Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN4691.3.5                         30 END     1           2        3                PREDICTED: similar to KIAA0966 protein [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012077626 Xt7.1-CABC11509.3 - 38 ESTs
                                                                       ....-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABC11509.3                                                                                                                                                                                                                                                                                                                                     GGGGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTGACACTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCCGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAGAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTTTGAAGTATTGGTGTTGTTGTGTGGCCCTATCCTTCTTATAAGGCAGGATCTTGGCTGCATTGGCCTACGGTCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTAGGAACGCTGATAAATAATTTACCAAGTGTTAGTGTGTTACACTCCAAAACACTACTCAAAATGTTTCCATGCCTTGACAGACCTAGAATGACCAAGTAAAGAATATTATCTTTTTAAAAAGAGTTATTTTATTATACTTTCCATGGAGTGACTTATATCCTGCTAATCTCATGACGTCTTAAAAATATTTCCCAATCTTGTGTGATAATACTTCAAAACATAGTAACACATACCTGTACATACAACTGTAACTGATGGCACTCCAGTCCAGCAATTGTGCTAATAACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATGTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAACATAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227034                                                                                                                                                                                                                                                                                                                                           GAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTGACACTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCCGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAGAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTTTGAAGTATTGGTGTTGTTGTGTGGCCCTATCCTTCTTATAAGGCAGGATCTTGGCTGCATTGGCCTACGGTCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTAGGAACGCTGATAAATAATTTACCAAGTGTTAGTGTGTTACACTCCAAAACACTACTCAAAATGTTTCCATGCCTTGACAGACCTAGAATGACCAAGTAAAGAATATTATCTTTTTAAAAAGAGTTATTTTATTATACTTTCCATGGAGTGACTTATATCCTGCTAATCTCATGACGTCTTAAAAATATTTCCCAATCTTGTGTGATAATACTTCAAAACATAGTAACACATACCTGTACATACAACTGTAACTGATGGCACTCCAGTCCAGCAATTGTGCTAATAACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATGTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAACATAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                          3     3     6     6     6     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     8     8     7     7     7     7     7     7     6     6     6     6     5     6     5     5     5     5     5     5     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     9     9     9     9     9    10    11    10    11     9    10     9    10     9    10     9    10    10    10    10    10    10    10     9    10     8    10     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8    10     8    10     8    10     7     9     7     8     7     8     7     9     2     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     3     3     3     3     4     4     4     4     4     4     4     4     3     3     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     8     8     8     8     9     9    10    10    11    11    11    11    12    12    13    13    13    13    13    13    12    12    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    13    14    12    13    11    12    11    12    11    12    11    12    10    11    10    11     9    11     9    10     9    10     9    10     9    10     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     3     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------T----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Br ---- 6e-007     AAR12640.1 MyoD [Branchiostoma belcheri tsingtaunese] --------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Cs ---- 1e-008     BAC81668.1 orphan basic helix-loop-helix factor NoTlc [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bf ---- 2e-009     AAF81766.1 basic helix-loop helix transcription factor AmphiNeurogenin [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 3e-008     NP_496070.1 transcription factor (2J902) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bb ---- 7e-010     AAD10038.1 twist protein [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 1e-009     BAE06630.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 2e-010     CAJ83180.1 transcription factor 15 (basic helix-loop-helix) [Xenopus tropicalis] -----------------------------------------------------=============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 9e-022     NP_525055.1 CG2655-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 5e-023     XP_792477.1 PREDICTED: similar to T-cell acute lymphocytic leukemia 1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 2e-071     NP_998402.1 T-cell acute lymphocytic leukemia 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 9e-081     NP_003180.1 T-cell acute lymphocytic leukemia 1 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 5e-083     NP_035657.1 T-cell acute lymphocytic leukemia 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Gg ---- 9e-090     NP_990683.1 Avian SCL [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                        PROTEIN --- ?? ---- 6e-170     NP_001081746.1 stem cell leukemia protein SCL [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                            PROTEIN --- Xl ---- 7e-171     AAH72130.1 LOC398028 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABC11509.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA------------------------------------ATG---ATG------------------ATG------------------------------------ATG---------------------------------TAA---------------------------------------------ATG------------------------------ATG------------------------------TAA------------------------------------------------------------------------------------------TAG---------------TGATAG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------TAG------------TAA------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA------------TAG------------------------------------ATG---TGA------TAG------------------------------------------------------------------------------------ATG------TAA------------------------------------------------------------------TAA---ATG------------------------------------------TGA---------------------------------------------------------------------------------TAGTAA---------------------------------------------------------------TAG---TAG------------------------------------TAA---------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGA------------------------TAG------------------------------TGA------------------------------------------------------------------------------TAA------TAG------TGA------ATG---------TGA------------------------------------------------------------------------------------------------------ATG------TAA---------------------------------------------------------------------------------------------------------------------TGA---TAATGA---------------ATG---------TAG---------TGA------------------------------------------------------------------------------------------------TAA---------------------ATG------------------------------------ATGTAA---TGA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Hrt1 PIPE in                         CAAQ3994.5p AGGCCACAAAATGGCTCCACTCACTTTTCCAAATGAAAGGCAAACGGTAATGTATCTATAGGAGGGGAGAGCCGTGCTGTAAGCATTGTGTGTCCCTCTGTCCCTGAAGATGATGGAGAGGTTGGGGACAGACATCGATGGCACCCACGATGTTGCATCTCCCCCAGCACAACAAGACGCAGCAGAGCCAGAGAGAACTGTGGAGCTGAGTGGGGTGAAAGAAGGGGCGGCCCCCAACTCCCCCCCCAGAGCTGTCCCGGTGATTGAGTTGCACAGAAGGGGGGAGGGATCGGGGAATATAAAGGCCAGAGAGCAGGAGCTGAGGCTGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTGACACTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCTGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCC
  5   1   2       bld BrSp      in                    EC0CBA004CA05.g1                                                                                                                                                                                                                                                                                                                                     GGGGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTAACACTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCCGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCA
  5   1   2       bld BrSp      in                    EC1CBA001ZH06.g1                                                                                                                                                                                                                                                                                                                                     GGGGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTAACACTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCCGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCAC
  3   1   2       bld HeRe      in                     EC2CAA10AH12.b1                                                                                                                                                                                                                                                                                                                                      GGGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTGACGCTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCCGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAATGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCGGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTCTGGCCAAACTTCTGA
  5   1   2       bld HeRe      in                     EC2CAA10AH12.g1                                                                                                                                                                                                                                                                                                                                       GGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTGACGCTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCCGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAATGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCGGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCT
  5   1   2       bld HeRe      in                     EC2CAA17AD07.g1                                                                                                                                                                                                                                                                                                                                       GGCAGAGCATTAGGACCACTGAGCTGTGTAGAGCTCCCTTGACACTAGCCACAGAATTGTGCAGAGCCCCACTGACTCCGACCACAGAGCTTTGCAGAGCACCACTTACCCCAACTACAGAGCTGTGCAGAGCCCCACTAACCCCCACCACAGAGCTTTGCAGACCCCCACTTACCCCAGCTGCAGAACTCTGCAGAGCATCATTGACACCAGCTGCAGAGCTGTGCAGAGCCCCAAGCTCAGTGACTGGACCGCCTCTTACTGTCACCACCGAGCTTTGCAGACCCCCGATCCCCTTGCCGAGCACCGGACCCCCAGCTGAACAAGCTGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACA
  5   1   2       bld HeRe      in                     EC2CAA21AC01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCGAGCACCGGACCCCCAGCTGAACAAGCTGTAGAAGCCCGGATGGTGCAGCTGAGTCCCACGGCTTCCCTCCCTTTGCAGGCGGCGGGCAGAACCATGCTGTATGGGCTCAATCAGACCCTGGCGTCGGGTAACAGTGGTTACTTTGATGACCCAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTAT
  3   1   2       bld Ski1      in                         CABJ1978.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTAAAATACAAAAAAAAA
  5   1   2       bld Ski1      in                         CABJ1978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGCCTACCCCATGTTCACAAACAATTCCAGAGTTAAGAGAAGACCTGGCCCCTATGAAGTGGAGATTTCTGAAGGTCCCCAAACAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA21AC01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGTCCCCAAACAAAAAGTGGTCAGACGCATCTTTACCAACAGCCGAGAGAGGTGGAGGCAACAGAACGTAAACGGGGCATTTGCTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATT
  3   1   2       bld HeRe      in                     EC2CAA17AD07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAACGTAAACGGGGCATTTGGTGAACTTCGCAAGCTCATCCCTACTCACCCTCCAGACAAGAAACTTAGCAAAAATGAAATTCTTCGTCTGGCAATGAAATACATCAACTTTCTGGCCAAACTTCTTGATGACCAGGAAGAAGAAGGCAACCAAAGGAATAAAGGAAATAAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAA
  3   1   2       bld Fat1      in                         CABC2254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGATAATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTG
  5   1   2       bld Fat1      in                         CABC2254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGATATGGGATGGTTCAGCAAGAACTTCTTCAAGACATGCTGTCCCCAAACTCTAGCTGTGGAAGTTCTTTAGATGGTGTGCCAAGCCCTGATAGTTACTCAGAGGAACATGATACACTGGACTCCAAGCACAGCAGAAATCTACATCAAGCTATGCTACCTGTAGATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                    EC1CBA001ZH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGCTACCTGTAAATGGCAGTGGGCAGCGGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCCCTGGGTATGGACCAATGTTTTCCTGGTATTGATGCCCAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTTTTCAATGCAACAAAAACCGCTGGGCAAGAGGACTTTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAAAGAGGTTCCTTCTATGTATATGTATTGGAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTAGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA039l10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTGGGCAGCGCGTGATTAAATAAATATCAGCATCATTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAGAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTT
  3  -1   2       bld HdA       out                   THdA035i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATATGAATCTCTAAGGTATGGTCCATACCCATTTGGGTCATAGCTCATACCCATGAGGAAATACTGGCGAATGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGAAACCTGTAACCGTTTCATAGCTATATGCTTACTGGAGACAAATTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGCAACCATTG
  3   1   2       bld BrSp      in                    EC0CBA004CA05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCCAGTATTTCCTCATGGGTATGAACTATGACCCACTGGGTATGGACCATTGTTTTACTGGTATTGATGCACAATTTGGGATGAAGACAATATATGAATCTCTAAGGTACTCTATTTAAAATACAAAAAAAATCCATCTTTATAATGTACAGACCATCTCTTCAATGCAACAAAATCCGCTGTGCAAGAGGACTCTCATGTTTATAGATAAGGTATATTGTATTCCAGTGTAAGAGAGGTTCCTTCTATGTATATGTATTGGAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCCTTAGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Hrt1      in                         CAAQ4642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCTATGTATATGTATTGAAACATGTAACCGTTTCATAGCTATATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAGAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTTTGAAGTATTGGTGTTGTTGTGTGGCCCTATCCTTCTTATAAGGCAGGATCTTGGCTGCATTGGCCTACGGTCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTAGGAACGCTGATAAATAATTTACCCAAGTGT
  5   1   2       bld TbA       in                   TTbA055c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATGCTTACTGGATACAAAGTTGACCAAGTTAAACATTTAGCATAATAATTTCTCTTGATAGAGCCTCAGGATGGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAAAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAAAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTTTGAAGTATTGGTGTTGTTGTGTGGCCCTATCCTTCTTATAAGGCAGGATCTTGGCTGCATTGGCCTACGGTCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTA
  5   1   2       bld Tad5      in                         XZT54973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATTTTGGAACCATTGAAAAAAAAAAAAAAAAAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAGAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTTTGAAGTATTGGTGTTGTTGTGTGGCCCTATCCTTCTTATAAGGCAGGATCTTGGCTGCATTGGCCTACGGTCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTAGGAACGCTGATAAATAATTTACCAAGTGTTAGTGTGTTACACTCCAAAACACTACTCAAAATGTTTCCATGCCTTGACAGACCTAGAATGACCAAGTAAAGAATATTATCTTTTTAAAAAGAGTTATTTTATTATACTTTCCATGGAGTGACTTATATCCTGCTAATCTCATGACGTCTTAA
  5   1   2       bld Fat1      in                        CABC11509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGGAAAACAAGCAGAAATTTTTTTACTTGGTACCTGTTGAAGAGAAGGTACATATCCATTCATTTATATTGCAGTTGTTAGGTTCACATCAGTATTATTTAATAAATGTTTGGCACATTATATATTATTTGCAAGTTGTAGTTAAAAATCTGCATTTATAATGTATTGATTTTTATATTTTAACTGTGTTTAAAGCTAAGAGAGAAGCCACAGTGTTCTGTTTTATCCATTGACTCTGTAAATGGGCTGTGGAGACTTTTGTGGGTCTTTATTTCCTGAAAAAAGTCTCTCTCATTATTCACAAGATCCTACATTCAGTAGTCCACAATTAGTGCCAAAGACCCTAAATTGATGCTATAGTTGCCATTTTGAGTGCAAACAGAAGTAGTCCTCCTATGGATCCAAATGTTTTTGAAGTATTGGTGTTGTTGTGTGGCCCTATCCTTCTTATAAGGCAGGATCTTGGCTGCATTGGCCTACGGTCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTAGGAACGCTGATAAATAATTTACCAAGTGTTAGTGTGTTACACTCCAAAACACTACTCAAAATGTTTCCATGCCTTGACAGACCTAGAATGACCAAGTAAAGAATATTATCTTTTTAAAAAGAGTTATTTTATTATACTTTCCATGGAGTGACTTATATCCTGCTAATCTCATGACGTCTTAAAAATATTTCCCAATCTTGTGTGATAATACTTCAAAACATAGTAACACATACCTGTACATACAACTGTAACTGATGGCACT
  3   1   2       bld Hrt1      in                         CAAQ4642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTATATGTTATTGTTCAACACCATAGATCACCTTCCCCCATGTATCATTCTTAGTTTCACTCAAACTTCAGCTTTTCTCTGCAAGGTTACAACTGTTTTTTCTTGGTTTAGGAACGCTGATAAATAATTTACCAAGTGTTAGTGTGTTACACTCCAAAACACTACTCAAAATGTTTCCATGCCTTGACAGACCTAGAATGACCAAGTAAAGAATATTATCTTTTTAAAAAGAGTTATTTTATTATACTTTCCATGGAGTGACTTATATCCTGCTAATCTCATGACGTCTTAAAAATATTTCCCAATCTTGTGTGATAATACTTCAAAACATAGTAACACATACCTGTACATACAACTGTAACTGATGGCACTCCAGTCCAGCAATTGTGCTAATAACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATGTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTA
  5   1   2       bld Tad5      in                         XZT35635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGACTTATATCCTGCTAATCTCATGACGTCTTAAAAATATTTCCCAATCTTGTGTGATAATACTTCAAAACATAGTAACACATACCTGTACATACAACTGTAACTGATGGCACTCCAGTCCAGCAATTGTGCTAATAACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATGTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTNCATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTTGTCATGCAATAAAAAAGGTACAGTGAC
  5   1   2       bld Eye                                  CCAX7656.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCTTGTGTGATAATACTTCAAAACATAGTAACACATACCTGTACATACAACTGTAACTGATGGCACTCCAGTCCAGCAATTGTGCTAATAACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATGTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATAT
  5   1   2       bld TpA       in                  TTpA047c23.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACTCCAGTCCAGCAATTGTGCTAATCACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATTTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTT
  5   1   2       bld TpA       in                  TTpA047d07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACTCCAGTCCAGCAATTGTGCTAATAACTTTCTTGTTTATTGAGATCTCTGCACACAATGTTTCGAGGGATGCAGGTATATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATTTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTA
  5   1   2       bld AbdN                               IMAGE:7022639                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATAAAGGGAAATCCTCTCCCCTTAATTTTGCAAATAAGTGCATATTAGTAAGAAAAAAATACTTGTCATAGACAAGTTCTGAGCAGGATCAAACAACTAGAATATTTGAATATTTAGATATAGTCCATTCTCAAAGAAAAAATCCCATTCGAGAAAATATAAAAGTGGCTGTAAGGGAAAAAACATTTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATANAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCNNTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTTCATTAAATGTTTGTACTGGTTTAGAGTAAAGTCCTTGGAGTTTTGGGTTTCTGGCACTTTTTTTTGGCAGAAATGGTAAAGTTAACCAAGGGGCCTGGA
  5   1   2       bld Neu                            TNeu028e22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGGGAAATATAAAAGTGGCTGTAAGGGAAAAAACATGTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGC
  3   1   2      seed Fat1      in                        CABC11509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATATAAAAGTGGCTGTAAGGGAAAAAACATTTGATCAGTGATTACCCGCATTTGCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAAC
  3   1   2       bld Tad5      in                         XZT54973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGTGATCAGTGATTACCCGCATTTGCCAGACCCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTG
  3   1   2       bld Tad5      in                         XZT35635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     gcatttgccagaacccacagattgccagtctgggcctgGGAAGCAGTGTCGNATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTNTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAAC
  3   1   2       bld Hrt1 PIPE in                         CAAQ3994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAGAACCCACAGATTGCCAGTCTGGGCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAAC
  3   1   2       bld TbA       in                    TTbA039l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTGGGAAGCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTTTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTTTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTTTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTTTGAAACATAAAAAAAAAAAAAAAAAAAAAAAAGCGGC
  3   1   2       bld TbA       in                    TTbA055c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGTGTCCGATAAACAGGGGCATTGTGACTGCCACGATTCTACTCGAGTATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAACATAAAAAAAAAAAAAAAAAAG
  3  -1   2       bld Hrt1      in                        CAAQ11411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAACATAAAAAAAAAAAAA
  5  -1   2       bld Hrt1      in                        CAAQ11411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGCAGAAGTCAATTGTTCCCTGTGCCATACGCTTAAGATTAAATGGGTGAATTTCCTGTGGTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTCGCTTATGCTAAATCTTGATGTTAATGACAGCACTTTTCATTAATGTTGTACTGTTAGAGTAAGTCTTGAGTTTGGTTTCTGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTAACCCTTCCCTTGGTCCAAAGATATGGGAAGAGTTAACTTTGTAAAGCCGTTTAGGCAAACAGTCAATGTGCTATTTAGAAAAAAAACACATTTTTTGTTATATAATGTAATATTGAGAAAATTCCTAAATAAAATTTCTGAAACAT
  3   1   2       bld TpA       in                   TTpA047d07.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTTGTTTTAACTATGAGAAAGTCATTCATCACATAACCAATAGTTCCAAGGGAACACCAGAAAGCCTCAGTTGTGACATTTGCATTCTAGTGGGTATCGGTTTTTTTTGCGAGGGCAAACCAAAGTCATTATTTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTT
  3   1   2       bld TpA       in                   TTpA047c23.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAAACCAAAGTCATTATTTTCTTTGCCAGCCGTGGGCCTAATTGACATAGGAATTCTGATTATTTATGGCACTTCAATGACAATACTATGAAAACCTTTTCATTGTGACATATAGGGCACATTTTGCTTTCCTACATACAGGTAGTTTTTGGTCATGCAATAAAAAAGGTACAGTGACCTTAATGGATTTATAAAATAATTATTGCCTTGTTACTTATGCAGATGAATGTTTTGAGATTTGCTTGGCTGTGCTCAGTTGGTCATTGGAAAGGTACATATATTTTCCCTCTTCTTTGGCTTATGATAAATATCGAGGTAAGAGACAGCACTTTTCATTAATGTTGTCCTGTCAGAGTAAGTATGGAGTGTGGTTTATGCATTTTTTGCAGAATGTAAGTAACCAGGCCTGGTACCCATTTCACCCTTCCCTGGGTCCAACGATATGGGAAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)