Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CACX1439.3                           15 END     1           1        6                MGC82338 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012077514 Xt7.1-TNeu111o05.3 - 52 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                             2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     5     7     5     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     7     9     7    10     7    10     7    10     7     9     7     9     7    10     7    10     6    10     6    10     6    10     5     9     4     8     4     8     4     7     4     7     4     7     4     7     4     7     4     7     4     7     5     8     5     8     5     8     5     8     5     8     5     7     5     7     5     7     5     6     5     6     5     6     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     8     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     5     5     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     6     6     5     6     5     6     6     7     7     8     8     9     7     8     8     9     8     9     8     9     8     9     8     9     9    10     9     9     8     9     8     9     9    11     9    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    11    11    12    12    12    12    13    13    13    14    13    15    13    15    14    16    14    16    16    18    16    18    17    21    17    21    17    20    17    20    18    21    18    21    18    21    18    21    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    18    21    18    21    17    21    18    21    11    22    20    22    14    23    15    24    15    23    15    23    15    23    15    23    15    23    14    22    14    21    13    17    17    18    12    18    12    18    12    18    11    18    13    19    14    20    14    20    14    20    15    22    15    22    15    22    16    22    14    22    16    22    16    22    16    22    15    21    15    20    14    20    13    20    13    20    13    19     3     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAGGTTATATTATATAGTGCATTGCTGTACATGCACTCTCCTTGCTTCTCTATAAGTTACAACCTTGATTCCTACAATCCCCA
                                               BLH ATG     194    1969                                                                        
                                               BLH MIN     194     234                                                                        
                                               BLH MPR     194     234                                                                        
                                               BLH OVR     194     944                                                                        
                                               CDS MIN     194     234                                                                        
                                               ORF LNG     194     146                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 4e-015     NP_014824.1 Homolog of human WASP, proline-rich protein; Las17p [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN -== Ce ==== 4e-044     NP_506615.2 F43D2.1 [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dm ==== 5e-104     NP_788082.1 Cyclin K CG15218-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 3e-128     XP_001195649.1 PREDICTED: similar to Cyclin K [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 3e-161     NP_003849.2 cyclin K [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PREDICTED = Dr ==== 0          XP_697908.1 PREDICTED: similar to cyclin K [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 0          NP_033962.1 cyclin K [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PROTEIN === Gg ==== 0          NP_001026380.1 cyclin K [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH93550.1 MGC115029 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 0          NP_001089373.1 hypothetical protein LOC734423 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xt ==== 0          NP_001072323.1 hypothetical protein LOC779776 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu111o05.3                                                                                                  TAG---------------ATG---------TAGTGA---------------------------------TGA------------------------------------------------TAG---------TGA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------ATG---TAA---------------------------------------------------TAA------------------------------TAA------------------------------------TAA---TAG------------------TAA---------------------ATG---------------TAG---TAG------------------------------------------ATG---------------------------------TAA------------------------TAGATG---TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TAA---------TAA------------------------------TAG------------------------ATG------------------------------------------------------------ATG------------------------ATG------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATG------------TGA------------------TAG---------------------TGA------------------------------------------------------------------TAA---------------------------------------------------------------TAA---------------------------------------------------TAA---TGA---------------------------TAA---------------------------------------TAA------------------------------------------------TAG---------TGA------TAG------------------------------------TAG------TAA------------------TAG---------------ATG---------------------TGA---------------------------------------------------------------------ATG------------------------------------------------TGA------TAA------------------------------------------------------------------------------ATG------TGA---------------ATG---------------------------------------------TAA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   1         - Neu                            TNeu092c24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTCTaaagtggagtgaagcatttctggtgatgttgcccagagaaaccaaacagcaattagatttcagcagttagaaaaccaaagcaaagcatctgattggctgttataagcaatatcaccagtaagttttactccactttttacacagcatgataaatatacCCCTAAGTCTAATCTCTAGGTAAGCATGATCCCAGCTGAAGGGGATTGTGAGGGTTTCCAATTGCAGGATTGCTAATGAGATCTGACCATTTCCTTAATATGCTCTGTTAATCCTATTTAGTTTGTGCACCACACTGTCCCTACAGTGGGAGCCAGAAATCATAGCTGTGGCAGTTATGTATCTTGCTGGAAGGCTGTGTAAGTTCAAATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAGCAGTTTGTCCAAGATGTTCCTGTTGATGTGCTTGAAGGTATATTTATTTGTAATGCAGTAGTTGCATATTTGTTGGATGGAAAAACTTTTGCACACCAGAAAATTTTGTGTCCCAAATTTGTCACATAGACCAAGCGTTACCCACTGCAGTCAGAGGTAGAATAAAATAAAACCACACCATTATTTTACACTATTTTCTTATG
  5   1   1         - Te5       in                        CAAO12550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTGTAAATGACAGTTTGTGCACCACACTGTCCCTACAGTGGGAGCCAGAAATCATAGCTGTGGCAGTTATGTATCTTGCTGGAAGGCTGTGTAAGTTCGAAATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAGCAGTTTGTCCAAGATGTTCCTGTTGATGTGCTTGAAGACATTTGTCATCAAATCCTTGATTTATATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCCGCAAACCTCCCCTCAGGTTCAGGCACAAATAGCTTCAGTTCAGCCTCAACAGCAGACCCAAAATGCAGATCTCCAAACAGCTCCTCAAAAAGAACAGCAACAGACCACATCCCAACAGCCCAAGAAGCCTTCTCCTCAGTCAAGCCCTCCAAAGCCAGTGAAGCGACCTTTGCCTACTTCACCAAAAGATGATAGCAAAGTAATAGAACAACCACTACCTAAACTATCAAAAATTGAGATCTCGCATCCACCTTTACCTCCTGTTCTTCCTCCACCAGAACGAANACCTCTGGTCCCTAGTATTGCTGTGAGCGAAGGAGATCCTGCAGTTGCTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGC
  5   1   1         - Gas8                                  st17e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGTTTGTGCACCACACTGTCCCTACAGTGGGAGCCAGAAATCATAGCTGTGGCAGTTATGTATCTTGCTGGAAGGCTGTGTAAGTTTGAAATACAGGAGTGGACATCAAAGCCACTTTACAGAAGATGGTGGGAGCAGTTTGTCCAAGATGTTCCTGTTGATGTGCTTGAAGACATTTGTCATCAAATCCTTGATTTATATTCTCAAGGAAAGCAACAGATGCCTCATCATGGAGCTCAGCAAACCTCCCCTCAGGTTCAGGCACAAATAGCTTCAGTTCAGCCTCAACAGCAGACCCAAAATGCAGATCTCCAAACAGCTCCTCAAAAAGAACAGCAACAGACCACATCCCAACAGCCCAAGAAGCCTTCTCCTCAGTCAAGCCCTCCAAAGCCAGTGAAGCGACCTTTGCCTACTTCACCAAAAGATGATAGCAAAGTAATAGAACAACCACTACCTAAACTATCAAAAATTGAGATCTCGCATCCACCTTTACCTCCTGTTCTTCCTCCACCAGAACGAAAACCTCTGGTCCCTAGTATTGCTGTGAGTGAAGGAGATCCTGCAGTTGCTTCAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGCTCCTGTTCACCAGCCTCCACCTATACCTCATAGACCGCCACCTCCTCCACCTGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCA
  3  -1   1       chi Fat1      out                        CABC6228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTATAGGTTATATTATATAGTGCATTGCTGTACATGCACTCTCCTTGCTTCTCTATAAGTTACAACCTTGATTCCTACAATCCCCAGGATACTCCTGTTTTGACAGTTTCCCCTCTGGTTCCAGGTTATGCAGTTTCATGTGATACCTGTTAATAATACAAAAGCAATATATGATGCAACAGAATCTAAAACTATGTATTTTGTACAGTCATACACAAGACTTTATTCCCCTGTGTACAGTGTATATTAGATATATGTTTCTTTTTAAGTAAAGAACCTATAATTCAGCATTTATTTGTTGCTTTTATGACCCCTTTAACATGCAACACCTTTTAAAATAAAAAAAACCTTTAAAAAAAAAAGAATCTTTCTGTTTTAGTTAGTGGTTTTACTTTGCAGTAAGTGAAGTACTTATTTGTGATTTTGCCAGAAAATTCATAAACGGTGGTCTGTGTGCTGCCATACAGTCCTGAAACAGAAAATTCCAGATTTAACTCCCAATACAATTTCAAATCCATAAGGGAAGGTTTACATGTCTGTATATGATTAATCATTTACCTTATCTCCTTTTTAGATGGGAGTGCAGGTTGTTGATGCTTCAGTTGCAGGTTTGGGAGGATGCCCATATGCTCAGGGAGCTTCAGGGAATGTGGCAACTGAAGATGTTGTGTATATGCTGCATGGTCTTGGAATTCAAACAGTGAGTATTCAGTGTTCTTTTGCACTTTATATCTTTGCCTTTATGCTTTCTAAAATAGTGATTTTGGAGCTAGAGTCTCTTATGACAACTACCTTATGTTATAATCTCATATACTGTAACTTATTCATAGGAGGTCTGGTTGTAGATTTTGGTCCAGTCAACATGATTTTCTCTCTCTTACACATGCTAAGTAAATAAGTGAGAGTACTAAAGTACTGGTCTCTTCACA
  5   1   1         - Neu       in                   TNeu111o05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAACCTCCCCTCAGGTTCAGGCACAAATAGCTTCAGTTCAGCCTCAACAGCAGACCCAAAATGCAGATCTCCAAACAGCTCCTCAAAAAGAACAGCAACAGACCACATCCCAACAGCCCAAGAAGCCTTCTCCTCAGTCAAGCCCTCCAAAGCCAGTGAAGCGACCTTTGCCTACTTCACCAAAAGATGATAGCAAAGTAATAGAACAACCACTACCTAAACTATCAAAAATTGAGATCTCGCATCCACCTTTACCTCCTGTTCTTCCTCCACCAGAACGAAAACCTCTGGTCCCTAGTATTGCTGTGAGCGAAGGAGATCCTGCAGTTGCTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGCTCCTGTTCACCAGCCTCCACCTATACCTCATCGACCGCCACCTCCTCCACCTGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCAACTTATGGAAGTCTCCCCCCTACTTATGGGCCCCCTGCTCATTTGCCCTATCATCCTCATGTCTTTCCACCTAATCCT
  5   1   1         - Tbd1      in                         CBXT6756.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCAGTGAAGCGACCTTTGCCTACTTCACCAAAAGATGATAGCAAAGTAATAGAACAACCACTACCTAAACTATCAAAAATTGAGATCTCGCATCCACCTTTACCTCCTGTTCTTCCTCCACCAGAACGAAAACCTCTGGTCCCTAGTATTGCTGTGAGCGAAGGAGATCCTGCAGTTGCTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGCTCCTGTTCACCAGCCTCCACCTATACCTCATCGACCGCCACCTCCTCCACCTGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCAACTTATGGAAGTCTCCCCCCTACTTATGGGCCCCCTGCTCATTTGCCCTATCATCCTCATGTCTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCACCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTTTATCCACCACCTCCAGCATACAACCCCAATTTTCCTCCTCCTAGACTGCCACCCACTCATACAGTTCCCAGTCATCCCCCTCCAGGAATTGCCATGCCACCAACCTCCTATCCTCCTCCTGCTGTCCCACCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAGCTTTTCACTG
  3   1   1         - Te5       in                        CAAO12550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACGAAAACCTCTGGTCCCTAGTATTGCTGTGAGCGAAGGAGATCCTGCAGTTGCTTTAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGCTCCTGTTCACCAGCCTCCACCTATACCTCATCGACCGCCACCTCCTCCACCTGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCAACTTATGGAAGTCTCCCCCCTACTTATGGGCCCCCTGCTCATTTGCCCTATCATCCTCATGTCTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCACCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTTTATCCACCACCTCCAGCATACAACCCCAATTTTCCTCCTCCTAGACTGCCACCCACTCATACAGTTCCCAGTCATCCCCCTCCAGGAATTGCCATGCCACCAACCTCCTATCCTCCTCCTGCTGTCCCACCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAAGCTTTTCACTGCAGGGGGAGAGTTTTAATCCCTGATTACATTTTTTTATTGCCCATCATAAAAACACTGGTTAATACCAATTAAAAAAGCAGCTTTCTAAAACT
  5   1   1         - Tad5      in                         XZT67463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGCAGTTGCTTCAGAACCAGCAGAACATACAAAGATCCAGATTCCTCCTCCAGCCCATCCTGCTCCTGTTCACCAGCCTCCACCTATACCTCATAGACCGCCACCTCCTCCACCTGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCAACTTATGGAAGTCTCCCCCCTACTTATGGGCCCCCTGCTCATTTGCCTTATCATCCTCATGTCTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCACCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTTTATCCACCACCTCCAGCATACAACCCCAATTTTCCTCCTCCTAGACTGCCACCCACTCATACAGTTCCCAGTCATCCCCCTCCAGGAATTGCCATGCCACCAACCTCCTATCCTCCTCCTGCTGTCCCACCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAAGCTTTTCCCTGCAGGGGGAGAGTTTTAATCCCTGATTACATTTTTTTTATTGCCCATCATAAAAACACTGGTTAATACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTTCTTAGC
  5   1   1         - In60                            IMAGE:8952066.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACCTAAATTACAAAAGATTACATAAAAAACAAAACGTCCCCTCATCGACCGCCACCTCCTCCACCTGCTAGCTATATTACGGGGATGTCTACAACCAATTCATACATGTCTGGAGAGGGTTACCAGAGTTTACAGTCCATGATGAAGACTGAAGGGCCAACTTATGGAAGTCTCCCCCCTACTTATGGGCCCCCTGCTCATTTGCCCTATCATCCTCATGTCTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCACCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTTTATCCACCACCTCCAGCATACAACCCCAATTTTCCTCCTCCTAGACTGCCACCCACTCATACAGTTCCCAGTCATCCCCCTCCAGGAATTGCCATGCCACCAACCTCCTATCCTCCTCCTGCTGTCCCACCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAAGCTTTTCACTGCAGGGGGAGAGTTTTAATCCCTGATTACATTTTTTTATTGCCCATCATAAAAACACTGGTTAATACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACACGATGCAAAATGAAAATACATAATGTAAGCTTCATATATGGAAATAGAGCTCTATCTATCATAGATGTCTATATAATTTACTCTCAGTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTTGTCCCAACACATGTAG
  5   1   1         - Neu5      in                         ANHP1714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAACTTATGGAAGTCTCCCCCCTACTTATGGGCCCCCTGCTCATTTGCCCTATCATCCTCATGTCTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCACCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTTTATCCACCACCTCCAGCATACAACCCCAATTTTCCTCCTCCTAGACTGCCACCCACTCATACAGTTCCCAGTCATCCCCCTCCAGGAATTGCCATGCCACCAACCTCCTATCCTCCTCCTGCTGTCCCACCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAAGCTTTTCACTGCAGGGGGAGAGTTTTAATCCCTGATTACATTTTTTTATTGCCCATCATAAAAACACTGGTTAATACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCCTTACCTC
  3  -1   1         - Int1      in                        CAAP11529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGCCCTATCATCCTCATGTCTTTCCACCTAATCCTCCACCCACTGTACCACCGCCACCACCACCTTCTTCATTCCCACCTCCTAACATTCCTCCTCCTACACCTGTTTATCCACCACCTCCAGCATACAACCCCAATTTTCCTCCTCCTAGACTGCCACCCACTCATACAGTTCCCAGTCATCCCCCTCCAGGAATTGCCATGCCACCAACCTCCTATCCTCCTCCTGCTGTCCCACCGGGTGGGCAGCCTCCTGTTGTACCTCCTCCAATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAAGCTTTTCACTGCAGGGGGAGAGTTTTAATCCCTGATTACATTTTTTTATTGCCCATCATAAAAACACTGGTTAATACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTAAATCTCTCCCCTTCAACTGTCAAAAAC
  5   1   1         - Ova1      in                        CABE12439.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGCCTCCTGTTGTACCTCCTCCATTCCACCACCTGGGATGCCACCAGTTGCAGGGCTGGGCCGTGCTGCTTGGATGAGATAACCATGCTTTCTTGCTATCATATCTAAGCTTTTCACTGCAGGGGGAGAGTTTTAATCCCTGATTACATTTTTTTATTGCCCATCATAAAAACACTGGTTAATACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTTAC
  5   1   1         - Ski1      in                        CABJ10709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCGATTCGTAATACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTG
  5   1   1         - Tbd1      in                         CBXT7414.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACCAATTAAAAAAGCAGCTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATTTTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTC
  5   1   1         - Ova1      in                         CABE2374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTCTAAAACTAGAAGAGACTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTC
  3   1   1         - Te4       in                         CAAN5688.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAAGTTTCTATAATTTACTGTCTACTGCAAGCAGATGTTTAATCCTTTGAAATAGTGTTAGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGT
  3   1   1         - Tbd1      in                         CBXT7414.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCTCTTTTCTTTAGCTTGTTGAAATGTGTACAAGGATGCAAAATGAAAATACATAATGTAAGCTTCATTTTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAA
  5   1   1         - Neu                            TNeu004c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAATGAAATACATAATGTAAGCTTCATATTATGGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGATATAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGGAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAAAGCAGGAATTCCACTTTACAACCACAGAGGGGGAAGCAGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTG
  5   1   1         - Tad5                                 XZT40833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGAAAATACATAATGTAAGCTTCATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGGT
  3   1   1         - Te1  5g3  in                        CBWN15150.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATATTATGGAAATAAGGAAGGCTTCTTAATCTTATCAATTAGATGTTCTAATATAAATTTACTCTTCAGTTCTTCAGTGCCCCCCCTTACCTCCCAGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTGGTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAA
  5  -1   1         - Int1      in                        CAAP11529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAATCTGTCCCACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTT
  3   1   1         - Neu       in                    TNeu111o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACATGTAGGCAAAGGGAGAGAAGACCACTGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTAAAAAAAAAAAAAAAAAA
  3   1   1         - Ski1      in                        CABJ10709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTGGGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATTGTNTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTATCAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTATTTCTGATATTGTATTATGTTTC
  3   1   1         - Ova1      in                        CABE12439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGGTCCATGTGCAAGCTGCATTTAGAGATTCATTTCATGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTT
  3   1   1         - Lun1      in                         CABD8885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGTGCAAGCTGCATTTAGAGATTCATTTCATGTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAACTTCAACAGT
  3   1   1         - Tbd1      in                         CBXT6756.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTAAGAAATGAAGTTCCTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATAATATGGAATGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTTTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAA
  3   1   1         - Sto1      in                         CABG7387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTATTTCCAAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTATCAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTATTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAAAAACTTC
  5   1   1         - Sto1      in                         CABG7387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTATTTCCAAGGGTGAAGTAGTATATTTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTATCAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTATTTCTGATATTGGATTATGTTTAAAAAAAAAAAAAAAAAAACTTCAAAAAAAAAAAAAA
  3   1   1         - Ova1      in                         CABE1857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAACTTCAACAGT
  5   1   1         - Ova1      in                         CABE1857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTGTCTTTATAATCTCTCCCCTTCAACTGTTCAAAAACAAGATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAC
  5  -1   1       chi TbA       out                  TTbA065c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTCCAAGGCTTGGGGGAACTGGTTGATTGCAGGTGGGACCTTGAGCCTTTTGTACAGGATGGCCTTTTGGGGCTGGAGTTTGAAGTAACGGGGCCATTTGACAAAGCGGGTCAGATCCCCCTTGGGCTGGATATTTTGACCAATGCCGAAGTTTTTTGGCCTTTTTTTGAACAGAGGGTTGACCCCCTTTTTGGCCTTGGCCTTTTTCACGACGGAAGGGGGGGGTGCCCCCTTTTTCCCCTTGGCCTTTTTCCCTTTAGGCATGGGAAAATAGTGTTGACGGGGCCGCTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTTAGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGTTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTTTTGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGGGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTATCAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTTTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAAACCCTGGCATTGAATTATTTCGGATATTGTATTATGTTTAAAAAAAAAAAAAAAAAAACTTCAA
  3   1   1         - Tad5      in                         XZT67463.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATACTTTCCAGCATATTGTAAGAATGTATATAACGGACTCCAGAAGTGTCTCTAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGTTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTATCAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTATTTCTGATATTGTATTATGTTT
  3   1   1         - Neu5      in                         ANHP1714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGCAACATCATAGGGGGATTTTAGTAAAAGGCTGATTATGGGGACTCTTGCAGCTTCAGATGCTATCTTGAAACTGCTTTCAACATTTGTATTCCTGCCTATGGCACTTGCTTTAGCCACCACCTTTATGCCCCCTTGCTACTGAGACCTAGAGCAGGAATTCCACTTTACAACCACAGAGGGGAAGCAGGCAAGGACTTGGAAAGCAGGTTTTTTGGGTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTT
  5   1   1         - Gas       in                   TGas065p07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGACGCGGCCGCTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAACTTCAACAGTATTTGTTTGTTTGTTTTGCTTATTTAGTCCCGGCATTGAGATATTT
  3  -1   1         - BrSp      in                    EC0CBA001BC04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTTTTTTGCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTCGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGAAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGGGCCTTAAGTAGGGCTCTTCAGTGCTTCCTGTAACATGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAAA
  5  -1   1         - Gas                            TGas013n20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATTTTGTTTATGCTTTGAATACTATGGACTGCTCCCTGTTGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACTTTTTTCCTGATTATTCTAAAACACTGGCATTGAATTAGTTCTGATATTGT
  5  -1   1         - BrSp      in                    EC0CBA001BC04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTTATGCTTTGAATACTATGGACTGCTCCCTGTCGAGAATATTTTGAAGCCATATTGGCTGAGATAAATGTATATATATGTTTGAGATTTCAGATGTTGGTTCTAGTCGGTAAAAAAAAAAAAAAACTGAAACCAAGTGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTTGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACATGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAA
  3   1   1         - Gas       in                    TGas065p07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAAAAAAAAAAACTGAAACCAAGGGACTTTTTCTTGTTTTCTTTGTTTTGTTCTTGGTAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAACTTCAACAGTATTTGTTTGTTTGTTTTGCTTATTTAGTCCCGGCATTGAGATATTTAGATATTTTGTGAAGCCGACTGTTGGCGCTTTGAGTTGTAGGTTTATTAATGGTTTTGGTTCGGGCATTAGTTTATAGAAAGGCAAATGCTAGCTAATTGCCCTTTGATTTGAGAATTATCTGCCAATCAATGTGTTGTGATACAGGTTTTCTTAATTTCTGTTCCACAGTTTTCAATATTTATGATAAAACCAGGTTGTGGTCTCCAGAGAGAGGATTGAAATAAATGGGAGTTGACTATTTaaagaaacaaaaaagaaaaaaaaaaaaataaaaaataaaaaaaaataaaaaaa
  3   1   1         - Ovi1                                 CABI6283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATACTGACTTTAACAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGGTCTTCAGTGCTTCCTCTAACACGCTTAGAGTGGCTGGCAATATCTAACTG
  3   1   1         - Ova1      in                         CABE2374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGACTTACAAAAATGCTTGTAAATAGGTTTTAATGGAAAGCAGAAATGTAACAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTAGTTCTGATATTGTATTATGTTTAAAAAAAAAAAAAAAACTTCAACAGTATTTGTTTGTTTGTTTTGCTTATTTAGTCCCGGCATTGAGATATTTAGATATTTTGTGAAGCCGACTGTTGGCGCTTTGAGTTGTAGGTTTATTAATGGTTTTGGTTCGGGCATTAGTTTATAGAAAGGCAAATGCTAGCTAATTGCCCTTTGATTTGAGAATTATCTGCCAATCAATGTGTTGTGATACAGGTTTTCTTAATTTCTGTTCCACAGTTTTCAATATTTATGATAAAACCAGTTGTGGTCTCCAGAGAGAGGATTGAAATAAATGGGAGTTGACTATTTTAAGTTTGGGATTTAGGTAATTCTTATGTAGCTCTCTTTCAATGTAGTTTCGTATTTTTCCATCCAAACATAACCATAAAGATGGCTACTTGACTGACTGGAGAATGCATGGAATGCTGGGATACAAGACAACTGAGAGTAATTTCTTGCTCTTCTTAAAGGGGATCTATTGCAAAAATTAAAATTTTAACATAAGCGTCATCTGACTTAAATAAGAAACTTTCTGAATCTCACCAATTAAAAATACCGTTTCTAAAAAT
  3   1   1         - Gas       in                    TGas127f11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAATGTATCAGCATATCCCTTTTGTTAACAAATGTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTATTTCTGATATTGTATTATGTTAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas       in                   TGas127f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAATGTATCAGCATATCCCTTTTGTTAACCATTTTGTGCCTTAAGTAGTGCTCTTCAGTGCTTCCTGTAACACGCTTAGAGTGGCTGGCAATATCTAACTGTGACCCTACACATTTTTTCCTGATTATTTCTAAAACACTGGCATTGAATTATTTCTGATATTGTATTATGTTT
  5   1   1         - Gas7      in                         XZG29731.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGTTTTGGTTCGGGCATTAGTTTATAGAAAGGCAAATGCTAGCTAATTGCCCTTTGATTTGAGAATTATCTGCCAATCAATGTGTTGTGATACAGGTTTTCTTAATTTCTGTTCCACAGTTTTCAATATTTATGATAAAACCAGTTGTGGTCTCCAGAGAGAGGATTGAAATAAATGGGAGTTGACTATTTTAAGTTTGGGATTTAGGTAATTCTTATGTAGCTCTCTTTCAATGTAGTTTCGTATTTTTCCATCCAAACATAACCATAAAGATGGCTACTTGACTGACTGGAGAATGCATGGAATGCTGGGATACAAGACAACTGAGAGTAATTTCTTGCTCTTCTTAAAGGGGATCTATTGCAAAAATTAAAATTTTAACATAAGCGTCATCTGACTTAAATAAGAAACTTTCTGAATCTCACCAATTAAAAATACCGTTTCTAAAAATAACCAAGTTACACTCTCCGCTCTCATGTGTCTCTTCATGCAGTAGGCAGAGTTTTGATACAAAAGGTTGTATTAAACCTGTCTAAGTTGCGCCTTTTCTCTAGAAGCTCACTCTTTCAAAATAACCAGCTTTGTTTCTCTACATGCAGGATTTGTGCTGAAGTTATTTTGTTTGTGTAGAAAGTAAGTTATTTGAGTTAACTGTAGCGTATCTGCTAGGAAAGGGA
  3   1   1         - Gas7      in                         XZG29731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTAAAAATACCGTTTCTAAAAATAACCAAGTTACACTCTCCGCTCTCATGTGTCTCTTCATGCAGTAGGCAGAGTTTTGATACAAAAGGTTGTATTAAACCTGTCTAAGTTGCGCCTTTTCTCTAGAAGCTCACTCTTTCAAAATAACCAGCTTTGTTTCTCTACATGCAGGATTTGTGCTGAAGTTATTTTGTTTGTGTAGAAAGTAAGTTATTTGAGTTAACTGTAGCGTATCTGCTAGGAAAGGGAGCCGCCCCCTCCACAAACATGTATCAGACTTGCCCATCAATCAAAATCTGACTCCAATTTCTATTTAAAAAAAAAAAAAGAGGTTGCTGAGAGGGGGGAAGTTAAGGGTAACTTATTGCAAAAGCGGTACAGAATTTTTTACTTGTGTATATTTAGTAAGTTACATATTTCAGTAAGACAAAGCTTGTATTATGTTTTCATTTTTGCAATAGTTCCCCCCCTAATGCTGTTCAGTGATCCAGCCTAAGCTCTGGTCTAATTCTGACAGAATCTTTGGAACATTGAGTTGCATCTGATGGACTTGATCTTCAGTACTTGGATCACATCTGCCTAGAAGAACGTTTGTAAAATTACTCCTACACCATGTGCACAGCTGCTACGTAGTTACCCAAGAGActtaaaagaacagtaacaccaagaaatgaaagtattttaaagtaattaaaatgtaatgcactgttgTAAAAAAAAAAAAAAAAGG

In case of problems mail me! (