Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSS3564.5                            4 END     3          13       75                Hypothetical protein MGC147427 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012077870 Xt7.1-CAAK8725.3 - 22 ESTs
                                                                       ....-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK8725.3                                                                                                                                                                                                                                                               TTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAAAGACTGGGGATACACTGATACAACATTAAAGACTAGGGATACATTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAAAGACTGAGGATATATTGATACAACATTAGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTT
                                                  Xt7.1-CHK-1008229998                                                                                                                                                                                                                                                                     ATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAAAGACTGGGGATACACTGATACAACATTAAAGACTAGGGATACATTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAAAGACTGAGGATATATTGATACAACATTAGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAAxTTTTTTTGAAA
                                                      consensus depths                                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     5     6     5     6     5     6     7     8     7     8     7     8     7     8     8     9     8     9     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11    11    13    11    13    11    13    12    14    13    15    15    15    15    15    15    15    15    15    15    15    17    17    17    17    16    17    17    17    16    16    15    16    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    17    18    19    19    19    19    19    19    19    19    19    19    19    19    18    19    18    19    19    19    19    19    19    19    17    17    17    17    17    17    16    17    17    17    17    17    17    17    17    17    10    17    10    17    10    17    10    17     8    16     8    16     8    14     8    14
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------T
                                                      Xt7.1-CAAK8725.3                                                                                                                                                                                                                                                                TAG---------------TGA------------------------------------------------------------------TAG---------------TGA------------------------------------------------------------------TAG---------------TGA------------------------------------------------------------------TAG---------------TGA------------------------------------------------------------------TAA---------------TGA---------------------------------------------------------------TAG---------------TAA------------------------------------------------TAA---------------------------------------------------ATG------------------TGA---------------------------------------TAG---------------------------------------------------------------------------TAG------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGA------------ATG------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------ATG---------------TAGTAG---------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                ]
  5   1   2       bld Thy1      in                        CBST3690.fwd CTGGCTTTGCTGTCCTGGATTTTCAATGGTTAGTTTCAGTTACCTAGAACATCAGTTCTGGCACAGTAAGAAAGGGATTGCTAGAGACTGGGCATACACAGATACAATGATAGATACTGGGAATACATTGATACAGCATTAGATATTGGGGATACATGGATACAGTGTTAGACATTGGGGATACATTGATACAACATTAAAGATTGGGGATACATTGATACAACATTAAAGACTGGGGATACATTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAAAGACTGGGGATACACTGATACAACATTAAAGACTAGGGATACATTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATCCAACATTAGAGATTGGGGATACACTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAAAGACTGAGGATATATTGATACAACATTAGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTNAAGGAT
  5   1   2       bld Lun1      in                         CABD3527.5p                                                                                                                           GATACACTGATACACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTACAGATTGGGAATACACTGATACAACATTAAAGACTGGGGATACACTGATACAACATTAAAGACTAGGGATACATTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATCCAACATTAGAGATTGGGGATACACTGATACAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAAAGACTGAGGATATATTGATACAACATTAGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCAACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCAC
  5   1   2       bld BrSp      in                     EC2BBA24AD02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGATACACTGATACAACATTAAAGACTGAGGATACATTAATACAACATTAGATATTGGGGATACACTGATACAACATTATAGACTGAGGATACATTAATACAACATTAGATATTGGGGATACACTGATACAACATTAGAGATTGGGGAAACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGATATTGGGGATACACTGATACATTAAAAACTGGGGATACATTGATACAATCTTAGACATTGGGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTATATATAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATAGGCCATTCATGGCACTATCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCT
  5   1   2       bld Fat1      in                         CABC1625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGGATACACTGATACAACATTAGAGATTGGGAATACACTGATACAACATTAAAGACTGAGGATATATTGATACAACATTAGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAAGGTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATC
  3   1   2       bld Lun1      in                         CABD3527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGGATATATTGATACAACATTAGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTT
  3   1   2       bld Fat1 FL   out                        CABC5250.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGATATTGGGGATACACTGATACATTAGAAACTGGGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTAC
  3   1   2      seed Brn3      out                        CAAK8725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGACCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGT
  3   1   2       bld Tad5      out                        XZT20978.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATACATTGATACAATGTTAGACATTGAGGATATATTAATACATTGTTCTGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGACCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Fat1      in                         CABC1625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGTCATGTACTTTGTAAGAAACAGAATGTAAATCATTAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGT
  3   1   2       bld Tbd1                                 CBXT2788.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAGCATGTAAATCATCAAAGTGCCACTGTATACAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCCCTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATTTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCTGGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATC
  3   1   2       bld BrSp      in                     EC2BBA24AD02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACAAGAATGTAAATCATTAAAGTGCCACTATATATAACTTGCCCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATAGGCCATTCATGGCACTATCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACACGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTGAATTTGCACAGAGCAGTATTTTAAACT
  5   1   2       bld Liv1                                 CAAR4040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGACCTTTAAAGGAATATTTTTCAATTTGTGTATGTATAGTTTTCACTATATCTGAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTATAANAAANAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      out                       CBSS3564.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGAAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTTTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTTTCTGAGGTTACAAATCTGTGTTGTTTTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTTTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTGGTAT
  3   1   2       bld Thy1      in                        CBST3690.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGCTCTGTAGTTACTATTTATACAGTACACAAAGGTTAGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTTTGCAACAGCTGAAATGTCCACAATACATTCTCCCTTTGGGTGATCATATTCTGCAGCCCAGCACAAATATTTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCCTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGGGAAATTTTTTGGGGTTACAAATTTGTGTTGTTTTAAACGCAAACCCATCTGTGTTGACATTTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTTTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTAT
  3   1   2       bld BrSp      in                     EC2BBA34BD06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGGAAAACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACT
  5   1   2       bld BrSp      in                     EC2BBA34BD06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGTGGCATTCCAGTGACTGCAGAGCTAGAATTCCCTTTGTTCACTAAATTGCAAATATGTTGGGGACTGTAGTTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTATAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg044b09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGT
  3   1   2       bld Egg       in                    TEgg044b09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCTGCAACAGCTGAAATGTCCACAATACATTCTCCCTCTGCGTGATCATATTCTGCAGCCCAGCACAAATATCTATATGCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCNAATTTTTTTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Thy1      in                       CBST12635.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTAT
  3   1   2       bld Thy1      in                       CBST12635.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCATTCATGGCACTACCACTTGGCATGTATTCATAGTTACCAACTAATTTCCTTTATCCATTGGCCAATTGCAGAGATCCAGCTCGGTTCTGTGCTCTGCATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTAT
  3   1   2       bld Tad5      in                         XZT10194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGTCCGCGGACGCGTGGGGTCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTTTTACTTCCAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATTTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATT
  5   1   2       bld Tad5      in                         XZT10194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATCTGTCATGAAAGTGTATAATGAAATGACTGCAACATGAAGCTGTATGTGAATGTAATGGGTAGTAGTATTACTTACAAGCAGAGAAATTCTCTGAGGTTACAAATCTGTGTTGTTCTAAACGCAAACCCATCTGTGTTGACATCTGGTATCAAACGGGCCATGTCCGAAACACAAGTGTCTTGTTTGATGCCTTTTATAGAACTTGTATCAGTGCAATTAAACAGTTGTATGTGTTTTTTTTGTCATTAGTAGTATTTAAATGTCTCTGACTTCTCTTTGTTGAATTTGCACAGAGCAGTATTTTAAACTTTTAATAAAACCAATTTTTTTGTNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)