Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR2183.3.5                         66 END     1           3        1                DKFZP434I116 protein isoform 1 [Homo sapiens]
     2   2.0    0Xt7.1-TEgg078g21.3.5                       60 END     1           3        1                LOC497000 protein [Xenopus tropicalis]
     3   2.0    0Xt7.1-TTpA035l20.5                         38 END     1           3        2                LOC446973 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012077551 Xt7.1-XZG50028.5 - 33 ESTs
                                                                       ...-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG50028.5                                                                                    CAGCAGAGAGGGTATAGGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACTCATCAAGATTTAGCCGGTTCACTGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTAGGGGACCCTGTTCGTCCTCTCTGCTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGGCAGTGGAGCAAATCTTGTATCCTCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAATGGGGTCAAAGATTTTTTTTTT
                                                  Xt7.1-CHK-1008227659                                                                                          AGAGGGTATAGGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACTCATCAAGATTTAGCCGGTTCACTGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTAGGGGACCCTGTTCGTCCTCTCTGCTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGGCAGTGGAGCAAATCTTGTATCCTCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAATGGGGTCAAAGATTTT
                                                      consensus depths                                                                                         2     2     3     4     6     8     8    10     7    10     9    11     8    13    12    14    12    15    11    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    13    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    12    13    11    12    12    13    12    13    11    13    11    13    11    12    11    12    11    12    11    12    11    12     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6     5     5     4     5     3     4     3     4     3     4     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     6     6     7     7     8     7     8     8     9    10    11    10    11    12    13    12    13    12    13    12    14    12    14    12    14    12    14    12    14    12    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    13    14    14    14    15    15    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14     9    10     2     2     2     2
                                                                   VAR                                                                                                                                                                                                CTTCATTAGTCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            T-----------
                                               BLH ATG     124    1160                                                                                    
                                               BLH MIN     124     171                                                                                    
                                               BLH OVR     124      42                                                                                    
                                               EST CLI      10      33                                                                                    
                                               ORF LNG     124       9                                                                                    
                                                                       PROTEIN --- Sc ---- 3e-010     NP_011403.1 TATA-binding protein-associated-factor; Taf6p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 2e-031     NP_524161.2 TBP-associated factor 6 CG32211-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 7e-091     XP_783285.1 PREDICTED: similar to TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 0          XP_685510.1 PREDICTED: similar to TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_006464.1 PCAF associated factor 65 alpha; TAF6-like RNA polymerase II,p300/CBP-associated factor (PCAF)-associated factor, 65 kD [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED = Mm ==== 0          NP_666204.1 RIKEN cDNA C530024J06 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAH73241.1 MGC80584 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 0          NP_001085716.1 MGC80584 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG50028.5                                                                                                                                                                                                                ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAG------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Neu  FL                     TNeu021e01.FL-Sanger                                                                                                              ATGATGGACTGGTTGCTGTTTCCACTATAGCTTGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACTCATCAAGATTTAGCCGGTTCACTGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTAGGGGACCCTGTTCGTCCTCTCTGCTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGGCAGTGGAGCAAATATTGTATCCTCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCTAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu  5g3  in                   TNeu054f05.p1cSP6                                              TGTCTCTGAAGGAAGGGGCGGGGCATAGCAGGAACCGGCAGCAGAGAGGGTATAGGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCCTATTTG
  5   1   2   14  bld Brn4 5g3  in                         CAAL6803.5p ...................................................................................CAGCAGAGAGGGTATAGGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCCTATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTNCAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTNGTAGTCATGATCTGGAACAGCTG
  5   1   2   24  bld Te5  5g                              CAAO6778.5p .............................................................................................GGTATAGGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCCTATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACA
  5   1   2       bld TbA  5g                        TTbA019d03.p1kSP6                                                                                                GACTGGTTGCTGTTTCCACTATAGCTTGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGGGCTCACTGTTCTTCATTAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTA
  5   1   2       bld TbA  5g                        TTbA020d03.p1kSP6                                                                                                  ACTGGTTGCTGTTTCCCTATAGCTTGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGGGCTCACTGTTCTTCATTAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTNCATGACCACTGGACCCTGCG
  5   1   2       bld TbA  5g3  in                   TTbA038i16.p1kSP6                                                                                                   AGGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCCTATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTNGCTAGGGGATGACCCACACCNTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTT
  5   1   2   30  bld Te1  PIPE out                       CBWN12089.b1 ...................................................................................................GGAAAGCAGGATGATGGACTGGTTGCTGTTTCCACTATAGCTAGTCATGTGTTATTCGCGAAATAAACGAGTAATTACATTGACGGGGGAGATAATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGGGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACTTAGATATGGTTAAAGTTGATTTGCTTGAACTATCAGCAAAATGCTGCAGTGACTTTGATTTAAAATCAGAGTTAGAAAGATC
  5   1   2       bld TbA  5g3  in                   TTbA045g21.p1kSP6                                                                                                      AAAGCCGGATGATGGACCGGTTGCCGTTTCCCCTATAGCTAGTCCTGTGTTATTCCCCACCAAAACCAGTAATTACCTTGACGGGGGAGATTATCCGAGTCTAGGGATGTCCCCCACCGAAGACCGAAGATATGTAGAGCTGTGTCCGGATTCCGTACGTTTAACCGCAGAGAGTGTGGGTCTGGATATCCCCGATGAGGTTGCTGCCTTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCCATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCCTATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCC
  5   1   2       bld Neu  FL                        TNeu021e01.p1kSP6                                                                                                             GATGATGGACTGGTTGCTGTTTCCACTATAGCTTGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATNTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCAC
  5   1   2   20  bld Thy1 5g                             CBST5112.fwd .....................................................................................................................CTGGTTGCTGTTTCCACTATAGCTTGTCATGTGTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCCAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGGGAAATCTGTTAGTCCTGATCTGGAACAGCTG
  5   1   2       bld TpA  5x3  out                  TTpA025j03.p1kSP6                                                                                                                                       TATAGCTAGTCATGTGTTATTCGCGACAAAGACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCGACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCCTATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTT
  5   1   2   12  bld Gas7 5g3  in                         XZG50028.5p .....................................................................................................................................................GTTATTCGCGACAAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGNGCTGGTCTTCTCAGCCCTATTTGGACTCATCAAGATTTAGCCGGTTCACTGTATC
  5   1   2   10  bld Mus1 5g3  in                         CABH6995.5p ......................................................................................................................................................CCATCGATTCGCAAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACTCATNCAGATTTAGCCGGTTCACTGTATC
  5   1   2   10 seed Ova1 5g3  in                         CABE2483.5p ..................................................................................................................................................................AAAACGAGTAATTACATTGACGGGGGAGATTATCAGAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAG
  5   1   2       bld Tad5      in                          XZT4519.5p                                                                                                                                                                          TTCCTTTAAGGGCTCACTGGTTCTTCATTAGTCTAGGGATGTCTCACACAGAAGACCGAAGATATGTAGAGCTGTGTCAGGATTCAGTACGTTTAACAGCAGAGAGTGTGGGTCTGGATATCACAGATGAGGTTGCTGCATTACTTGCTGAAGATGTATGCTACAGACTCCGAGAGCTTACCCAGTTCAGTGCACAATGTCTTAGACACTCACGGAGGCGCAGGCTGACAGTGGAGGATTTTAACCGGGCTTTGCGATGGAGCAATGTGGAGGCAGTATGTGGCCACGGATCACCAGATTCAGTAACTTACCGCAGTATTAAAGATGGAGATTGCCACTACACTGAGGACCGAGAAATCAACTTGGTGGAATTGGCACTGGCAACAAACATTCCTAAAGGCACACCAGAGACTGCCGTTCGAGTTCATGTCTCATATTTGGATGGCAAGGGGAACTTGGAGCATCAGGGAACAGTTCCTGCAGCAGTCTCACTTCTGACAGATGACCTACTAAAGTATTACCAGCGTGTCACACGAGCTGTGCTAGGGGATGACCCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATT
  5   1   2       bld Tad5      in                         XZT36802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACACCTCATGAAGGTTGCTCTTCAAGATTTGCAGACAAATTCAAAGATTGCTGCCCTTTTACCATACTTTGTTTATGTTGTAAGTGGGGTGAAATCTGTTAGTCATGATCTGGAACAGCTGAGTCGCCTCTTACAGTTGGTGCGGTCTCTACTTTGGAACCCCTTTCTGTACCTGGGCTACTATGGTTGCAGTCTTATGCAGAGTGTCCTTTACTGTGTCACAGAGCCTCTTGCTGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACTCATCAAGATTTAGCCGGTTCACTGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTAGGGGACCCTGTTCGTCCTCTCTGCTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGGCAGTGGAGCAAATCTTGTATCCTCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGGACCCAAA
  5   1   2       bld Thy1      in                        CBST9828.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTTCTATTAATCCACTCAATGACCACTGGACCCTGCGAGACTATGGGGCTGGTCTTCTCAGCCTTATTTGGACTCATCAAGATTTAGCCGGTTCACTGTATCCACAAATATTGCAGTCTCTACAGAAAGTGCTAGGGGACCCTGTTCGTCCTCTCTGCTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGGCAGTGGAGCAAATCTTGTATCCTCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCAT
  3   1   2       bld Mus1 5g3  in                         CABH6995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGAAAGTGCTAGGGGACCCTGTTCGTCCTCTCTGCTCTCATTATGGAGCTGTAGTGGGACTGCATGCCTTAGGATGGAAGGCAGTGGAGCAAATATTGTATCCTCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCTAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTGCCTCTCGCCCTAT
  3   1   2       bld Ova1 5g3  in                         CABE2483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTCCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCTAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACC
  3   1   2       bld Tad5      in                         XZT36802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCCCTACCTATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATCCCATGTCTAATGCACAAGTCAANGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACC
  3   1   2       bld Neu  5g3  in                    TNeu054f05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGGGCTGGGTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCCTCCAATCTGCTCACCCCCCNTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAGGCAGAACTTTCACTCTATCTGCCATTGTAGTTTCTGGGTGGGGTAAAAGGCACTGCAGAGTGCTAAATTTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA038i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTGCAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCCCAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTTTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTTTTATTAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGTTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn4 5g3  in                         CAAL6803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAAAACTGTGTTAGATGATCATTCCATGTCTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTT
  3   1   2       bld Te1       out                        CBWN5945.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAATGCACAAGTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACGCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT14381.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCAAAGCAGATGGACACAAGGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAA
  3   1   2       bld Thy1      in                        CBST9828.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAAAGCAGATGGACACAAAGTGTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACC
  5   1   2       bld Tad0      in                     NISC_no09g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCTAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCTTCTCGCTATGCCCAAAAATTGCCTATGAT
  3   1   2       bld Tad5      in                          XZT4519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATGGAGCCATTCTAGTGGCAGTAGAACGTCTCCTCAAGATGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATCTGCTCACCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTT
  3   1   2       bld HdA                           THdA036o15.q1kaT7w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAAGAGGAAAGCTCGTTCATCTGATTTAACTTCATCTGTTGCACCTTCGTTAGACAACCCCTCAATNTGCTCACCCCCCCTCTGTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTTTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCGGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTGGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTATACCAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TbA  5g3  in                    TTbA045g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTACCCTTACTAGAGATGTACCGTGAACTGTACTGCTTCTTTGGAGACAGCCTAGCTGTGCGTTTTGGAACAGGAGGAAACCAATCACATCATGGTGGGGCACCACAGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCTTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTCTGCTGCATCAAGGCTTAGAGGGACATCCAGACAGGGGCAGAGAACACAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7 5g3  in                         XZG50028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAACACACAGGAACCCAAAAAAGAATGTACTGGGGATGGGACAAGAAAGATGCCTCAACTCACTGCCCATGGAGAAGAAGAAGCAGTTACTGTGGGAAAACAATGTCAGCGCCCCACTCAGACGCAGATGTTTGCTGCATCAAGGCCTAGAGGGACATCCAGACAGGGGCAGAGAACCCAAGGTGTAAGAGAAGCATTCCAAAGAAGTAGACTGACACCCCGTGGAACACCACGTTTTACTTTCTTAATAGGGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACTAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAATGGGGTCAAAGATTTTTTTTTTTAGCCTATGTTGTGCAAATCTATATATCACTGTGTACACAGTCATTTCTGGATTTTCTTATGTCTTAAGTATATTAGTATACAATGTTACATACTTTGCTTTTGTTATATTGTGGAGAGATTTTTTTTATAGACTGGGCAGTTGGCCAAAAAAGAAAAAAG
  3   1   2       bld Tbd1      in                        CBXT14381.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAAGACAGGCTGGAAGAGGTGGAGGAGGACGCAGGTTTCAAAGTGTCTTCCAGTTGCATACAGGTCCTGGAGCTACAGCATCTCGCTATGCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAAAAAAAAAAAAAAA
  3   1   2       bld Tad0      in                     NISC_no09g01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCCAAAAATTGCCTATGATAGGAAGAGTGACCAGAGCTGGACGAAGGGTAGCACAAGCAGAACTTTCACTCTATCTGCCATTGTAGTTTGGATTACTAATTAAAAGGCACTGCAGAGTGCTAAATTTAATACCAATGGGGTCAAAGATTTTTTTTTTTTAGCCTATGTTGTGCAAATCTATATATCATTGTGTACACAGTCATTTCTGGATTTTCTTATGTCTTAAGTATATTAGTATACAATGTTACATACTTTGCTTTTGTTATATTGTGGAGAGAATTTTTTTATAGACTGGGCAGTTGGCCACATTATTAGTTTAGATGGTTTATATGGATAACATTGCAGGATGTCAGCTTTAAGAATGATGATTTTCAATTGGCTTTACTGTAGTTGTATACTTTACATTTATTTACATGAAATTTCGGTTTTaaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)