Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu093l16.3                         47 END     1           3        2                Hypothetical LOC496534 [Xenopus tropicalis]
     2   1.0    0Xt7.1-CAAP11658.5                          22 END     1           3        4                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 176.0    0Xt7.1-XZG43113.5                            2 PI      98       1562     1656                PREDICTED: similar to Alpha adducin (Erythrocyte adducin alpha subunit) [Danio rerio]

 This cluster: approximate FL confidence score = 96%

 1012077786 Xt7.1-CABI12603.5 - 26 ESTs
                                                                       -30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI12603.5                               TGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGCAGTGATCCCCAACCTATTTTAATTGTGAGCCAAATTCAGATGTGAAAAGTATTGGTGATTCACATAAGCATGAAAAAAGTTCCTTGAGGATGCTAAATAAGGGCTGTGATTGGCTAACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTG
                                                  Xt7.1-CHK-1008228963                                     GCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGCAGTGATCCCCAACCTATTTTAATTGTGAGCCAAATTCAGATGTGAAAAGTATTGGTGATTCACATAAGCATGAAAAAAGTTCCTTGAGGATGCTAAATAAGGGCTGTGATTGGCTAACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTGTTTCCT
                                                      consensus depths                                    3     3     4     4     4     4     5     5     5     5     5     7     6     7     7     7     7     7     8     9     9    10    11    12    11    12    11    12    12    13    12    13    12    13    12    13    12    13    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    11    12    11    12    11    13    12    13    12    13    11    13    12    14    12    14    12    14    12    13    12    13    10    11    11    12    11    12    11    12     9    10     9    11     9    10     9    10     9     9    10    10     9     9     8     8    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    12    10    11    10    11    10    11    10    11    10    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    10    12     9    11     9    11     7    11     5     7     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6
                                               BLH ATG     190     231                               
                                               BLH MIN     166      48                               
                                               BLH MPR     142      48                               
                                               BLH OVR     115     231                               
                                               CDS MIN     115      48                               
                                               ORF LNG     115      44                               
                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 1e-007     NP_001038744.1 zgc:136580 [Danio rerio] ----------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 6e-011     AAH87618.1 LOC496105 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 6e-011     NP_001088829.1 hypothetical protein LOC496105 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 1e-032     NP_034641.1 interferon gamma receptor; INF-g receptor [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 3e-034     NP_000407.1 interferon gamma receptor 1; Immune interferon, receptor for [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PREDICTED - Gg ==== 2e-036     XP_419722.2 PREDICTED: similar to Interferon-gamma receptor alpha chain precursor (IFN-gamma-R1) (CD119 antigen) (CDw119) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 0          AAI21593.1 Hypothetical protein MGC147184 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI12603.5                                                                                            TGA---TGA---------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TGA---------------TAA---------TAA------------TAA---TAA------------------TAG---TGA------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  0   1   1           BrSp FL                   EC2BBA31DD02.FL-Pollet   GGCCACACGCTGTTGTGAGGATGCGTGGTGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGACCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCGAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCTTGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAAtGAaCAAACATAactatgGtataaaactggttttatt
  0   1   1           Ova1 FL                          CABE3121.FL-MGC                         GCGTGGTGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas057f23.FL-Sanger                               TGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGCAGTGATCCCCAACCTATTTTAATTGTGAGCCAAATTCAGATGTGAAAAGTGTTGGTGATTCACATAGGCATGAAAAAAGTTCCTTGAGGATGCTAAATAAGGGCTGTGATTGGCTAACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTGTTTCCTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp FL   in                     EC2BBA31DD02.g1 GGGGCCACACGCTGTTGTGAGGATGCGTGGTGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGACCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAA
  5   1   2       bld Ova1 FL   in                         CABE3121.5p                   CCGAGGGCGTGGTGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGNGATGTGAA
  5   1   2       bld Gas  FL   in                   TGas057f23.p1cSP6                               TGGAGCGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTG
  5   1   2   30  bld Ova1 5x3  out                       CABE11539.5p ...................................CGCCAGTCTCTGACTCGGTAAGAGCTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGNGATGTGAAA
  5   1   2   12  bld Gas7 PIPE in                         XZG63038.5p ...........................................................CTGGGAGTTTCCGCTCTCGGTTCCTCTTTTTCTGAAAGTGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGNGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACC
  5   1   2       bld TbA  5x3  out                  TTbA009m21.p1kSP6                                                                                     CCCCGGGGCCCCGCGATTTCCCATAAGTCCCACTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGAGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATAGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAAGGCGATGAACTGGGGGGGTACGGCATACCTTGAAGACTGGCTAAAAGATAAAACCTACTGGCATTACGGCTCAAGGCAGAATCT
  5   1   2       bld In66 5g                         IMAGE:8962456.5p                                                                                        CAAAAGTTGATTTTTCCCATAAGTCCCACTTGGTGCAGTTCAAGGCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGGTTTCAGATGCGATGAACTGGGGTGTACGGCATACCCTTGAAGACTTGCTAAGATAAACCTACTGCATACTGCTCAAGCAGATCTATTTATTGGATGTGAAAGGAGAGAAGTCTCAAGAATCTGTGTGTTTATAGAAACAAACATTTATGATGAACTTCATATAGTGATGTCATTGCTGGTGTGGCTTTATCACTTGTGATG
  5   1   2       bld Tad5      in                         XZT14174.5p                                                                                                                                    GCCTGTGGCTGACGATGGAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAANACAAACATTTTATGACCCAGAACTTCATAATAGG
  5   1   2       bld TbA  5g3  in                   TTbA060f08.p1kSP6                                                                                                                                        GCTGTGGCTGACTATGGAGGGAGCTGGAGACCGGCTGTTATACCTCTGCCTTACTCCAGCTGCTCCCTCTCTTGCTTCGTGGCCTACTGGTTTCCGGAACATAGCACAGACCGGCCTGTCGCATGGGACACCGCGAACTACCGCCCGCGCGTACCTTTGACCTTTGCCGCTTAACCTTTTACTCTAGTCATATAATATGAATACTGCTTTATTCAGGGATTACCACATTACTTCAGCTACACCACATTTTCAACTAAAGCTCGTGGATTACAAAAGATAAGGACATTGGACTGTTGTGAAATCGTGCACTGATACATTACCCACATACTGTGACCTTTCGCCGATGTTTTGTATTCTAT
  5   1   2       bld Neu       in                   TNeu059k03.p1cSP6                                                                                                                                                     GAGGGAGGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGAC
  5   1   2       bld Tail      in                         CBSW8131.b1                                                                                                                                                           GGCTGGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCTGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACTTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATG
  5   1   2       bld Gas7      in                         XZG50900.5p                                                                                                                                                               GGAGACCGGGTGTTATACCTCTGCCTTACACCAACCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGG
  5   1   2       bld Ova1      in                         CABE9104.5p                                                                                                                                                                                                 CCTGCTCGCTCTCTTGCTTCTTGTCCTAATGGTTTCCGGAGCAGAAGAGAAACCCGGCCTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCT
  5   1   2      seed Ovi1      in                        CABI12603.5p                                                                                                                                                                                                                                                           CTGGCGCATGGGACACAGCGAACTAGCGCCAGCGCATACACAGTGCCTTTGCCGCTTAACCTTTTACTCAAGTCATATAATATGAATACAACTTTATTCTGGGATTACAACTTTACTTCTGCTACACCACATTTTCAAGTAGAAATCAAGGATTACAAAAAAGATGGAAATTGGAGTGTTGTGAAATCATGCAAGGATACATTACAAAAATACTGTGACCTTTCAAAGAAATTTAATAATCCAGGCATTTATTACAAGGCAAGAGTTAAAGCCTTTGTTGGAACTGAGGAAAGTAACTATTCCATTGCAAATGATTTTTCCTTACGAATTCATGGTAAGGTTGGGCCACCAACATTAAATTCCTCTGTGGAAAATACTGAAATTATTGTTTATATTTGGCACCCTGTCACACCACTCAAAGATGGAAATGAATATAAAACAATCCACCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGC
  3   1   2       bld Ova1 FL   in                         CABE3121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACCCAGTTTTATGATGACTTTAGCTATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACGTGTGTATGTCTAATGCT
  3   1   2       bld BrSp FL   in                     EC2BBA31DD02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGAAGTATTTTATAATAACCAAACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCGAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCTTGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATAAGATAAACCACATGTTCCTTTTATTTGCTGAGACAATAAACAAACATAA
  3   1   2       bld Gas7      in                         XZG50900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAACCATGGTTTCAGAATGCGATGAACTGGGGTGTACGGCATACCTTGAAGACTTGCTAAAAGATAAAACCTACTGCATTACTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACGTGTGTATGTCTAATGCTAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                         XZT14174.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGCTAAAAGATAAAACCTACTGCATTTCTGCTCAAGGCAGATCTATTTATTGGGATGTGAAAGGAGAGAAGTTTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAAAATAAAAAAAAAA
  3   1   2       bld Ovi1      in                        CABI12603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAAGTCTCAGGAAATCTGTGTGTATATAGAAAACAAACATTTTATGACCCAGAACTTCATAATAGGGTGTATTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGcagtgatccccaacctattttaattgtgagccaaattcagatgtgaaaagtattggtgattcacataagcatgaaaaaagttccttgaggatgctaaataagggctgtgattggctaACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTGTTTCCTAC
  5   1   2       bld Spl2                                CBSS6905.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCGTTTTTTTTTTGTTTCATTTTGCTGTGTGCTTTTATCACTTGTGATTGGCATGACACTTCTGTTGAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCT
  3   1   2       bld Ova1      in                         CABE9104.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTATCACTTGTGATTGGCATGACACTTCTGTGNAAGGGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGcagtgatccccaacctattttaattgtgagccaaattcagatgtgaaaagtattggtgattcacataagcatgaaaaaagttccttgaggatgctaaataagggctgtgattggctaACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTGTTTCCT
  3   1   2       bld TbA  5g3  in                    TTbA060f08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGTAATCCCAAGACTCCACAATCAGTGAGTCTATCAAGCAAGAGACAGTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACCCCAGTCAAACTGATGAACCTGGATACGGCAGCTCATTTACAGGAACAGAGAAGCATTATTTTGAAGATGGCCATGAACCTGGACGCATAAATGACCAGGATGGTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTGGTATTTATTTCCCCACAGACAGAGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAAATGAACAAAGCATAACTATGGTACTTAAACATGTGTATGTCTAATGCTAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Tail      in                         CBSW8131.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTAATCCCAAGACTCCACAATCAGTGACTCTATCAAGCAAGAGACACTTCCCATTGAACACCCAACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACCGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGCAGTGATCCCCAACCTATTTTAATTGTGAGCCAAATTCAGATGTGAAAAGTATTGGTGATTCACATAAGCATGAAAAAAGTTCCTTGAGGATGCTAAATAAGGGCTGTGATTGGCTAACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTGGAGTAAAACTGTTTCCTACAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 PIPE in                         XZG63038.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAGGAATCAAGGTTTGATCCTATTTCCATAACTACTGAAGAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGCAGTGATCCCCAACCTATTTTAATtgagccaaattcagatgtgaaaagtattggtgattcacataagcatgaaaaaagttccttgaggatgctaaataagggctgtgattggctaACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTGTTTCCTACAAAATGGAGTGTGTAGACTTTTTACACAGATTTATCTTTAATAATAAAAAAAGCCGAGATAAATCCTGTTAGAACTTATCCCACTTTTACTGCAAAATTGCAGTCTATATAAAGAAGTTGAAAACCAATCCAAGACTGTTTAGTGTAAAAAAAAAAAAAAAG
  3   1   2       bld Neu       in                    TNeu059k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAACAAAGAGTAGCTTGGAAAAGGGCTGTCATGTAAAGCCAATGTTAGATACCGCTGACACCAGTTCAANACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAATGAACAAACATAACTATGGTATTAAACTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGcagtgatccccaacctattttaattgtgagccaaattcagatgtgaaaagtattggtgattcacataagcatgaaaaaagttccttgaggatgctaaataagggctgtgattggctaACGCCATGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTGTTTCCTACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  FL   in                    TGas057f23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTCAAACTGATGAACCTGGATACAGCAGCTCACTTACAGGAACAGAGAAGCATTATTCTGAAGATGGCCATGAACCTAGACGCATAAATGACCATGATGCTAGAAGCATTGAAGAACTAAACTGCAGCAACAATGGTAGTATTTATTTCCACACAGACAGTGACAATGGTATGCCTTTGGACTTAGAAACACTCAAGGTGACAGAAAATACACCCTTATCTGAATTCAAATGTCCCAGCAGTTCATCTGGATATGATAAACCACATGTTCCTTTTATTTGCTGAGACAAATGAACCAAACCATAATCTATGGTATTAAACCTGTGTATGTCTAATGCTAACATTCGCCTGTTTCTCCATAGcagtgatccccaacctattttaattgtgagccaaattcagatgtgaaaagtgttggtgattcacataggcatgaaaaaagttccttgaggatgctaaataagggctgtgattggctaACGCCTGTGGACTGGCAGCCCACAGAAGGAGCTACTTTGAGTAAAACTTTTCCTAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)