Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 86%

 1012077571 Xt7.1-XZT58003.3 - 26 ESTs
                                                                       ..-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT58003.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACTACTAGTCACAGCAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAAATTTGAACAGAATATTAACTGAAAAGTATCTTCTGATTATCCTTGATGCATACTCTCTGCCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTGTGGCATATATTTTCGGAGAGCTGAAGGGTGCTTGCCGAAGGTATGCGACATGGGCTCCTGCCTGTGCCTGCACCCGAGTGAATGGGGTACGCTAAGGCACATGAGGCCGAGGTACGCATAAAAACACTAGACTTTGCATTCTCTTGCGTTTTTGTGCAGATGTCTGCTACATGTGCCTGAACTTGAGCGCATTCCGTTCGTTCGGGTGCAGGCACAGGTGGGAGGAGTATGGTGGTATTTTCGGCAGCGATTTTCAGCTTGCTGGAAATATATGCCATTCACCTGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGTTATCAATTAAATAATTATTTGCACACAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228985                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGTCACAGCAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAAATTTGAACAGAATATTAACTGAAAAGTATCTTCTGATTATCCTTGATGCATACTCTCTGCCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTGTGGCATATATTTTCGGAGAGCTGAAGGGTGCTTGCCGAAGGTATGCGACATGGGCTCCTGCCTGTGCCTGCACCCGAGTGAATGGGGTACGCTAAGGCACATGAGGCCGAGGTACGCATAAAxACxCxAGACTTTGCATTCTCTTGCGTTTTTGTGCAGATGTCTGCTACATGTGCCTGAACTTGAGCGCATTCCGTTCGTTCGGGTGCAGGCACAGGTGGGAGGAGTATGGTGGTATTTTCGGCAGCGATTTTCAGCTTGCTGGAAATATATGCCATTCACCTGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGTTATCAATTAAATAATTATTTGCACACAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     2     3     3     4     4     5     5     6     6     6     6     6     6     6     8     6     8     6     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9    10    11    10    12    10    12    10    12    10    12    11    13    11    14     9    13    11    12    12    13    13    14    13    14    13    14    12    15    11    15    12    15    12    15    12    15    12    14    12    14    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    12    11    12    11    12    11    12    11    12     2     3     2     3     1     3     1     3     1     3     1     3     1     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     3     3     2     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                               BLH ATG      22     346                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN      40     122                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 1e-015     NP_010740.1 Phosphate metabolism; transcription is regulated by PHO system; Ppn1p[Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 4e-048     AAP91726.1 sphingomyelin phosphodiesterase 1 [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 4e-053     NP_729555.2 CG32052-PA [Drosophila melanogaster] ----------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ==== 2e-053     NP_505620.3 ZK856.5 [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ==== 3e-069     XP_692822.1 PREDICTED: similar to acid sphingomyelinase-like phosphodiesterase 3B isoform 1 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-070     XP_786766.1 PREDICTED: similar to acid sphingomyelinase-like phosphodiesterase 3B isoform 1 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 2e-082     XP_001232192.1 PREDICTED: similar to Sphingomyelin phosphodiesterase, acid-like 3B [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 4e-142     XP_701744.1 PREDICTED: hypothetical protein XP_696652 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 4e-159     NP_065586.3 acid sphingomyelinase-like phosphodiesterase 3a [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 3e-165     NP_006705.1 acid sphingomyelinase-like phosphodiesterase 3A [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          AAH91078.1 Unknown (protein for MGC:108398) [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT58003.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------TGA---------------------------------------------------TGA------------------------------------------------------TGA---------------------TGA---------------------------------------------------------------------------------------------------------------------------TAG------ATG---TGA------------------------------------------------------------------------------------------------------------ATG------------ATG------------ATG---TGA---TAA---------TAA------------------------------------------------------TGA------------------ATG---------------------------------TGAATG---------------------------------------------------------------------------ATG---------------TGA---TGA------------------------------------------ATG---------------------------------------------------------TGA---------TAA---------------------------------------TAA------------------------------TAA---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1           AbdN FL                     IMAGE:7024261.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Te5  5g3  in                         CAAO6827.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACACAACCGTCACTGGAACACTACTAGTCACAGCAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTT
  5   1   2       bld AbdN 5g                            IMAGE:7024656                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACTACTAGTCACAGCAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAANAGGTATACATTATTGCACATGTTCCAGTGGGGATATCTACCTTTTTGCAAGACTCACCCCCAGCTATGAAGGGAAACATTTTAATGGAAAGGCTGGGTCAAAA
  5   1   2       bld AbdN 5g                            IMAGE:7022662                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAGTCACAGCAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGAAAGACCCAGCCAAACAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGNTTCCAGTGGGGATATCTACCTTTTTGCAAGACTCACCCCAGCTATGAGGGGAAACATN
  5   1   2       bld AbdN FL                            IMAGE:7024261                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATAACATGGGAGTTCTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCT
  5   1   2       bld AbdN                               IMAGE:7021023                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGTGCCTGCTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAGTCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCAACTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTTCCTGTGAAGGAGAGTGAAGTTTACACAGCAGTTAGCAAAGTTTTTGGAAACCGTGGTTTAACAGAAAGAAGCCCCTTAGCCACTTTTCCGTTAAAGGGGGGTTATTTATTTCCCCCAGAATTTATTAAATCAAAACAAAAATCCTGGCCCACCTTCCTTTAACGGGATCCATTCAGTTTTTAAAAAAAACCCAAATCCTTTTTATTAAACACTTCCCCAAAACAAAAGGGGGGACACGGTGTAAAACCTTTGTAAACAAAAACCCCAAGGCCCCAAACCCAAATTTTTTTAAAAATGGGGCCTGGGGAAAAAAAACACACTTTTTTTTAAAAAAAAATCTTCCTCTCTGCGCCCCCAAAAAAACACAATTTGTGAAAAAAAAGGGGGTCACAACCCAACTTTTTTT
  5   1   2       bld TbA       in                   TTbA067m07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTACTTCTTGTCACTCCGCTGGTTATTTCAGCCATGCCCCTGAATCCAGAAGGCAATCCCACACAGGAAGAAACCGCAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTG
  5   1   2       bld Egg       in                   TEgg004g10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCCCTAACATGCCAGAAAAATATCACTAAGATTTTCATGCATTTTAGGGCAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAAC
  5   1   2       bld Egg                            TEgg082b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTCCCTAACATGCCAGAAAAATATCACTAAGATTTTCATGCATTTTAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTGATTTCATG
  5   1   2       bld Spl1      in                         CABK9163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCA
  5   1   2       bld Gas7      in                         XZG16641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTTCT
  5   1   2       bld Tad5      in                         XZT58003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCANATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCT
  5   1   2       bld Tad5                                 XZT24341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGA
  3   1   2       bld Spl1      in                         CABK9163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTTACGGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  3   1   2       bld Tad5      in                         XZT58003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCACCAAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld TbA       in                    TTbA067m07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGTGAACATGACAGACCCAGCNCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAG
  3   1   2      seed Brn2      out                       CAAJ16148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  3   1   2       bld Te5  5g3  in                         CAAO6827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTCCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  3   1   2       bld Spl2      in                        CBSS2464.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  5   1   2       bld Spl2      in                        CBSS2464.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTGCACATGTTCCAGTGGGATATNCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg004g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG16641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAGG
  5   1   2       bld TpA       in                   TTpA068f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAAATTTGAACAGAATATTAACTGAAAAGTATCTTCTGATTATCCTTGATGCATACTCTCTGCCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTATGGCATA
  5   1   2       bld Tail      in                         CBSW8295.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCGCCCTTTTTTTTTTTTTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAATTTGAACAGAATATTAACTGAAAAGTATCTTCTGATTATCCTTGATGCATACTCTCTGCCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTA
  5  -1   1       add In66                            IMAGE:8962362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTCATTTAAGAATTTTCGTTCGCCTTAACCAATGATTAATTAGTATCAGTTTGCCTGAAGCAACCTCTAATCAATGAATCTCATCGTCCAAAAAAAAAATTGAACAGAAATATACTGAAAGTTTCTTCTGATATCTGATGCATACTCTCTGCTTCTTTCTTACCTTTCCTGCTCACAGCCAACCAATATCATATTGTCACATTGCCTTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTGTGGCATATATTTTCGGAGAGCTGAAGGGTGCTTGCCGAAAATGTGCGGCATGGGCTCCTGCCTGTGCCTGCGCCCGAGTGAATGGGGTACGCTAAGGCACATGAGGCCGAGATACGCATAGAAACACTAGACTTTGCATTCTCTTGCGTTTTTGTGCGGATATCTGCTACATGTGCCTGAACTTGAGCGCATTCCGTTCGTTCGGGTGCAGGCACGGGTGGGAGGAGTGTGGTGGTATTTTCGGCGGCGATTTTCGGCTTGCTGGAAATATATGCCATTCACCTGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGATTTTAT
  3   1   2      shim Tail      in                         CBSW8295.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTGTGGCATGTATTTTCAGAGAGCTGAGGGGTGCTTGCCGAAGGTATGCGACATGGGCTCCTGCCTGTGCCTGCACCCGAGTGAATGGGGTACGCTAAGGCACATGGGGCCGAGGTACGCATAAAGACGCAAGACTTTGCATTCTCTTGCGTTTTTGTGCAGATGTCTGCTACATGTGCCTGAACTTGAGCGCATTCCGTTCGTTCGGGTGCAGGCACAGGTGGGAGGAGTATGGTGGTATTTTCGGCAGCGATTTTCAGCTTGCTGGAAATGTATGCCATTCGCCTGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGTTATCAATTAAATAATTATTTGCACACAAAAAAAAAAAAAAA
  3   1   1       add TpA       in                   TTpA068f20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAATGCAGATTAATACTATGTGTATGTTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGAtgatgccacaccaggcgtatggcatatattttcagaaagctgaaaagtgcttgccgaaaatatgcgacatgggctcctgcctgtgcctgcacccgagtgaatggagtacgctaaggcacatgaggccgaaatacgcataaaaacactagactttgcattctcttgcgtttttatgcagatgtctgctacatgtgcctgaacttgagcgcattccgttcgttcgggtgcaggcacaggtgggaggagtatggtggtattttcggcagcgattttcagcttgctggaaatatatgccattcacctGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGTTATCAATTAAATAATTATTTGCACACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)