Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 56%

 1012077837 Xt7.1-CBSS3865.5 - 38 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBSS3865.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCCGGTGCCGAGTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAG
                                                  Xt7.1-CHK-1008227045                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCCGAGTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAGAAAGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     6     6     8    10    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    16    15    16    17    17    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    20    21    20    21    20    21    20    21    20    21    20    21    21    22    20    22    19    22    19    22    18    21    16    19    17    19    14    18    12    18    12    18    12    17    11    17    11    17    14    19    14    24    14    26    14    26    15    27    14    26    14    25    13    25    14    23    11    23    13    23     9    24     9    24    11    25    10    24    15    24     7    23     7    22     7    22     7    22     7    22     7    21    14    20    16    19    16    19    16    19    16    19    14    19    16    19    16    19    16    19    16    19    16    19    16    19    16    19    16    19    16    19    16    19    16    19    16    19    15    18    15    18    15    18    15    18    15    18    15    18    15    17    15    17    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    13    15    13    15     8    12
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------AG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---CT-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C-------
                                               BLH MIN      51      68                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      51      57                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      51      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       4      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      51       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 4e-013     BAD97679.1 fibrillar collagen [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 2e-014     ABG36939.1 fibril collagen [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-014     AAT41626.1 collagen type IX-like [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 4e-014     NP_999631.1 3 alpha procollagen [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 2e-014     NP_650558.1 CG14889-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 2e-015     NP_495104.1 BLIstered cuticle BLI-2, Nematode cuticle collagen (bli-2) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 7e-032     AAH75339.1 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 5e-039     NP_001005976.1 zgc:103597 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 3e-070     NP_033907.1 complement component 1, q subcomponent, beta polypeptide [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---= 9e-073     XP_425756.2 PREDICTED: hypothetical protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ---- 3e-076     NP_000482.3 complement component 1, q subcomponent, B chain precursor [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 1e-110     AAH73409.1 MGC80872 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 1e-110     NP_001085836.1 MGC80872 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBSS3865.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGA------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------TAG------------------TAA------------------------------------------------------------------ATG------------------TGAATG------ATG---TAG---------------------------------------------TGA------------------------------TAG---------------------ATG------TAA---------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Abd0 5g                            IMAGE:7002674                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCAGGGAACTCATTTCTCTCTACCGACCCGGTGCCGAGTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCAGGTCCAGAAGACGAACCGTTTGGCTG
  5   1   2       chi Abd0 5g3  in                       IMAGE:6999590                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCCGGTGCCGAGTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCACATCATGATGGGCAAAGACAAAGAAGGAAATGGNCACCTCTGTGACCGGCCAGAATTCTTCGGTGACCCGGGCGGTTGGCCCCGGCCAAAAAACATCCGTTGTTGGAACACGAAAAATACTTTGGGCCAAGGGGAAAATTTTTCCGTTCTGGCTTCGGACCTAAGGTTTTTGCCCAGGAAGCAAGCCC
  5   1   2   10 seed Spl2 5g3  in                         CBSS924.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGTGCCGAGTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCCAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGAC
  5   1   2   10  bld Tail 5g3  in                         CBSW5379.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTGCCGAGTGTCAGAGGGGGGCTGTGATTCTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCCAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCAGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGGGAAGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGAC
  5   1   2   10  bld Thy1 5g3  in                        CBST9822.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGAGTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGTTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGANAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTTTTCCCTGACCCTCATAGCCTCCTCTGCTGCCCGTGGG
  5   1   2       bld Abd0 5g                            IMAGE:7017024                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGTGTCAGAGGGGGGCTGTGATTCTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCCAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAGGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCT
  5   1   2       bld AbdN 5g                            IMAGE:7003703                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGTCAGAGGGGGGCTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGGCCGACAGCATCTTCACCCGGCTTCCTGCTCTTTCCTGACCCCTCATAAGCCTCTTCTGCTGCCCCCATGGGGAGGGGCCCTTAGGGCCCCCATATACCCCCATTAATTCAATACCTGCCTCTTAATCCCATAAGGTGGTATTTGGCCATTTAGCT
  5   1   2       bld AbdN 5x3                           IMAGE:7005665                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGTCAGAGGGGGGCTGTGATTCTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCCAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAGGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACNGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGANAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCCATGGGAAGGGCCCTANNGGCCCCATATACCCCCATTTAATCANATACTGGGCTCTAATCCCAATAAGTGTAT
  5   1   2       bld In63 5x3                        IMAGE:8961017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAGGGGGGGCTGTGATTTTTTTCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGTTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGCCGACAGCATCTTCACCGGCTTCCTGCTTTTCCCTGACCCCTCATAGCTCTTCTGCTGCCCGTGGAGGTCCTAGGGCCCATATACCCATTATCATACTGCTCTAATTCATAGTGTATTGCATAGCTCCCAGCAACTGCAAGTCAACTGCTCCTTTCAGCATGACCCTCCTAGGTCCTTGACCAAAGAAACTCTATCTCCTCCATTCTTGGTTTCTAG
  5   1   2       bld In62 5x3                        IMAGE:8954389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCTAGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGCACCGACGGGGCCGACAGCATCTTCACGGCTTCTGCTCTTCCCTGACCCTCATAGGCTCTTCTGCTGCCCATGGAGGCCCTAGGCCCCATAAACCCATTATCATACTGCTCTATCATAGTGTATTGCATAGCCCCAGCACTGCAGCACTGCCCCTTCAGCATGACCCCCAGTCCTGCAGACTCATCCTTCATCTGTCATGTGGCACTGGGGTAAATGAGGCAACGTAATTGGTAGGCAATTACGCTACTGTTTAGATGGGGAACTGTCATGTGCCAAGCTCTGAGTATGCAGACTGCTCAGTAACATTGCGAGAATGACGAG
  5   1   2   10  bld Spl2 5g3  in                        CBSS9607.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCGCTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCCAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGAGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGG
  5   1   2       bld AbdN 5g                            IMAGE:7025449                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCTCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGANAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCCATATACCCCATTTATCAATACTGCTCTTATCCATAAGTTGTATTGGGCATTACCCCCCCAGCAACTGCAGCCCA
  5   1   2   10  bld Spl2 5g3  in                        CBSS5010.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCAAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGTTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGANAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTTTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCGT
  5   1   2   14  bld Brn4 5g3  in                         CAAL6720.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGATTTTGCCCTACACCCGCCATGAAGCCCCTGGGAGTGGCCCTGTTAGTAGCCTTGATATCAGCCCCACTGGTCACGGCCCAGAGCTGCAAAGTTGGCTTGCCCGGGATTCCTGGAGCCCCAGGGCCTGATGGGAAAGATGGAGCAGATGGAGCCCAAGGAGAAGTGGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGANAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCAGTAATCAATACTGCTCTAATCCATAAGTGT
  5   1   2       bld Thy1      in                       CBST12752.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAGAGCCGGGGCAAATCGAGGGCTGGAATAAAGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGAGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGTACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATTCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTAAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGC
  5   1   2       bld In62                            IMAGE:8956869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGGGCTTGGAATAAAGAAGAAGCAGAAAGGAGACACTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCAGCAACTGCAGCCAACTGCCCCCTTTCAGCATGACCCCCCAGTCACTGCCAGACTCATCCCTCATCTGCTCATGATGGCAACTGGGGGGGTAGATGAAGCATCAGATATATTGGGTACAGCAGTT
  5   1   2       bld Tail      in                         CBSW6371.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGAGCAGAAAGGAGACACTGGCCCCCCAGGTAATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGCGTCAACATCATGATGGGCAAGGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGCTTGGGGCAAACTGGGGGGGG
  5   1   2       bld Spl2      in                        CBSS3865.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGCCCCCCAGGTCATCCAGGTAAAGTTGGACCCAAGGGGCCAGTGGGGCCCCCAGGCCTCCCAGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCAGTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCT
  5   1   2       bld Tail      in                         CBSW6087.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGCCCCCAGGGCCTCCCAGGGTTTCCCAGGCCAAAAGGGCTTAAAAGGGGAGTCGGGAGACTACAAGATCAGCCTGAAATCTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGGGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGCGTCAACATCATGATGGGCAAGGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGCTTGGGGCAAACTGGGGGGGGGCTTATAATGAATCAGGATAATATTGGGGTACAGGCAGGTTTAGCAGGCTGATTCTGCTTTATGATATTGGGGGGG
  5   1   2       bld Spl1      in                         CABK7617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCCTTCTCGGCCCAGAAGGCCTCAGGGGCCGCGGTCCGGCGAGACGTTCCTGTTCGCTTTGATAAGGCCATTACCAACGACAATGGCCACTATGAGCCCAGGACTGGCAAGTTCACCTGTAAGGTGCCCGGCGTCTATTATTTCAGCTACCATGCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAGGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGATCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCCATGGTACCA
  5   1   2       bld Limb      in                        CBSU9623.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCACCTCCCGGGGGCAACTCTGTGTCAACATCATGATGGGCAAAGAGCAGAAGAGGAAGATGGCCACCTTCTGTGACCAGGCCCAGAACATCTTCCAGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAATCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGC
  5   1   2       bld Liv1      in                         CAAR6534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGGGAACATCTTCCGGTGACCACGGGCGGGTTGGTCCTCCAGGTCCAGAAAGACGAGTCCGTTTGGCTGGAGACGACGGAAAAGAATAGCCTTCTGGGCACCGACGGGGCCGACAGCATCTTCACCGGCTTCCTGCTCTTCCCTGACCCCTCATAGGCCTCTTCTGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGATCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAAC
  3   1   2       chi Abd0 5g3  in                       IMAGE:6999590                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAAAAAATTTCTTTTTGGGAGAGGGAAAAAAAATCCTTTTGGGACCCGAGGGGCGGAAGAAATTTTCCCGGGTTCGTGTTTTCCCAGGACCCTTTAAGGCCTTTTTGGTGGCCCCCTGGGAGGGGCCTAAGGCCCCCATTAAACCCCATAAATAATAATTGTTTTAATCCAAAAGGGTATGGCCATTAGCCCCCCCAGCAATGCAGCCAAACTGCCCCCCTTTCAGCATGACCCCCCCAAAGTCATTGCCAAGACTTCATCCCCTTTCCATCCTTGCTCCATGGTTGGGCAAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAATCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACATATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCAACG
  3   1   2       bld Spl1      in                         CABK7617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGATCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATGAAAGAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR6534.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGATCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATT
  3   1   2       bld Thy1      in                       CBST12752.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATTCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTAAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCTGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAATGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTG
  3   1   2       bld Tail      in                         CBSW6087.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGCTTGGGGCAAACTGGGGGGGGGCTTATAATGAATCAGGATAATATTGGGGTACAGGCAGGTTTAGCAGGCTGATTCTGCTTTATGATATTGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGACGAACCTGGCATTGGCCAAGTTCAAAGCCCCAACATTGGGCTTGAGATAAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCTACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAATAAAAAAAAAAAAAAAA
  3   1   2       bld Thy1 5g3  in                        CBST9822.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCCCCGTGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGTCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGAAGCTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCCCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAG
  3   1   2       bld Spl2      in                        CBSS3865.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCAGTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACATATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAT
  3   1   2       bld Spl2 5g3  in                        CBSS5010.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCCCCGTGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGTCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGAAGCTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCCCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAGAAAG
  3   1   2       bld Spl2 5g3  in                         CBSS924.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCAGTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACATATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAT
  3   1   2       bld Limb      in                        CBSU9623.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCCCCATGGGAGGGCCCTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAATCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACATATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTG
  3   1   2       bld Tail      in                         CBSW6371.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGGGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTTTCAGCATGACCCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGCTTGGGGCAAACTGGGGGGGGGCTTATAATGAATCAGGATAATATTGGGGTACAGGCAGGTTTAGCAGGCTGATTCTGCTTTATGATATTGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGACGAACCTGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATAAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCTACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAATAAAAAAAAAAAAAAA
  3   1   2       bld Tail 5g3  in                         CBSW5379.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCCCATATACCCCATTAATCAATACTGCTCTAATCCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTAAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAATGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCCCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAATAAAGAGATTCAAAAAAAAAAAAAAA
  3   1   2       bld Spl2 5g3  in                        CBSS9607.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTAATCAATACTGCTCTAATTCATAAGTGTATTGGCATTAGCCCCCCAGCAACTGCAGCCAACTGCCCCCCTGTAAGCATGACCCCCCCAAGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCTGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAATGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTAAAGAAAG
  3   1   2       bld Brn4 5g3  in                         CAAL6720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCACTGCCAAGACCTCATCCCCTTCCATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGACCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCTAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGGAAAATGCTACGGTGCAGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACATATCAGTTCCATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAT
  3   1   2       bld Spl1      in                         CABK8962.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGATCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAGAAAGAAAAAAA
  5   1   2       bld Spl1      in                         CABK8962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCCTTGCTCCATGGTTGGGGCAAACTGGGGGGGGGTTAGATTGAAAGGCAATCAGGATAATATTGGGGTACAGGCAGATTTAGCAGGCTGATACTGCTTTATGATAATGGGGGGGGGATCTGGTCACATGTTTGGGCCCAGAAAGTCTTGAATGTATAGAATGGGCCAGAGGAACCGGGCATTGGCCAAGTGGTCAAAGCCCCAACATTGGGCTTGAGATGAATTCAATAGGAAAGTCATTTCTCAGTAGGAGTTTCCAGATACTTCAGTGATGTGCAACTAAAAATCCTTCCCCCGGACCGGAACCGGCGGCCCAATGGTACCAGAACTGATTAGAATGATTATTTCGCTCCAAACTCACAATATAGAGCAAAATGCTACGGTGCCGTTCCCTCTGTGGCCAGCAGGGGCAGTGTCTGTTAACGTATCAGTTCTATATTCTGTATTAGGAAATAACAGTATTTGCAGTATAATGCAGGTTGCAGCTGTACTAACGCCATTGCTGCTGCGCCACGGAGTATGTTGGCGATATAGCAATAAAGATTGAAAGAAAGAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)