Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012077718 Xt7.1-TNeu097b06.3 - 36 ESTs
                                                                       .......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu097b06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCCACAAACCATGCTACGGTGCAGTCTATCATTAATGCCCTCAAACTTACGAAGGGTGTTAGTAGCCCCTGCTGTGTTCCTGATAAACTTTTTTCCATCAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGACATGGTCGCTGGCAGCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAACTGAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGGAAGAACTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227317                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCCACAAACCATGCTACGGTGCAGTCTATCATTAATGCCCTCAAACTTACGAAGGGTGTTAGTAGCCCCTGCTGTGTTCCTGATAAACTTTTTTCCATCAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGACATGGTCGCTGGCAGCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAACTGAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGxxxxxxCTAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     6     7     8    12     8    12    10    12    11    12    11    12    11    12    11    12    11    12    11    13    11    13    11    13    11    13    11    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    15    13    15    13    15    13    15    15    15    15    15    17    17    17    17    17    17    17    17    17    17    17    17    16    17    16    17    16    17    16    17    16    17    14    15    14    15    14    15    14    15    14    15    14    15    13    15    13    15    13    15    13    15    13    15    13    15    13    15    12    14    10    12    11    12    10    11    10    11     9    10     9    10     9    10    10    11     9    10     9    10     7     8     6     8     6     7     6     7     6     8     5     6     5     6     5     6     5     6     5     6     4     4     4     4     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     7     9     7     9     9    12    10    13    11    13    11    13    12    15    13    16    13    16    13    16    13    16    13    16    14    17    15    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13     8     9     7     9     2     2     2     2
                                               BLH ATG      19     494                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN      19     163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR      19      92                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               EST CLI     -12      33                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG      19       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Cs ---- 1e-011     BAB68348.1 lefty/antivin related protein [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Br ---- 1e-018     ABD62777.1 myostatin [Branchiostoma lanceolatum] ========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 5e-027     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Ci ---- 4e-040     BAE06303.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-040     NP_477311.1 decapentaplegic CG9885-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 2e-049     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 1e-047     XP_787248.1 PREDICTED: similar to bone morphogenetic protein 4 [Strongylocentrotus purpuratus] ---------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bb ---- 6e-050     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ----------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 2e-049     NP_031579.2 bone morphogenetic protein 2 [Mus musculus] ------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 5e-050     NP_001191.1 bone morphogenetic protein 2 precursor [Homo sapiens] -----------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 7e-139     NP_990153.1 anti-dorsalizing morphogenetic protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 9e-144     NP_571951.2 anti-dorsalizing morphogenic protein [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAC59736.1 anti-dorsalizing morphogenetic protein 1 precursor [Xenopus laevis]  ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001081792.1 anti-dorsalizing morphogenetic protein 1 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 0          CAJ81579.1 novel protein similar to anti-dorsalizing morphogenic protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu097b06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TAA---------------------------------------TAG---------TAG---------TAG------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------TGA---------------------------TAA------------------TAG---TGA------------------TAA------------------------TAA---------TGA------ATGTAG------------------TAA------TGA---TGA------------------------------TAA---------------------TAG---------------ATG------------------------------ATG---------------------------------------------------TAG------------------TAA---------------------ATG------------------------------TAA------------------------------------------------------------------------------------TAA---------------------------------------TGA---TAG------------------ATG------------TAG---------------------ATG---------------------------------------------------------------------------TAA------------------------------------------------------------------TAA------------------TAA------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           Gas  FL                     TGas066c03.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCCACAAACCATGCTACGGTGCAGTCTATCATTAATGCCCTCAAACTTACGAAGGGTGTTAGTAGCCCCTGCTGTGTTCCTGATAAACTTTTTTCCATCAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGACATGGTCGCTGGCAGCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAACTGAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAAGAACTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990706                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGATAGAAACCACAAGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATCACTGATGATGGAAGAGAGGATTGTCTCGTGGACATCACCTGATG
  5   1   2   12  bld Gas7 5g3  in                         XZG24385.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAAACCACACGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGAAAGGAGAGG
  5   1   2   12  bld Gas7 5g3  in                         XZG49298.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAACCACAAGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAATGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTTCAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGC
  5   1   2   12  bld Gas7 5g3  in                         XZG32264.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAACCACAAGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTNACTGTCCGANATCTGGGAGGCGCACAAGTTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG30087.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAACCACAAGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCCCCATGAAAGCCAACAGCCCATGCTGGTTTTATTCCCTG
  5   1   2   12  bld Gas7 5g3  in                         XZG31353.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACCACAAGAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTGGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAATGGACCTTT
  5   1   2       bld Gas1                               IMAGE:6987337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGGGGGTACCGGGTCCGGGAATTCCCGGGGATGGTTGGGTTTTATANTTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTC
  5   1   2       bld Gas  FL   in                   TGas066c03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCTGCAACTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCA
  5   1   2       bld Gas  5g                        TGas011p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAACTTGATGAGATGGACCTAAGAAGAGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTG
  5   1   2       bld Gas  5g                        TGas008i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAACTTGTGAGAGGACCTAAGAAGAGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCTAAACTTGTGCCGCCTAATTATTCTTGAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTT
  5   1   2       bld Neu  5g                        TNeu040i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAACTGTGAGAGGACCTAAGAANAGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG65431.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTCCTGTTTGTTATCATACAAGACTGCACCTCCAGACCTACTGATATAGTGGACACTACTGACCTTGAATTAGAAGACCCTGAGCTTGTAAGATCTCAAGCTCTTAAAAGACTTTTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTT
  5   1   2       bld Gas1                               IMAGE:6988044                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTGAGGTACCGGGGTTCCGGAATTCCNCGGGATTGTAAGATCTCAAGCTCTTAAAAGACTTTNTGGAAGTATTTGGTATTGAGGAACCACCACATCCTCTTCAGCATGTCAAACAACCACCTCAGTACATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAA
  5  -1   0       chi Lun1      in                         CABD7001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTTTTTTTTGAAACTGTGCAGTTTATNTTCTACAGTATTATATCTAACCGCAAAATAATTTCTCAGTTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGGTAAGTCTAAAAAATGTTCTTTTATTAGTGTCTACTACTATTTGCAATTTTTGGCAAGCCAGTTGGGTATGCCCATTTAAGTTATATAAGATAATAACATATTAACACACACAAGGAATAATTAAGTCTTTGTTCTATTTTTTACAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTAAGTATGCAGATCAGCTGCCATACACCTTTTTTAATATGTAATGTTATTTGTAACTAGTTGGAAGATTTGCAGTTATCGGTCTTTGTTTTTGTGTTTTGAGGTAGCACTTGCATATATATGGAAGGACAGTCTGCCTGTAAATTATAATAATAATATATGTCAGCATATAATTTGACAAATGAATAAAGGTCATATGTCATAGATGCCTGCAGTGTACAGGCTAAGGACTGTGAGGCAACATTATATAGGTTATGAGGTGATACTGCCCTATATGGTCCCTCGG
  5   1   2       bld Gas7      in                         XZG62873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCCACAAACCATGCTACGGTGCAGTCTATCATTAATGCCCCTCAAACTTA
  5   1   2       bld Neu       in                   TNeu097b06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGGAATACAGTCAGGAGTTTTTTTGACAAAATTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCGCCACTTCTGTCAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGCGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCATGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATG
  3  -1   0       chi Lun1      in                         CABD7001.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAACTGTGCAGTTTATTTTCTACAGTATTATATCTAACCGCAAAATAATTTCTCAGTTCACAGTGACCATATGCATTTCCTGTTTAACCTCTCAACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTCCATCTTTTTAAACTAAAGCCAAGGCCTTCTGAGCAAGCTTACTTCAAAAGGCACCACTTCTGTCAGGTAAGTCTAAAAAATGTTCTTTTATTAGTGTCTACTACTATTTGCAATTTTTGGCAAGCCAGTTGGGTATGCCCATTTAAGTTATATAAGATAATAACATATTAACACACACAAGGAATAATTAAGTCTTTGTTCTATTTTTTACAGATAAGTGTCTATCTGGTCCTAGATAAAAATAAAATACAGTTGCCACAAGGGAGAAAACTGCTATCATCCAAACTTGTGCCTATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTAAGTATGCAGATCAGCTGCCATACACCTTTTTTAATATGTAATGTTATTTGTAACTAGTTGGAAGATTTGCAGTTATCGGTCTTTGTTTTTGTGTTTTGAGGTAGCACTTGCATATATATGGAAGGACAGTCTGCCTGTAAATTATAATAATAATATATGTCAGCATATAATTTGACAAATGAATAAAGGTCATATGTCATAGATGCCTGCAGTGTACAGGCTAAGGACTGTGAGGCAACATTATATAGGTTATGAGGTGATACTGCCCTATATGGT
  5   1   2       bld Gas                            TGas026i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCAAACAGCCCATGCTGGTTTTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTGAACAATCAACCTGATGGACAGATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCA
  5   1   2       bld Gas7      in                         XZG15377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGTACCCTTACCAAATGGACCTTTTGTGCCAGCTTCAAACAGAACAAGGATTAGCAGATCAGTAGAAGATGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCCACAAACCATGCTACGGTGCAGTCTATCATTAATGCCCTCAAACTTACGAAGGGTGTTAGTAGCCCCTGCTGTGTTCCTGATAAACTTTTTTCCATCAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGACATGGTCGCTGGCAGCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAACTGANAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAANAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATG
  5   1   2       bld Gas7      in                          XZG5930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTATCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCCACAAACCATGCTACGGTGCAGTCTATCATTAATGCCCTCAAACTTACGAAGGGTGTTAGTAGCCCCTGCTGTGTTCCTGATAAACTTTTTTCCATCAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGACATGGTCGCTGGCAGCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAACTGAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCANATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCAAAAACATAAATGTTACATTTTAGGCAGCTAAGCG
  5   1   2       bld Gas7      in                         XZG43030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACTTACGAAGGCTGTTAGTAGCCCCTGCTGTGTTCCTGATAAACTTTTTTCCATCAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGACATGGTCGCTGGCAGCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAACTGAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTT
  5   1   2       bld Gas7      in                         XZG61606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGCGGGTGCCACTAAAACCATTTTGGACAAACACCTACAAATGGTGGCGCTGTTTAGGGTACCATCTAGGATAACCTATAGAAAACAGACCCCATGTTTGGTGAAACACTGATAAGCACTGTATTTTCAGTTGTTCTACAAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTC
  3   1   2       bld Neu       in                    TNeu097b06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAAGTTTCTGAGTCCAGGAATGGTAAAAGTGTTACATTTTATAGATCAAACATGCCACTTAGTTTCTACATTTCTAAGACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCCTTGGAAAAAATAAAAAATGAAGAACTAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas1 5g3  in                       IMAGE:6990706                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCACTAGTTTACATTTTTAGACAGATTAAAATTCAAAAAGGCTGTATTTATAACTTGTAAGACTGGGAGATAGTATGAACTTTCCTATTGTTAAGTTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATATTTT
  3   1   2       bld Gas7 5g3  in                         XZG49298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACATGATTAAAAGTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 5g3  in                         XZG24385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTCAAAAAGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCCCCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                          XZG5930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGGGCCTGTATCTATAACTTGTAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTGGAAAAAAAAAAAAAAAGGG
  3   1   2       bld Gas7 5g3  in                         XZG30087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAAAGATTGGGAGATAGTATTGAACTTTCCTATGTTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATTAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAAG
  3   1   2       bld Gas7      in                         XZG43030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAGGACCT
  3   1   2       bld Gas7      in                         XZG61606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGACTGGGAGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAAGACCT
  3   1   2      seed Gas7      in                         XZG62873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGATAGTATTGAACTTTCCTATTGTTTAAGTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAAGAACT
  3   1   2       bld Gas  FL   in                    TGas066c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAAGTATCTATAGCAAACTCTGATATTTACTGCAAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACCATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCCTTGGAAAAAATAAAAAATGAAGAACTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG31353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAAGTATCTATAGCAAACTCTGATATTTAACTGCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGACCCTTGGAAAAAATAAAAAATGAGGACCT
  3   1   2       bld Gas7 5g3  in                         XZG65431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATATTTACTGCCAACAATGAAATACAATGTAGTATCTAATATATACTGTCTAAGAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAAG
  3   1   2       bld Gas7      in                         XZG15377.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGGATGAATTTGAATATCCACATCCATATACATAGATTACTGTTAACAACTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATAAACATTCTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAATGGAATTCCACCAAAAATGATTTTGGGTGGTTAGCCTTTAAATATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAATAAAAAATGAAG
  3   1   2       bld Gas7 5g3  in                         XZG32264.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGATGAATGAATATCCACATCCATATACATAGATTACTGTTAACACNTACAGAAAGTATCATTATAGCCACCATGTGGCCTCATGAGTGAAAATGCAGTACACCCCAAATCCAGTATGTATGCGTCTAGATGCATTTGCAATGTTTTCCAAAACATAAATGTTACATTTTAGGCAGCTAAGCGTGGAAGTTAATTACAGGTGGGTGCAGCACTAATGCAGTACCTAGTATCTAGCAAAATTAGAATTTAATATATCTGTCTAGCACCACGCTGGCTTGTTTGTAATTTTTGCCCAAATTCTATACACATTGTCCAACAATTTTGTTCTAGAGCCTAAGTGAGCAGCCAGTACATAACTGAACACAATATTTGCCAATGAATTTAGAAGGGAATTCCACCAAAAATGATTTAGGGTGGTTAGCCTTTAAACATTTCTGAGCTCATGTGGCTCTATGCAAAACTTGCATGTACTGCGTTATTACTCTTTGTAATATTTGTATATAAGCAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAACGTGTGAGGATAATTTTCTTTTTTATAAATGTACATATTAAAATATATGCATTAAAATATAATTTCTATGCAAGAACCTTGGAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)