Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ5933.3                           32 END     3           8        9                natural killer-tumor recognition sequence [Homo sapiens]

 This cluster: approximate FL confidence score = 85%

 1012077594 Xt7.1-CABK9786.3 - 36 ESTs
                                                                       .....-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK9786.3                                                                                                                    AAAGCCCGACCGCAATGTTACTTCGACGTGGAGATTAATCGGGAGCCAGTTGGCCGCATTGTCTTTCAGCTGTTCTCCGATGTGTGTCCTAAGACATGCATGAATTTCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAAGCCCCTCGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGAGAGAAGTGGAGTAAAGGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAGAAATCCAAAAAGCTAAAGCATTCAAAGAAGCGCAAGCCGTCAAAAAAAGACCAGTCCCGTGGGCCCAAAGAGGAAGTAGGAAGTAGGAAATCAAAATCTTCCCAGGAAAGAATAAAAAGATCTTTATCGGTGTCCTCTCAAGACTCTTCCAAAAGACACCGGTCTAGATCCGACAAAGACAATTATTCCTCTGGTCATTCCAGCAGAGGCGCTCTCTCTGATTCTAGATCCAGATCGAGATCTTATTCAAGAGAGAGTGTAAGATCTAGAACAGGTTCCAGATCCTCCTCCCGCTCTAGGAGTGACTCAAGGGGCAGGTCTCCGGGGAAAGCTAGGTCAAGACACAGGAGCAGATCAAGGTCCGGTTCAAATTCAGTGACTCGGACGTCCAGTTCCAAGCAATTTAAAACTACACCCCACAAAAACAGAGAACCGCCTTTAGCAGAGAGCAAACCAGTTCCTGTGGCCGAACAAGGGAAACCCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAACTACGGAAAACATACCTGAGATTCCAATAAGTGACAGTCCGCCTCCTTCAAGATGGAAACCTGGACAGAAACCATGGAAACCATCTTATGAACGAATACAAGAAATAAAGGCCAAAGCATCAGACAAGTTGCCCTCACAAGGTAAACATACTGAAGGGGATACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAGAAGAAAAAAGAGAAGAAACGCAAAGCTCAGAAGAAGAAGCCCATGTTCCACTGGCAGCCTCCTTTAGAGTTCGGTGATGAGGAAGAGGAGGAAATGGTGACGGAGAAACCCGATGCTACGAAAAATGGTGTCACTGAAAAACACAATCAGGTTCAAGACAAGACTTTGGACGACATCACTCAGTCCTCTAGA
                                                  Xt7.1-CHK-1008227327                                                                                                                          CGACCGCAATGTTACTTCGACGTGGAGATTAATCGGGAGCCAGTTGGCCGCATTGTCTTTCAGCTGTTCTCCGATGTGTGTCCTAAGACATGCATGAATTTCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAAGCCCCTCGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGAGAGAAGTGGAGTAAAGGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAGAAATCCAAAAAGCTAAAGCATTCAAAGAAGCGCAAGCCGTCAAAAAAAGACCAGTCCCGTGGGCCCAAAGAGGAAGTAGGAAGTAGGAAATCAAAATCTTCCCAGGAAAGAATAAAAAGATCTTTATCGGTGTCCTCTCAAGACTCTTCCAAAAGACACCGGTCTAGATCCGACAAAGACAATTATTCCTCTGGTCATTCCAGCAGAGGCGCTCTCTCTGATTCTAGATCCAGATCGAGATCTTATTCAAGAGAGAGTGTAAGATCTAGAACAGGTTCCAGATCCTCCTCCCGCTCTAGGAGTGACTCAAGGGGCAGGTCTCCGGGGAAAGCTAGGTCAAGACACAGGAGCAGATCAAGGTCCGGTTCAAATTCAGTGACTCGGACGTCCAGTTCCAAGCAATTTAAAACTACACCCCACAAAAACAGAGAACCGCCTTTAGCAGAGAGCAAACCAGTTCCTGTGGCCGAACAAGGGAAACCCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAACTACGGAAAACATACCTGAGATTCCAATAAGTGACAGTCCGCCTCCTTCAAGATGGAAACCTGGACAGAAACCATGGAAACCATCTTATGAACGAATACAAGAAATAAAGGCCAAAGCATCAGACAAGTTGCCCTCACAAGGTAAACATACTGAAGGGGATACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAGAAGAAAAAAGAGAAGAAACGCAAAGCTCAGAAGAAGAAGCCCATGTTCCACTGGCAGCCTCCTTTAGAGTTCGGTGATGAGGAAGAGGAGGAAATGGTGACGGAGAAACCCGATGCTACGAAAAATGGTGTCACTGAAAAACACAATCAGGTTCAAGACAAGACTTTGGACGACATCACTCAGTCCTCTAGAAAAAGT
                                                      consensus depths                                                                                                                         2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     6     2     6     2     6     3     7     3     7     4     7     3     7     3     7     4     7     4     7     4     7     4     7     4     7     4     7     4     8     5     9     5     8     5     8     5     8     5     8     5     9     6     9     6     8     6     8     6     8     5     7     5     7     5     7     7     9     7     9     7     9     7     9     6     8     6     8     6     8     7     9     7     9     7     9     7     8     7     8     8     9     7     9     7     9     7     9     7     9     7     9     8    10     8    10     8    10     8    10     8    10     8    10     6     8     6     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     6     6     6     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     5     5     5     5     5     5     6     6     6     6     6     6     6     6     9     9     9     9    10    10    10    10    10    10    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    13    14    13    14    14    14    14    14    14    14    14    14    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    12    11    12    11    12    11    12     8    10     6     7     5     6     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      -9     334                                                                                                                    
                                                                                                         PROTEIN --- Ci ---- 2e-010     BAE06667.1 Retinoblastoma-binding protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                          PROTEIN === Br ==== 2e-043     AAQ24380.1 cyclophilin A; rotamase [Branchiostoma belcheri tsingtaunese] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                          PROTEIN === Sc ==== 4e-049     NP_013317.1 a cyclophilin related to the mammalian CyP-40; physically interacts with RPD3gene product; Cpr6p [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                           PROTEIN --- Ce ==== 7e-067     NP_509506.1 CYcloPhilin family CYP-8 (53.6 kD) (cyp-8) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PROTEIN --- Xl ---= 9e-080     AAH97565.1 MGC114713 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PREDICTED - ?? ---= 9e-080     NP_001089456.1 hypothetical protein LOC734506 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                           PREDICTED - Sp ---- 4e-093     XP_781217.2 PREDICTED: similar to Ppig protein [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN --- Dm ---- 5e-102     NP_733246.1 CG1866-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PROTEIN --- Dr ---= 5e-122     NP_998629.1 zgc:55535 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                 PREDICTED - Gg ==== 0          XP_418494.2 PREDICTED: similar to natural killer tumor recognition protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                 PROTEIN -== Xt ==== 0          CAL49421.1 natural killer-tumor recognition sequence [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                 PROTEIN --- Mm ==== 0          NP_035048.3 natural killer tumor recognition [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                 PROTEIN --- Hs ==== 0          NP_005376.2 natural killer-tumor recognition sequence [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK9786.3                                                                                                           ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG
                                                                   ORF                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2       bld Gas  FLt3                      TGas018h01.p1kSP6 ATCCCAGGATGCAACGCGGCGCAGAATCCACAGTGAGGGGAGAAGGAGGTGGAGCTTGCCAGGCGCCTGTCGCAGTGCCCGGGAACACGGTTCTTTCTAAGCCATCATGGGGGAGAAAGCCCGACCGCAATGTTACTTCGACGTGGAGATTAATCGGGAGCCAGTTGGCCGCATTGTCTTTCAGCTGTTCTCCGATGTGTGTCCTAAGACATGCATGAATTTCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGC
  5   1   2       bld HdA       in                   THdA011h06.p1kSP6                                GTCTGATTGTTTATTTTGGCCCTCTACTTTAGCCAATTGGTAATGATTGAATTGTCTCCCAAGTATACTTGGCTGTATTACATTTATTAGGAACATACCTATTTTACAGCAGGATTCAGCACCAATACCCATATGGGTCCCCATATACCCACCAGTGCAGGTTCTTTTTGTTTCCTTTCTGTTATATGTTTGGCACCTCTGCGTAGCCTGTCCTGGATTTTCACAAATAACAACTGATCTCTTTTTGTTGTCTTTTTCTTCTTTTTTTTTTTTTATTTGCTTTTTTTTTTTTCTTACCATATTTGTGAATTCAAAAAATGATTTCTCCATATTTCTTTTTATTTCCTTCTCTCTTTAATAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCTTGATTTCAGGGTTTGAATTGAT
  5   1   2       bld Neu  FLt3                      TNeu094i17.p1cSP6                                                     GAGCTTGCCAGGCGCCTGTCGCAGTGCCCGGGAACACGGGTCTTTCTAAGCCATCATGGGGGAGAAAGCCCGACCGCAATGTTACTTCGACGTGGAGATTAATCGGGAGCCAGTTGGCCGCATTGTCTTTCAGCTGTTCTCCGATGTGTGTCCTAAGACATGCATGAATTTCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCATGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAG
  5   1   2       chi Gas  5x                        TGas022h12.p1kSP6                                                                                   GGAACACGGTTCTTTCTAAGCCTCATGGGGGAGAAAGCCCGACCGCAATGTTACTTCGACGTGGAGATTAATCGGGAGCCAGTTGGCCGCATTGTCTTTCAGCTGTTCTCCGATGTGTGTCCTAAGACATGCATGAATTTCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGGTAAGGTTCAATCTGCGTTTCCCTCCTTACGTCCCCTTTAACGTGAATTATTCTAGCCGTTGCCCCTGCATACGATGAAGCCATAGATCGATTTCTTGCATGAACCTCATGTTGCATGAACCTGTCTATATGCATGAATTCCTCCTTAGTGGTTTATTTATTTTTAAATTTTTTTTTCTAGCTGCTTAACGTTTTTTTTTTTAGAAAGTGAGATCTAACTGTATTTGGTTAAACAGTGTCTTTTCTCAGCATGGAGGTTAGGCAACTTTTTTCATGAAAACTCCTATCTTCCTGCCTAAAACTGTCAACATATTC
  5   1   2       bld TbA                            TTbA060k10.p1kSP6                                                                                                TGGGGGAGAAAGCCCGACCCGCAATGTTACTTCGACCGTGGAGATTAATCCGGGAGCCCAGTTGGCCGCCATTGTCCTTTCCAGCCTGTTCTCCCGATGTGTGTCCCTAAGACATGCATGAATTTCCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACTATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTC
  5   1   2       chi Te4       in                         CAAN3148.5p                                                                                                                                                                                                                                                     CAGGATGCAACGCGGCGCAGAATTCCACAGTGAGGGGAGAAGGAGGTGGAGCTTGCCAGGCGCCTGTCGCAGTGCCCGGGAACACGGTTCTTTCTAAGCCATCATGGGGGAGAAAGCCCGACCGCAATGTTACTTCGACGTGGAGATTAATCGGGAGCCAGTTGGCCGCATTGTCTTTCAGCTGTTCTCCGATGTGTGTCCTAAGACATGCATGAATTTCCTGTGTCTGTGTACAGGTGAAAAGGGAATTGGAAAAGTGACCGGAAAAAAATTATGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAAATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTCAAAGATGAGAACTTTATTCTGAAACATGATCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAAACTGCTTCTGTGGAACCTG
  5   1   2       bld BrSp      in                     EC2BBA14CG10.g1                                                                                                                                                                                                                                                                                     GGGCTACAAGGGTTCCACCTTCCATCGAGTGGTTAAAAATTTTATGATTCAGGGAGGGGACTTCAGTGAAGGAGATGGCAAAGGTGGGGAGTCCATCTATGGCGGCTACTTTAAAGATGAGAACTTTATTCTGAAACATGACCGAGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACTACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCGGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCTGAGAGCGAGGCTGAAATCGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCTGGCAGGAAAGAGGAGGCCAGGGAGAAAAGCCCCTTGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAAC
  5   1   0       add TbA       out                  TTbA041h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                               TTCATTCTGCATTTCCCTCCTTACGTCCCCTTTAACGTGAATTATTCTAATCGTTACCCCTGCATACCATGAATCCATAGATCTATTTCTTGCATGAACCTCATGTTGCATGACCCTGTCTATATGCA
  5   1   2       bld Te3       in                         CAAM2082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCGTTCCTGTTGTCTATGGCTAACCGAGGGAAAAACACAAACGGCTCACAGTTCTTTATAACCACAAAAGCAGCTCCACATCTGGATGGTGTCCACGTGGTCTTTGGACTCGTGATTTCAGGGTTTGAAGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAAGCCCCTCGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCG
  5   1   2       bld Te5       in                        CAAO10626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGATTGAGCAGATTGAAAGCTTGAAGACCGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAAGCCCCTCGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGA
  3   1   2       bld Int1      in                         CAAP8204.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAA
  5   1   2       bld Int1      in                         CAAP8204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGACGCTGCCAGCCGGCCCTACGCAGATGTTCGAGTCATTGACTGTGGGCTGCTTGTAAGCAAGGCAGCAAGGGAAGAAAAAATAAAGAGAGCTGCGTCTCAATCAGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAA
  3   1   2       bld BrSp      in                     EC2BBA14CG10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAATAAAGAGAGCTGCGTCTCAATCGGAGGACTCCGACTCCAGTCTCAAATCCACGACACCCTCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCTGAGAGCGAGGCTGAAATCGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCTGGCAGGAAAGAGGAGGCCAGGGAGAAAAGCCCCTTGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGACGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAGTCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACGCCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCACTGGAGAGAAGTGGAGTAAAGGAGACAAACTTAATGACCGCCTTTCCGGTCAATGGGATGGAGGAAGTGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGAAGTAGAGAAAG
  3   1   2       bld HdA       in                    THdA011h06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCTCTCCCTCGTCATCTTCAGAGTCCACCTCTTCCGAGAGCGAGGCTGAAATAGAGAGGCATCGAAGGAAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAAGCCCCTCGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATTTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGAGAGAAGTGGAGTAAAGGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTATAAAAATCGCAAGAAGGAGAAGAAATTAAACATAAAAAAAAAAAAAAAAAGC
  5  -1   2       bld TpA                            TTpA062d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACCGgtgtacatgctcagttagtaagactatgaggaagcttcctgctgattggctaaaggtccccatatacgggcagatgcgtgccaagcaatgcgtgccaagcgagcggatcttcacccgatatccccacctatggatgggcgatatcggggagcgtttagTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGAGAGAAGTGGAGTAAAGGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAAAAAAAAAAAAAAGCGG
  5   1   2       bld Spl1      in                         CABK9786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAGAGGAAACGGAAAACCAAAGTTAAGCACTCAAAGCGGAGACGGAAGGAGTCCGGCAGAAAAGAGGAGGCCAGGGAGAAAAGCCCCTCGAGGGAGGAGCACAGTCCCCAGTCTGTTAAAAATCATCCAACAGAAGATAAAGATCTGACTGCGAAGAGGGAGAAACCGGTTGTTCGCCCTGAGGAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGAGAGAAGTGGAGTAAAGGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAGAAATCCAAAAAGCTAAAGCATTCAAAGAAGCGCAAGCCGTCAAAAAAAGACCAGTCCCGTGGGCCCAAAGAGGAAGTAGGAAGTAGGANATCAAAATCTTCCCAGGAAAGAATAAAAAGATCTTTATCGGTGTCCCTCTCAGACTCTTC
  3  -1   2       bld Ovi1      in                        CABI14325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATCCCGCCTGTGCCTGAGAATAGGTTTCTCCTGCGCAGAGATGCACCCGCGGCAAAGCCAGAGCCTGAACAGAAACCTGCTTCTGTGGAACCTGAAAAAAATGATCAGCAGAACGCACCACTCTCCAAATCTGGGAGGAGAATTCGGGGCCGTGGTACAATACGGTACCATACACCTCCTCGATCCAAATCTCGTTCAGAATCCGAAGAGGAAGGAGAGAGCAGCGAAACACCTCCTCATTGGAAAGAGGAAATGCAGAGGCTACGAGCCTACAAACCTCCCTCTGGAGAGAAGTGGAGTAAAGGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAGAAATCCAAAAAGCTAAAGCATTCAAAGAAGCGCAAGCCGTCAAAAAAAGACCAGTCCCGTGGGCCCAAAGAGGAAGTAGGAAGTAGGAAATCAAAATCTTCCCAGGAAAGAATAAAAAGATCTTTATCGGTGTCCTCTCAAGACTCTTCCAAAAGACACCGGTCTAGATCCGACAAAGACAATTATTCCTCTGGTCATTCCAGCAGAGGCGCTCTCTCTGATTCTAGATCCAGATCGAGATCTTATTCAAGAGAGAGTGTAAGATCTAGAACAGGTTCCAGATCCTCCTCCCGCTCTAGGAGTGACTCAAGGGGCAGGTCTCCGGGGAAAGCTAGGTCAAGACACAGGAGCAGATCAAGGTCCGGTTCAAATTCAGTGACTCGGACGTCCAG
  5   1   2       bld Neu                            TNeu042i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGACAAACTCAATGACCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACCTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAGAAATCCAAAAAGCTAAAGCATTCAAAGAAGCGCAAGCCGTCAAAAAAAGACCAGTCCCGTGGGCCCAAAGAGGAAGTAGGAAGTAGGAAATCAAAATCTTCCCAGGAAAGAATAAAAAGATCTTTATCGGTGTCCTCTCAAGACTCTTCCAAAAGACACCGGTCTAGATCCGACAAAGACAATTATTCCTCTGGTCATTCCAGCAGAGGCGCTCTCTCTGATTCTAGATCCAGATCGAGATCTTATTCAAGAGAGAGTGTAAGATCTAGAACAGGTTCCAGATCCTCCTCCCGCTCTAGGAGTGACTCAAGGGGCAGGTCTCCGGGGAAAGCTAGGTCAAGACACAGGAGCAGATCAAGGTCCGGTTCAAATTCAGTGACTCGGACGTCCAGTTCCAAGCAATTTAAAACTACACCCCACAAAAACAGAGAACCGCCTTTAGCAGAGAGCAAACCAGTTCCTGTGGCCGAACAAGGGAAACCCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAAC
  5   1   2       bld Ova1      in                         CABE8342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGGCGCCTTTCCGGTCAGTGGGATGAAGGAAGCGCATCACAGAGGTCAAGTTCCTGGTCACTTGATGGCTATCATTCTGATGGAAGTAGAGAAAGAGGTTCTCGCTCTAAAAATCGCAAGAAGGAGAAGAAATTGAAACATAAAAAGAAATCCAAAAAGCTAAAGCATTCAAAGAAGCGCAAGCCGTCAAAAAAAGACCAGTCCCGTGGGCCCAAAGAGGAAGTAGGAAGTAGGAAATCAAAATCTTCCCAGGAAAGAATAAAAAGATCTTTATCGGTGTCCTCTCAAGACTCTTCCAAAAGACACCGGTCTAGATCCGACAAAGACAATTATTCCTCTGGTCATTCCAGCAGAGGCGCTCTCTCTGATTCTAGATCCAGATCGAGATCTTATTCAAGAGAGAGTGTAAGATCTAGAACAGGTTCCAGATCCTCCTCCCGCTCTAGGAGTGACTCAAGGGGCAGGTCTCCGGGGAAAGCTAGGTCAAGACACAGGAGCAGATCAAGGTCCGGTTCAAATTCAGTGACTCGGACGTCCAGTTCCAAGCAATTTAAAACTACACCCCACAAAAACAGAGAACCGCCTTTAGCAGAGAGCAAACCAGTTCCTGTGGCCGAACAAGGGAAACCCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAACTACGGAAAACATACCTGAGATTCCAATAAGTGACAGTCCGCCTCCTTCAAGATGGAAACCTGGACAGAAACCATGGAAACCATCTTATGAACGAATACAAGAAATAAAGGCCAAAGCATCAGACAAGTTGCCCTCACAAGGTAAACATACTGAAGGGGATACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGC
  5   1   2       bld Brn2      in                        CAAJ16091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             NNCGTCCGCTCTTCCAAAAGACACCGGTCTAGATCCGACAAAGACAATTATTCCTCTGGTCATTCCAGCAGAGGCGCTCTCTCTGATTCTAGATCCAGATCGAGATCTTATTCAAGAGAGAGTGTAAGATCTAGAACAGGTTCCAGATCCTCCTCCCGCTCTAGGAGTGACTCAAGGGGCAGGTCTCCGGGGAAAGCTAGGTCAAGACACCGGACCTTGATCTGCTCCTGTGTCTTGACCTAGGAGCAGATCAAGGTCCGGTTCAAATTCAGTGACTCGGACGTCCAGTTCCAAGCAATTTAAAACTACACCCCACAAAAACAGAGAACCGCCTTTAGCAGAGAGCAAACCAGTTCCTGTGGCCGAACAAGGGAAACCCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAACTACGGAAAACATACCTGAGATTCCAATAAGTGACAGTCCGCCTCCTTCAAGATGGAAACCTGGACAGAAACCATGGAAACCATCTTATGAACGAATACAAGAAATAAAGGCCAAAGCATCAGACAAGTTGCCCTCACAAGGTAAACATACTGAAGGGGATACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTG
  3   1   2       bld Ova1      in                         CABE8342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAGTTCCAAGCAATTTAAAACTACACCCCACAAAAACAGAGAACCGCCTTTAGCAGAGAGCAAACCAGTTCCTGTGGCCGAACAAGGGAAACCCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAACTACGGAAAACATACCTGAGATTCCAATAAGTGACAGTCCGCCTCCTTCAAGATGGAAACCTGGACAGAAACCATGGAAACCATCTTATGAACGAATACAAGAAATAAAGGCCAAAGCATCAGACAAGTTGCCCTCACAAGGTAAACATACTGAAGGGGATACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATTAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGAC
  3   1   2       bld Te5       in                        CAAO10626.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACCATACATCAAACTGAGAAGACTGCGTCGTCTGCTGTAACTACGGAAAACATACCTGAGATTCCAATAAGTGACAGTCCGCCTCCTTCAAGATGGAAACCTGGACAGAAACCATGGAAACCATCTTATGAACGAATACAAGAAATAAAGGCCAAAGCATCAGACAAGTTGCCCTCACAAGGTAAACATACTGAAGGGGATACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACG
  3   1   2       bld Brn2      in                        CAAJ16091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCACAAAGTAAACATACTGAAGGGGATACTAGCACAAACTCAGGCCGANAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGT
  5   1   2       bld Gas7      in                         XZG53803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACTAGCAACAACTCAGGCCGAAAGCGCCAGGCTAGCTCCGATAGTGACCGCAGTGATTACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCC
  3   1   2       bld Spl1      in                         CABK9786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACTCAAGCAGATCGAGCTATAGGCGAAAATCCAGGATACATTCTTCTCGGAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGAAAAAA
  3   1   2       bld Te3       in                         CAAM2082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGG
  5  -1   2       bld Ovi1      in                        CABI14325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAG
  3   1   2      seed Te4       in                         CAAN3148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTCGGTCTTATAGCAGATCTTATTCCAGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAGAAG
  3   1   2       bld Gas7      in                         XZG53803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATCAAGAAGTCGTAGTAGCTCGAGTTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCG
  3  -1   2       bld Int1      in                         CAAP6374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAG
  5  -1   2       bld Int1      in                         CAAP6374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCGAGGCCAATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAG
  5   1   2       bld Tad5      out                         XZT3760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTCTCGCAGTGACTCTTCGTATGACCGCTCCTCCTCCTATGATTTCAAAGACAGGCACCATTCTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAGA
  5   1   2       bld Ovi1      out                        CABI8785.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAGGAGGTCTGGCTTAAAGAAACGAAACCGTTCCAGAGGTAAAAATGGTCGCTCGGCGAGTAGGTCCAAAGGAATGAATTCTTCAAAAAGCATGGTGAGCAATTCTGATTCCGAAACATCCTCTGACACAGAGAAAGAAGATTATCAGAATATTGTGCTGGAAACCACCAAGGCTTTAGAAGACCTTAAAAATCATATTGGCATTAAAAGTACTCCGGAACAAAATGAGAATGATACTAGCGTAGATAAACTACAAGAGAAGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAGAAGAAAAAAGAGAAGAAACGCAAAGCTCAGAAGAAGAAGCCCATGTTCCACTGGCAGCCTCCTTTAGAGTTCGGTGATGAGGAAGAGGAGGAAATGGTGACGGAGAAACCCGATGCTACGAAAAATGGTGTCACTGANAAACACAATCAGGTTCAAGACAAGACTTTGGACGACATCACTCAGTCCTCTAGAAAAAGTCAAAAAGCAAACCTTTGCGGNGTAGGAGGAAACTGC
  5  -1   2       bld Gas       in                   TGas069k19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGAGGAGCGGTCATACGAAGAGTCACTGCGAGAATTGGCTGAAAATGGCACTGATTCTGTACAGGCAGTATTACCAGAAAAATGTGACGAATTGAAAGAAAAATCCAGTGACATCAGTCAACTTTCCAAAGGGGACAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTTTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGGAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCATGGGGAAAAAAAAAAAAAAAAAAGCGGGGGA
  5   1   2       bld Neu0      out                      IMAGE:6992094                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAAACGAGAGCAATTTAAGTGCAGACGAGCTTGCGTCTTCTGAGAAGGAGGAAGGGGAGGCCAGCTCTGAATCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCCGGTTCCAAGAACAGCCCTTCTGCAAATATTCCAGAAAAGCTCCCAAAATCTCCGTCGCCGGCGAGCCCAAGCCCCGACCGCAGTAAAAGTAAATCAAAGAAACATAAGCGGCGTTCCAGCAAAAAAAGGGCCAAGAAAAGCCATGGGAAAAAGAATAAGGAAAAGTCGAAGAAGAAAAAAGAGAAGAAACGCAAAGCTCAGAAGAAGAAGCCCATGTTCCACTGGCAGCCTCCTTTAGAGTTCGGTGATGAGGAAGAGGAGGAAATGGTGACGGAGAAACCCGATGCTACGAAAAATGGTGTCACTGAAAAACACAATCAGGTTCAAGACAAGACTTTGGACGACATCACTCAGTCCTCTAGAAAAAGTTCAAAAAGCAAACCTTTGCGGGTTAAGGAGGAAACTGCCAAGGAGCAAAGCAAAAGCCTCAATCTCGTAGAAAGTCAAGACAAAGGAGAGAAGAATGAAACAAACACCAAAAAACTTCAGAACTTGACCCTGAGTTTGGCCCAGTCTCCCACTAGCCGCAAAACTGGTAATGGTAGCCTCCCCTTATCACATGTTAAGGACGAATCAGATTCTTCTGCCAAAAAACAGAGTGGTGTTACAAGTGTTAATAGTGGGCAGAATGCTCCACTCTCAGTATTGGTGGCTTCTATCGCAGGAGAAGAACTTGCAGCCAAGGGAAGAGAGACTTTGGGGACTGCGCANGGAACGGGGTGAAGCAGCTGATACCGAAAAAGGCAACACTGGAAAATCTGAAGCAGCAGGCGTTGACCATAAATGGAAAACCTGTTCAAGGAACAGAGTATCCTGG
  3   1   2       bld Gas       in                    TGas069k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGGACACAGAGGCTGTTTCAAAGTCGGCCACACCTTCNCGGTTCCAAGAACAGCCCCTTCTGGAAATATTCCACGAAAAGCTCCNCAAAATCTCCGTGCGCCNGGCGAGCCCCAAGCCCCCGACCGCCAGTAAAAGTAAATCAAAGNNAAACATAAGCNNGGCGTTCCAGNCAAAAAANNGGGCCNNGAAAAGCCCACTGGGAAAAAGAATATANGGAAAAGTCGAAGANAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)