTGCCAGAAGCAAGAATACAGGTATGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGC
  5   1   2       ext Eye       in                          CCAX446.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGTTCTCCAACAGAAGAGCAAAATGGAGAAGGGAGGAAAAACTTCGAAACCAGAGAAGGCAGGCCAGTAACACACCCAGCCACATTCCCATTAGCAGTAGTTTCAGTACGAGCGTCTACCAGCCAATCCCACAGCCTACCACACCAGTGTCCTCTTTCACATCGGGTTCCATGCTGGGCAGAACGGACACAGCATTGACAAACTCCTACAGTGCGCTGCCACCTATGCCTAGTTTTACAATGGGCAACAACCTACCTATGCAACCCCCTGTACCCAGCCAGACATCCTCCTACTCATGCATGCTGCCCACAAGTCCATCTGTGAATGGGCGGAGCTATGACACATACACACCTCCCCACATGCAGACACATATGAACAGCCAGCCAATGGGCACATCTGGCACCGCCTCTACAGGTCTCATTTCCCCTGGAGTGTCAGTCCCAGTTCAAGTACCCGGCAGTGAACCTGACATGTCTCAGTACTGGCCAAGACTACAGTAAAAACCGTGTTAATTTAACCAATGACTTTATGGAAAACAGTTGGATGTTCAGCAGTATTTTATAAAGACGGACAGACTGGCAAACAAAGGACTTGTTCACGCCGATGTGCGTCAGATACGTGGACTGTTGGAAGGACTGCATCATGGACTTTTTGCACATGGAAGGCGTTATATCAGTTGGAACAAATCTTCATTTTGATATCCAAACTTTTATCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAAC
  3   1   2       ext Eye       in                          CCAX446.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAACAAATCTTCATTTGATATCCAAACTTTTATCCCATTTGATGTACTATTTGTAAATTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTTCAAGTTGTTTACAGCGACATATCGAGATTAACCATTGTTGATTGTA
  3   1   4      seed Gas8 5g3  in                          st19a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATCCAAACTTTTATCCATTNGATGTACTANTTNGTAAANTGACATTTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCATCCTTGTGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTTGCGAGAGTTTTCATCTTAAGTGTTTCAAGTGT
  3   1   2       ext Gas8 5g3  in                          st20a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTATGTTATGATGAATAGAACAACGCGGACTGCATAGATGGATCTACCCCCCCATTGGTCATGAAACAGAATTTTTTTTCCAATAAGGAACCCATGATCAAGCCAAGAATTAAAAGAGATAGCCAAGAGATATCAATTCCTTCTACAATTTTTTCGGTACATGGATCAACGTTCCATGTTTGTATCAACCCCTTTGGTCGGGACCTTTAACCACCACCCCTCCTAAATCTTTCCTTGGTACCCCCCGCCCCCAAAAAAGTCGACCCTACTTTACAAAAACATTAAAATAAGACAAAGAAGAAAACCACGAAGAGAGACGTTTGGTAGATGAAAGGTAGATTGTGTCTTCGATATAATCCAATTTGTTTTATGTCGAGAAATGTATGTTTTTGTCTTCCCTAGAAATCTCCCAGAACGATTTCTATAATAAAGTTCATTTCATTTTTATCTGACGAGGATATTGTATAGATGTTTTATACACATTTTCATGCATCGCTCATTTCTTTTTCGGTCAGCGAATCGTTTAATTGTTCCTAGATAGTTGTACGATATGTTCACGGTCCAATCANCCTTGNGCATAGAGCTCATCCCTTATACCGATTAAAGTGCTNGCGAGAGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)