Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 86%

 1012077571 Xt7.1-XZT58003.3 - 26 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     2     3     3     4     4     5     5     6     6     6     6     6     6     6     8     6     8     6     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9    10    11    10    12    10    12    10    12    10    12    11    13    11    14     9    13    11    12    12    13    13    14    13    14    13    14    12    15    11    15    12    15    12    15    12    15    12    14    12    14    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    12    11    12    11    12    11    12    11    12     2     3     2     3     1     3     1     3     1     3     1     3     1     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     3     3     2     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                               BLH ATG      22     346                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN      40     122                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 1e-015     NP_010740.1 Phosphate metabolism; transcription is regulated by PHO system; Ppn1p[Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 4e-048     AAP91726.1 sphingomyelin phosphodiesterase 1 [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 4e-053     NP_729555.2 CG32052-PA [Drosophila melanogaster] ----------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ==== 2e-053     NP_505620.3 ZK856.5 [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ==== 3e-069     XP_692822.1 PREDICTED: similar to acid sphingomyelinase-like phosphodiesterase 3B isoform 1 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-070     XP_786766.1 PREDICTED: similar to acid sphingomyelinase-like phosphodiesterase 3B isoform 1 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 2e-082     XP_001232192.1 PREDICTED: similar to Sphingomyelin phosphodiesterase, acid-like 3B [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 4e-142     XP_701744.1 PREDICTED: hypothetical protein XP_696652 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 4e-159     NP_065586.3 acid sphingomyelinase-like phosphodiesterase 3a [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 3e-165     NP_006705.1 acid sphingomyelinase-like phosphodiesterase 3A [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          AAH91078.1 Unknown (protein for MGC:108398) [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT58003.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------TGA---------------------------------------------------TGA------------------------------------------------------TGA---------------------TGA---------------------------------------------------------------------------------------------------------------------------TAG------ATG---TGA------------------------------------------------------------------------------------------------------------ATG------------ATG------------ATG---TGA---TAA---------TAA------------------------------------------------------TGA------------------ATG---------------------------------TGAATG---------------------------------------------------------------------------ATG---------------TGA---TGA------------------------------------------ATG---------------------------------------------------------TGA---------TAA---------------------------------------TAA------------------------------TAA---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Egg                            TEgg082b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTCCCTAACATGCCAGAAAAATATCACTAAGATTTTCATGCATTTTAGTTCTGGCACATTTCTGACTTACATTTGGACTTTTCTTATCACATTACTGAAGACCGTACCAAAGTTTGCTTATCTTCGAAGGGTGCCAAAGCTTCAAATCCTGGAATATTTGGAGATTTTGTGTGTGACTCCCCTTATGAATTAATTTTATCTGCAATTCAGTACATAAAAGACTCTCATCAAAAAGTGATTTCATG
  5   1   2       bld Gas7      in                         XZG16641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTCATCAAAAAGTTGATTTCATGATATGGACAGGTGACAGCCCACCTCATATTCCAGTGAAAGAACTTTCCACAAAAATTGTGATAGATGTGATTGGCAATATGACTTCAACCATTCGCAGCCTCTTACCTGATCTTCTTGTATTTCCTGCTCTTGGAAACCATGACTACTGGCCCCAGGATCAGCTTCCTGTGAAGGAGAGTGAGGTTTACACAGCAGTAGCAGAGTTTTGGAAACCGTGGTTAACAGAAGAAGCACTTAGCACTTTCCGTAAAGGGGGTTATTATTCCCAGATTTATAAATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTTCT
  5   1   2       bld Tad5      in                         XZT58003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCANATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCT
  5   1   2       bld Tad5                                 XZT24341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAACAAATCTGCTCACTCTTTACGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGA
  3   1   2       bld Spl1      in                         CABK9163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTTACGGGATCATCAGTTTAAATACCAATCTTTATTACACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCAACCAATTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  3   1   2       bld Tad5      in                         XZT58003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCCAAACAAGGTGACAGTGAACATGACAGACCCAGCCACCAAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld TbA       in                    TTbA067m07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGTGAACATGACAGACCCAGCNCAACCAATTTGAATGGCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAG
  3   1   2      seed Brn2      out                       CAAJ16148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGGAAGACACTTTAAAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  3   1   2       bld Te5  5g3  in                         CAAO6827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAATCTCTCGCCAAAACAATGAAAAGGTATACATTATTGCACATGTCCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  3   1   2       bld Spl2      in                        CBSS2464.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTATTGCACATGTTCCAGTGGGATATCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTC
  5   1   2       bld Spl2      in                        CBSS2464.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTGCACATGTTCCAGTGGGATATNCTACCTTTTGCAAGACTCACCCCAGCTATGAGGGAAACATTTAATGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg004g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAAGGCTGGTCAAAATATTCCGTAATTACAGTGATGTGATAACTGCACAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG16641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATTTTATGGGCACACTCACCGTGACAGCATTATGGTACTTTTAGATGAAAAAGAAAAACCAGTTGGCTCTGTGTTTGTTACACCAGCTGTCACACCAATAAGGTCTGCATTGGAGACAGATTCCAATAATCCAGGATTTCGGTTATATCAGTATGATACCACTGACTACCACTTACTTGATCTCTGGCATTATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAGG
  5   1   2       bld TpA       in                   TTpA068f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCTTAAACCTTACTGAAGCAAACTTAAAGAATGAGTCTTCATGGAATCTGGAATATATTATGACTAAAACATACCAAATAAAGGATCTGCAGCCAGAAAGTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGTCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAAATTTGAACAGAATATTAACTGAAAAGTATCTTCTGATTATCCTTGATGCATACTCTCTGCCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTATGGCATA
  5   1   2       bld Tail      in                         CBSW8295.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCGCCCTTTTTTTTTTTTTTTGGAAGGCCTTGTAAAAAGGTTTCAGCAGCCAGAAAGCATTGAATTTCTATACTATTACAAAAATTACTTGGTGAGCTTTGACTCAAGAGTTGGCTGTGATCCTCTCTGCAAGTTACAGCAAATATGTGCCATTCAATATGTAGATGAGGAATCCTATACAAAATGCATCATTGGGAGTAAGGAATTTAAATAGACAACATGTTGCTCTTGTAAGCATCTTAAGATTTTTCTGCCTGCCCTAAACCAATGATTAAATAAAGTATTCAGTTTTGCCCCTGAAAGCAAAACCCTCTTAATCAAATGAAATCTCATCCGTTCAAAAAAAAAAAAAAAAAAAAATTTGAACAGAATATTAACTGAAAAGTATCTTCTGATTATCCTTGATGCATACTCTCTGCCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTA
  5  -1   1       add In66                            IMAGE:8962362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTCATTTAAGAATTTTCGTTCGCCTTAACCAATGATTAATTAGTATCAGTTTGCCTGAAGCAACCTCTAATCAATGAATCTCATCGTCCAAAAAAAAAATTGAACAGAAATATACTGAAAGTTTCTTCTGATATCTGATGCATACTCTCTGCTTCTTTCTTACCTTTCCTGCTCACAGCCAACCAATATCATATTGTCACATTGCCTTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTGTGGCATATATTTTCGGAGAGCTGAAGGGTGCTTGCCGAAAATGTGCGGCATGGGCTCCTGCCTGTGCCTGCGCCCGAGTGAATGGGGTACGCTAAGGCACATGAGGCCGAGATACGCATAGAAACACTAGACTTTGCATTCTCTTGCGTTTTTGTGCGGATATCTGCTACATGTGCCTGAACTTGAGCGCATTCCGTTCGTTCGGGTGCAGGCACGGGTGGGAGGAGTGTGGTGGTATTTTCGGCGGCGATTTTCGGCTTGCTGGAAATATATGCCATTCACCTGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGATTTTAT
  3   1   2      shim Tail      in                         CBSW8295.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCTTTCTTACCTTTTCCCTGCTCCACAGCCAACCAATATCATATTGTCACATTGCCCTTACATTGTTTTTTCCTGGCAGATACAGAGCTGCAGCTGGATAAAGGCAGGTAGTCAAAGATGAAATGAAAAGTGGGGCAGTTTGCCACCACTAACAACTTGCTGCTCTTGGTCCAGATCTATCTCTATCTCTATGGCCTTTCCACAAAGCTGGGCCTAATTACAAGAATAGGGAAAATGCAGATTAATACTATGTGTATTGTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGATGATGCCACACCAGGCGTGTGGCATGTATTTTCAGAGAGCTGAGGGGTGCTTGCCGAAGGTATGCGACATGGGCTCCTGCCTGTGCCTGCACCCGAGTGAATGGGGTACGCTAAGGCACATGGGGCCGAGGTACGCATAAAGACGCAAGACTTTGCATTCTCTTGCGTTTTTGTGCAGATGTCTGCTACATGTGCCTGAACTTGAGCGCATTCCGTTCGTTCGGGTGCAGGCACAGGTGGGAGGAGTATGGTGGTATTTTCGGCAGCGATTTTCAGCTTGCTGGAAATGTATGCCATTCGCCTGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGTTATCAATTAAATAATTATTTGCACACAAAAAAAAAAAAAAA
  3   1   1       add TpA       in                   TTpA068f20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAATGCAGATTAATACTATGTGTATGTTTACAATGTTTTGAGTATAATTTATTTCCTAAGATTTTGCCTTAGAtgatgccacaccaggcgtatggcatatattttcagaaagctgaaaagtgcttgccgaaaatatgcgacatgggctcctgcctgtgcctgcacccgagtgaatggagtacgctaaggcacatgaggccgaaatacgcataaaaacactagactttgcattctcttgcgtttttatgcagatgtctgctacatgtgcctgaacttgagcgcattccgttcgttcgggtgcaggcacaggtgggaggagtatggtggtattttcggcagcgattttcagcttgctggaaatatatgccattcacctGATCTGACATTTGCCTTAACTCAGGCTGTGCACAACAGATACAAATATATTTCAGAATTAAAACCCATGCAAAGCTGGTCTTTGTGTAAAATAATTGTTATCAATTAAATAATTATTTGCACACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (