Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CABK5884.5                           29 END     1           3        3                Hypothetical protein MGC145260 [Xenopus tropicalis]
     2   1.0    0Xt7.1-CAAJ19571.5                          16 END     4          12       26                Unknown (protein for IMAGE:7647497) [Xenopus tropicalis]
     3   1.0    0Xt7.1-CAAK7529.3                            2 END     1           3       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012077716 Xt7.1-TEgg069e06.3 - 32 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg069e06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGATCCTTCTGTTGAAAACAATGATGCCAATTGCCCGCAGTTTCATTTTATGCCCCGTTTTGTACGATTTCTGCCAGATGGTGGTAAAGAGGTCCTCTCCATGCATCAAGTTTTATTGTACTTGTTGCGATGTAACAAACCTTTAGTTCCTGAAGAAGAGATTGCAAACATGCTTCAGTGGGAAGAGCTTGAATGGCAGAAATATGCAGAAGAGTGCAAAGGGATGATTGTCACTAATCCTGGCATGAAACCCAGCTCAGTGCGAATTGATCAGCTTGATCGGGAGCAGTTTAATCCAGACGTTATTACATTCCCTATAATTGTCCATTTTGGAATAAGGCCTGCTCAACTGAGTTATGCCGGAGACCCTCAGTACCAGAAATTATGGAAAAGCTATGTGAAACTGCGCCATCTGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTTGGAATGAACCCCGACCATGCTCGAAACTCCCTCTCGAATTGTGGTATCAGGCAGCCAAAATATGGAGACAGAAAAGTGCATTACATGCATATGCGTAAAAAGGGAATTAATACACTAATAAATATAATGTCACGTCTAGGACAAGATGATCCTACCCCTTCCAGGATAAACCACAACGAGCGTCTTGAGTTCTTAGGAGATGCGGTTGTTGAATTTTTAACAAGCGTCCACCTATATTACCTGTTTCCATTGCTGGAAGAAGGAGGATTAGCTACCTACCGGACAGCTATTGTTCAGAATCAACATCTTGCCATGCTGGCAAAGAAATTGGAATTGGATCGCTTTATGCTATATGCGCATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATGGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGGGTCTTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTG
                                                  Xt7.1-CHK-1008227939                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCTGTTGAAAACAATGATGCCAATTGCCCGCAGTTTCATTTTATGCCCCGTTTTGTACGATTTCTGCCAGATGGTGGTAAAGAGGTCCTCTCCATGCATCAAGTTTTATTGTACTTGTTGCGATGTAACAAACCTTTAGTTCCTGAAGAAGAGATTGCAAACATGCTTCAGTGGGAAGAGCTTGAATGGCAGAAATATGCAGAAGAGTGCAAAGGGATGATTGTCACTAATCCTGGCATGAAACCCAGCTCAGTGCGAATTGATCAGCTTGATCGGGAGCAGTTTAATCCAGACGTTATTACATTCCCTATAATTGTCCATTTTGGAATAAGGCCTGCTCAACTGAGTTATGCCGGAGACCCTCAGTACCAGAAATTATGGAAAAGCTATGTGAAACTGCGCCATCTGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTTGGAATGAACCCCGACCATGCTCGAAACTCCCTCTCGAATTGTGGTATCAGGCAGCCAAAATATGGAGACAGAAAAGTGCATTACATGCATATGCGTAAAAAGGGAATTAATACACTAATAAATATAATGTCACGTCTAGGACAAGATGATCCTACCCCTTCCAGGATAAACCACAACGAGCGTCTTGAGTTCTTAGGAGATGCGGTTGTTGAATTTTTAACAAGCGTCCACCTATATTACCTGTTTCCATTGCTGGAAGAAGGAGGATTAGCTACCTACCGGACAGCTATTGTTCAGAATCAACATCTTGCCATGCTGGCAAAGAAATTGGAATTGGATCGCTTTATGCTATATGCGCATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATGGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGGGTCTTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGTGTAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     9     9     9     9     9    10    10    10    10    10    10    10    10    10    11    11    11    11    12    12    12    13    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    12    13    13    14    13    14    13    14    13    14    14    15    14    15    14    15    14    16    12    15    11    14    11    14    10    14    11    14    11    14    10    14     9    15    10    17    11    18    11    19    11    18    10    18    11    18    10    18    11    18    13    18    14    18    14    18    14    17    15    18    16    17    16    17    16    18    17    18    17    18    16    17    15    16    15    16    14    16    16    17    16    17    16    17    14    17    14    17    12    17    12    14    13    14    11    14    13    14    12    14    12    13    13    13    11    12    11    12    11    12    12    12    11    12    10    12    10    12    11    12     4    12     4    12     4    12     4    12     4    12     4    11     4    10     4    10     4    10     4     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTCTCTTTATATTTATATTTGTTTTGTTGTTTTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T---G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ---- 2e-008     NP_013966.1 RNAase III; cleaves a stem-loop structure at the 3' end of U2 snRNA to ensure formation of the correct U2 3' end [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-008     XP_790894.1 PREDICTED: similar to dicer1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-126     NP_492599.1 ribonuclease similar to Drosophila drosha (1K358) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 0          NP_477436.1 CG8730-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_695891.1 PREDICTED: similar to Ribonuclease III (RNase III) (Drosha) (p241) [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Hs ---- 0          NP_037367.2 putative ribonuclease III; putative protein p241 which interacts withtranscription factor Sp1 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_081075.2 ribonuclease III [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_001006379.1 similar to Etohi2 protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg069e06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATGATG------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------ATG---ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------ATG------------------------------------------------------------------------------------------ATG------TAA---------------TAG------------------------------ATG------------------------------ATG---------------------------TAA---ATG---------------------------------------------TAA------------TAG------------------------------------------------------------------------------------TAAATG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  3   1   1         - Spl1      out                        CABK5884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAATGATGCCTGAGCATTTTTGTGTGAAGGGCTTGGAACTATTTTCTTCCCATTTGTACAAGGATATTTTGGAACTTCATGACTGGAATCTTATGGATCCTTCTGTTGAAAACAATGATGCCAATTGCCCGCAGTTTCATTTTATGCCCCGTTTTGTACGATTTCTGCCAGATGGTGGTAAAGAGGTCCTCTCCATGCATCAAGTTTTATTGTACTTGTTGCGATGTAACAAACCTTTAGTTCCTGAAGAAGAGATTGCAAACATGCTTCAGTGGGAAGAGCTTGAATGGCAGAAATATGCAGAAGAGTGCAAAGGGATGATTGTCACTAATCCTGGCATGAAACCCAGCTCAGTGCGAATTGATCAGCTTGATCGGGAGCAGTTTAATCCAGACGTTATTACATTCCCTATAATTGTCCATTTTGGAATAAGGCCTGCTCAACTGAGTTATGCCGGAGACCCTCAGTACCAGAAATTATGGAAAAGCTATGTGAAACTGCGCCATCTGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTTGGAATGAACCCCGACCATGCTCGAAACTCCCTCTCGAATTGTGGTATCAGGCAGCCAAAATATGGAGACAGAAAAGTGCATTACATGCATATGCGAAAAAA
  5   1   1         - Egg       in                   TEgg069e06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGATCCTTCTGTTGAAAACAATGATGCCAATTGCCCGCAGTTTCATTTTATGCCCCGTTTTGTACGATTTCTGCCAGATGGTGGTAAAGAGGTCCTCTCCATGCATCAAGTTTTATTGTACTTGTTGCGATGTAACAAACCTTTAGTTCCTGAAGAAGAGATTGCAAACATGCTTCAGTGGGAAGAGCTTGAATGGCAGAAATATGCAGAAGAGTGCAAAGGGATGATTGTCACTAATCCTGGCATGAAACCCAGCTCAGTGCGAATTGATCAGCTTGATCGGGAGCAGTTTAATCCAGACGTTATTACATTCCCTATAATTGTCCATTTTGGAATAAGGCCTGCTCAACTGAGTTATGCCGGAGACCCTCAGTACCAGAAATTATGGAAAAGCTATGTGAAACTGCGCCATCTGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATT
  5   1   1         - Gas7      in                         XZG48397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGCGATGTAACAAACCTTTAGTTCCTGAAGAAGAGATTGCAAACATGCTTCAGTGGGAAGAGCTTGAATGGCAGAAATATGCAGAAGAGTGCAAAGGGATGATTGTCACTAATCCTGGCATGAAACCCAGCTCAGTGCGAATTGATCAGCTTGATCGGGAGCAGTTTAATCCAGACGTTATTACATTCCCTATAATTGTCCATTTTGGAATAAGGCCTGCTCAACTGAGTTATGCCGGAGACCCTCAGTACCAGAAATTATGGAAAAGCTATGTGAAACTGCGCCATCTGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTTGGAATGAACCCCGACCATGCTCGAAACTCCCTCTCGAATTGTGGTATCAGGCAGCCAAAATATGGAGACAGAAAAGTGCATTACATGCATATGCGTAAAAAGGGAATTAATACACTAATAAATATAATGTCACGTCTAGGACAAGATGATCCTACCCCTTCCAGGATAAACCACAACGAGCGTCTTGAGTTCTTAGGAGATGCGGTTGTTGA
  5   1   1         - Gas       in                   TGas116j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAGTTCCTGAAGAAGAGATTGCAAACATGCTTCAGTGGGAAGAGCTTGAATGGCAGAAATATGCAGAAGAGTGCAAAGGGATGATTGTCACTAATCCTGGCATGAAACCCAGCTCAGTGCGAATTGATCAGCTTGATCGGGAGCAGTTTAATCCAGACGTTATTACATTCCCTATAATTGTCCATTTTGGAATAAGGCCTGCTCAACTGAGTTATGCCGGAGACCCTCAGTACCAGAAATTATGGAAAAGCTATGTGAAACTGCGCCATCTGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTT
  5   1   1         - Gas                            TGas068n13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCTGGCTAATAGCCCGAAAGTCAAACAAGCTGACAAGCAGAAATTGGTCCAGAGGGAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTTGGAATGAACCCCGACCATGCTCGAAACTCCCTCTCGAATTGTGGTATCAGGCAGCCAAAATATGGAGACAGAAAAGTGCATTACATGCATATGCGTAAAAAGGGAATTAATACACTAATAAATATAATGTCACGTCTAGGACAAGATGATCCTACCCCTTCCAGGATAAACCACAACGAGCGTCTTGAGTTCTTAGGAGATGCGGTTGTTGAATTTTTAACAAGCGTCCACCTATATTACCTGTTTCCATTGCTGGAAGAAGGAGGATTAGCTACCTACCGGACAGCT
  5   1   1         - Brn1                                  CABL754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGAAGCTCTTCAGAAGATTAGACAAAAGAACACAATGCGACGAGAAGTAACTGTAGAGCTGAGTAGTCAAGGATTTTGGAAAACTGGTATCCGCTCCGATGTCTGTCAGCATGCAATGATGCTCCCGGTTCTGACCCATCACATACGCTACCATAAATGCTTAATGCATTTAGATAAATTAATTGGATATATCTTTACAGACCGCTGTTTGCTGCAGCTTGCAATGACTCATCCAAGCCACCATTTAAACTTTGGAATGAACCCCGACCATGCTCGAAACTCCCTCTCGAATTGTGGTATCAGGCAGCCAAAATATGGAGACAGAAAAGTGCATTACATGCATATGCGTAAAAAGGGAATTAATACACTAATAAATATAATGTCACGTCTAGGACAAGATGATCCTACCCCTTCCAGGATAAACCACAACGAGCGTCTTGAGTTCTTAGGAGATGCGGTTGTTGAATTTTTAACAAGCGTCCACCTATATTACCTGTTTCCATTGCTGGAAGAAGGAGGATTAGCTACCTACCGGACAGCTATTGTTCAGAATCAACATCTTGCCATGCTGGCAAAGAAATTGGAATTGGATCGCTTTATGCTATATGCGCATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATGGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAA
  5   1   1         - TbA       in                   TTbA056l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGATGATCCTACCCCTTCCAGGATAAACCACAACGAGCGTCTTGAGTTCTTAGGAGATGCGGTTGTTGAATTTTTAACAAGCGTCCACCTATATTACCTGTTTCCATTGCTGGAAGAAGGAGGATTATCTACCTACCGGACAGCTATTGTTCATAATCAACATCTTGCCATGCTGGCAAAGAAATTGGAATTGGATCGCTTTATGCTATATGCGCATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATGGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCGCAAATGACGAGACTAATAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTG
  5   1   1         - Egg       in                   TEgg063l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTTTTAACAAGCGTCCACCTATATTACCTGTTTCCATTGCTGGAAGAAGGAGGATTAGCTACCTACCGGACAGCTATTGTTCAGAATCAACATCTTGCCATGCTGGCAAAGAAATTGGAATTGGATCGCTTTATGCTATATGCGCATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATGGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCA
  5   1   1         - Tail      in                         CBSW3621.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCTGTTTCCATTGCTGGAAGAAGGAGGATTAGCTACCTACCGGACAGCTATTGTTCAGAATCAACATCTTGCCATGCTGGCAAAGAAATTGGAATTGGATCGCTTTATGCTATATGCGCATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATGGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGA
  3   1   1       chi Brn2      out                       CAAJ19571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGGGCCTGATCTGTGCAGAGAATCAGACTTACGCCATGCCATAGCAAACTGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATGTATGTAGACATGTATTTATCCCAAATAATAGTTTTAGATATATGCTGAACAAACTAATGTCTTTACAACAGCTATAATCTGACTCGAAAGCAATAATCCCAAAGCTTTTATCCGTCTGTGTTTTCTCCTTATTGCACATATTAAAAAGAAATGTCCATTACTTCTTATATAGCAAAGTGTTTGTGCTTACTGGAAGCCAGAAATATAGCCTTCCAACAATTTGTGGTCCCATATGAGAGAATATTT
  5   1   1         - Gas7      in                          XZG5571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTTTGAAGCACTCATGGGTGCAGTTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAAATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAA
  5   1   1         - Egg                            TEgg010c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTATTTGGAAGGTGGACTTGAAGAAGCAAAGCAATTATTTGGAAGACTGCTCTTCGGTAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAAC
  3   1   1         - Egg       in                    TEgg069e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAATCAGGACCTGCGAGACGTGTGGCTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTGCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAAAAAAAAAAAAAAAAA
  5   1   1         - Egg                           TEgg126m19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAATTATCCACTACACCCGCTTCAACTCCAGGAGTCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCCGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAGTCTCACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAG
  5   1   1         - Spl1      out                        CABK8073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCGATTCGCTAATTCTGATCGGCATCTGATTGAGACATCCCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGTAAATTCAGTTTATAGCCCTGATGCCTGACTACCTTTATACGTCTGAAAGTGTGCAGAAAACCTCTGGTAGGCTTTTTGCAACATATTGTTTGCTTTTCTTTATTAGATGATTTAAGGTTAACTACCTGCACTTTAAGAAATCCGCTAGAGATTCCAAGCACGATGCCTCCTCTGTACTGTAATGGATTAAGGAAAGTTCTTTATAAGTTACTGGTTCAGCACTTCAGCATTATAGACTAATTTAGAAGCAACAGGGACCTGCAGAATTTATGTAATGCATAAATATCCTTTTCCAGTTTTGCTATTAGTGTTCGCTTTATTTTCAGAATTCAGCATTGTCAAGGGGTGAGTTATAGTGCTAAGCAATTGCTTTTATTTTCCCATACCTCANNATAGCCTTTAAAACT
  5   1   1         - Gas                            TGas041l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCAGTTCTAAAGAAGCTCACCAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATG
  3   1   1         - Egg  5g3  out                   TEgg034n06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGTTTGAAGAGGCAATTGGAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAAAAAAAAAAAAAAAAA
  5   1   1         - Egg                            TEgg130n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTTGAATTTACACATGTTCGACTACTTGCTCGGGCTTTTACCTTAAGAACTGTAGGATTTAACCATCTGACCTTAGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATA
  5   1   1         - Ski1                                 CABJ1375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCGCTCCAAATGAAGGTTAAGAGACCACACACTGTTACAGTCCTGCTGTTGTTGCTCTGTTTGTCCCTGATATGTCGTGTGAAACTAATTCCCTATACTTTAATGTTTAGATACTTCTTGCAAAATTATTTCACTTGATACATATGTCAAAACCTTATAACCACTTACACTTAACCGCAACACTTGTAACGCTATAGTTTCAACTGTTTTCACTCCATTTTACTATATTACTTTTTGCTTCTTTTCTCCATGCTGTTTGTTTACAGTGGTTGCTATGGTTACCACGGTCACTTTTTGGCGGCATTTTTATGGAAGGGTACTTAAATTGTGCATTGGTATTCAGTCTGTTGGTTTTtccctgaagaagagtactgtttgtactcgaaatgttggaattttttcaataaacTTTTTTTTTTCTTTTGCACCAAGTCCCTGAGCGTGTGCGGCTCTCTCTCTCTCTCTTTATATTTATATTTGTTTTGTTGTTTTAGAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTC
  3   1   1         - Egg       in                    TEgg063l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGCCACAATCAGAGAATGGAATTCCTGGGTGATTCCATAATGCAGCTGGTAGCCACAGAATATTTATTCATACATTTCCCTGATCATCATGAAGGCCACTTAACGCTGCTACGTAGCTCCTTGGTGAACAACAGGACTCAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTGGAGAAGGAGCAGCAGGAATTGCAGAAAAAAAAAAAAAAAA
  3   1   1         - Gas       in                    TGas116j11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGCAAAAGTAGCAGAGGAACTTGGCATGCAAGAGTTTGCCATCACAAATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATTGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTTTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTTGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGGGTCTTTTTTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGGTAATAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Te1  PIPE out                       CBWN12217.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGACAAGACTAAGAGACCAGTGGTGCTCCGCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATTGATAAGGACCTGGAATATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTTGTTTTGTTTTAGGTGTCTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGTGTAATAAAAAAAAAAAAAAA
  3   1   1         - Gas7      in                          XZG5571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACAAAGACTTTGGCTGATTTATTAGAATCCTTTATCGCTGCCCTTTATATGAATAAGGACCTGGAAATGTCCACACGTTTATGAATGTTTGCTTCTTTCCACGACTGAAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCNCTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGGGTCTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAG
  3   1   1         - Tad5      in                         XZT37107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGAATTTTTTCAATAAACTTTTTTTTTTCTTTTGCACCAAGTCCCTGAGCGTGTGCGGCTCTCTCTCTCTCTCTCTCTTTATATTTATATTTGTTTTGTTGTTTTAGAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGTGTCTTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGTGTAT
  3   1   1         - Gas7      in                         XZG48397.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGAGTTCATATTGAATCAAGACTGGAATGATCCAAAGTTTCAACTTCAGCAGGGCTGCCTCCCTTTAAGAACAGAAGGCAAAGAGCCAGATTTCCCTTTGTACAAAACCCTACAAACAGTAGGGCCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGGGAAAGAATTGGCTGTGGTAAAGGCCCCAGTTTTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTTTCGAACGGAAGTATAGGCCGGAATTGATAGAACTCAGGTTGGAGAAGGAGCCGCCGGAATTAGCAGAAGAGATGGGAAAATAAAGCCGGGCGCTTTTATAGTATCCATCCAACTCACGGGGGACAGGTGCCATGCAATCCGGTCCTTTGTGGGGGTTTAGAAACATGTCCAGCTGTGTTTGGGGAAACCCAAGATAAATCAGGCATCTTTTTTTGTTTTGTTTTAGGGGTCTTTTTTTTTTTTTTTTTTAACTTGTCCCATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAAAAAATGGCAGGGGGGTAAT
  5   1   1         - Tad5      in                         XZT37107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATTTTTTCAATAAACTTTTTTTTTTCTTTTGCACCAAGTCCCTGAGCGTGTGCGGCTCTCTCTCTCTCTCTCTCTTTATATTTATATTTGTTTTGTTGTTTTAGAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGTGTCTTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGTGTAATA
  3   1   1         - TbA       in                    TTbA056l05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAATCAAGACCGGAATGATTCAAAGTTTTAATTTCAGCAGGGCTGCCTCCCTTTAAGAACAGAAGGCAAAGAGCCCGATTTCCCTTTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTTGAACGTACACAGTTGGTGTATATTTCAAAGGAGAAAGAATTGGCTTTGGTAAAGGCCCCCGTTTTTAGCAAGGTGAAATGGGGGCACCAATGGATGCGCTGGGGAAATATAACTTCCCCCCGATGGGTCCTTTGAAGCGCTTTTTCGAACGGAAGTTTTGGCCGGAATTGATTAAAATCCGGTTGGGGAAGGAGCCCCCGGAATTTGCCGAAGAGATGGGAAAATAAAGCCCGGCGGTTTTTTAGTATCCATCCAATTCCCTGGGGTCCGGTGCCATGCAATCCGGTCCTTTGTGGGGGTTTAGATACAATTCCCATTGTCTTTGGGGAAACCCAAGATAAATCCTGCCTCTTTTTTTGGTTTGCTTTAGGGGTATTTTTTTTTTTTTTTTTTTTTAAACGTGGTCCCATTTTAGTGGATTTTATCCATAGATGAGCTATTTTTTTTTTATTTAAATAATCTAGTAA
  5   1   1         - Egg                            TEgg039m19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAATGATCCAAAGTCTCAACTTCAGCAGTGCTGCCTCACTCTAAGAACAGAAGGCAAAGAGCCAGATATCCCTCTGTACAAAACACTACAAACAGTAGGACCCTCCCATGCTCGAACGTACACAGTTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGTGTCTTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGTGTAAT
  5   1   1         - Egg                            TEgg079p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGCTGTATATTTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGTGTCTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGTGTGTAAT
  5   1   1         - Tad5                                 XZT25760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCAAAGGAGAAAGAATTGGCTGTGGTAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGTGTCTTTTTTTGTTTTTATAAAATAAATGGCAGGTGTGTAATANAAAAAAAAAAAAAAAAAAAAAGGGGGGCCCCGCGGGG
  3   1   1         - Egg  5g3  out                   TEgg023e21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAGGCCCCAGTATTCAGCAAGCTGAAATGGGTGCAGCAATGGATGCGCTGGAGAAATATAACTTCCCCCAGATGGCTCATCAGAAGCGCTTTATCGAACGGAAGTATAGGCAGGAATTGATAGAACTCAGGTTGGAGAAGGAGCAGCAGGAATTAGCAGAAGAGATGAGAAAATAAAGCCTGGCGCTCTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTCGTGTGGGTTTAGATACATGTCCAGCTGTGTCTGGGGAAACACAAGATAAATCATGCATCTTTTTTTGTTTGGTTTTAGGGGTCTTTTTTTTTTTTTTTTTAACTTGTCACATTTTAGTGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATGGTTTTTATTATATGGTTTTTATAAAATAAATGGCAGGTGGTAATAAAAAAAAAAAAAAAAAA
  3   1   1         - Tail      in                         CBSW3621.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAGAAGCGCTTTTTCGAACGGAAGTATAGGCCGGAATTGATAGAACTCCGGTTGGAGAAGGAGCCGCCGGAATTTGCCGAAGAGATGGGAAAATAAAGCCTGGCGCTTTTATAGTATCCATCCAACTCACTGGGGACAGCTGCCATGCAATCCGGTCCTTTGTGGGGGTTTAGATACATGTCCAGCTGTGTTTGGGGAAACCCAAGATAAATCATGCATCTTTTTTTGTTTTGTTTTAGGGGTCTTTTTTTTTTTTTAACTTGTCCCATTTTAGGGGATTTTATCCATAGCTGAGCTATTTTCTTTTTATTTAAATACTTTAGTAAATTATTGTTTTTATTATATTGTTTTTATAAAATAAATGGCAGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)