Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 233.0    0Xt7.1-XZG33529.5                           63 PI      79        389      702                forkhead box I1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012077931 Xt7.1-CABJ9155.3 - 26 ESTs
                                                                       -600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ9155.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAAACAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228906                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAAACATAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    10    10    10    10    10    10    10    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10    10    11    10    11    11    11     9    10     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     6     8     7     8     7     8     7     7     6     6     6     7     7     9     7     8     7     8     9     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     9    10     9    10     9    10    10    12    11    13    12    13    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    14    13    14    11    14    11    14    11    14    12    14    12    14    12    14    12    14    12    14    12    14    12    14    12    14    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    10    12    10    11    10    11     4     9     3     4
                                               BLH ATG      51    1365                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      51     193                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      51      81                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      51      29                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      -2      29                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      51       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Br ---- 2e-018     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 5e-021     NP_014331.1 Fork Head homolog two; Fkh2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 1e-032     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] =============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Cs ---- 1e-033     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 5e-033     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-035     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bf ---- 6e-038     CAH69694.1 forkhead transcription factor [Branchiostoma floridae] --------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 7e-050     XP_787062.1 PREDICTED: similar to forkhead box I2 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 8e-062     BAE06443.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 2e-110     NP_944600.1 forkhead box I3b [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 1e-155     NP_036320.2 forkhead box I1 isoform a; forkhead (Drosophila)-like 10; Forkhead, drosophila,homolog-like 10; forkhead-related activator 6; hepatocyte nuclear factor 3forkhead homolog 3; HNF-3/fork-head homolog-3 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 9e-159     NP_076396.2 forkhead box I1; forkhead homolog 10 (Drosophila) [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Gg ==== 2e-180     XP_425185.1 PREDICTED: similar to Hypothetical protein MGC75815 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          AAY45746.1 ectodermally-expressed mesendoderm antagonist [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 0          NP_001080367.1 forkhead box I1 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Xt ==== 0          AAH61326.1 Unknown (protein for MGC:75815) [Silurana tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ9155.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAG------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------ATG---------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------ATG---------------------TAG------------------------------------------------------------------TAA---------------------------------------TAG---------------------ATG---------------------------------------------TGA---------------------------------------------------------------------------------TGA---------------------------------------------TAA------------------------------------------TGA---------------------TAA---ATG------------TAG---------------------------------------------------------------------TGATGA------------------------------------------------------------TAA---------ATG---------TAA---------------TAA------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           Neu0 FL                     IMAGE:5382411.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGACATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu0 FL   in                    IMAGE:5382411.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGACATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCT
  5   1   2   20  bld Tbd1 5g                              CBXT6634.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGACATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCAGTATGAGTGCATTTGATCCACAGGCACATTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATTGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAA
  5   1   2       bld Gas1 5g                            IMAGE:6981278                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGANACTTCCGCAGAAAGAGGAAGAAGAAGTCCGATGTCAGCCCCNATGGACAGATTTCTTNCCGATAGNCCTGAGGNNNAGTCACTAATGAGAGCCCTAGAAACGAGACATACGACAGT
  5   1   2   12  bld Gas7 5g3  in                         XZG61193.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTANATGAGAGCCCTAAGAACGGAGAACATCACGACATG
  5   1   2       bld Neu  5g3  in                   TNeu069d21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTAGCTAGTTCAGGTGCTTTTGCTTCCTGACCTGCTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGAT
  5   1   2   10  bld Ski1 5g3  in                         CABJ3536.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAGCTTTCACTATGAGTGCATTTGATCCACAGGCACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGANAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGT
  5   1   2       bld Ski1      in                         CABJ9155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACTCCCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACAGCATCTTCCACCCTCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCCTATGTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGT
  5   1   2       bld TbA       out                  TTbA017p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCAACTTTGAAACAGCCGATTACAGCATCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATAT
  5   1   2       bld Kid1      in                         CABA8279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAACTTTGAAACAGCCGATTACAGCACCACTGCAAATCCCTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACACAAGCCATTTCATGCCTCAGTCATATGGAATGCAAAGGCAGCTACTGCCTAACATGCATGGCTTGGGAGGTTCTGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCACCAAT
  5   1   2       bld Neu       in                   TNeu084p05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACTTAGGTTGGCTTCCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTTAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATTCATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATG
  5   1   2       bld Gas7                                 XZG41359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCCTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATCAGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAATTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGT
  5   1   2       bld TpA       in                   TTpA076n15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAATTCAATCAGACACAACCTGGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAGAGAAAGTCCGATGTCAGCCCCAATGGACAGATTTCTTCCGATAAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCANAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGNCAGGAGGGACCCTGTACTGAGTAGT
  3  -1   2       bld Kid1      in                         CABA9990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCCTGAAGGGAGTCCACTAAATGAGAGCCCTAAGAACGGAGAACATCACGACATGTTGGGAAATTCATCACCAGGAACAGATGACTCATCTGAAAAGAGGTCGCCTCCTCCATCTATAACACCGTGTCTTAATAACTTTCTCTCCAGCATGACTGCCTATGTTAATAGTGCTAACCCAGTAAGTAGGTCAGTTCCACTTGGACTCACTAATGAACCTTCCGATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ9155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGANCCTTCCGATAGGATGGGACAGACATGGGTTGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAAACAT
  3   1   2       bld Kid1      in                         CABA8279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATAGGATGGGACAGAACATGGTTGGTTTAAACTCCTACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGGG
  3   1   2       bld Neu  5g3  in                    TNeu069d21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGGACAGAACATGGTGGTTTTAAACTCCTACACTTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAACATAAAAAAAAAAAAAAAAA
  5  -1   2      seed Kid1      in                         CABA9990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACACTCCTCTTTCAAATATGCCAAGCCATGGAGGGTCTGACTGGTCATCCACAATATCGTCAAGTCCCTTTGGCTACAGCAGTTCTGTTTTCAACCAATTCACTCCTCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGCCTCGTGCCGAATTG
  3   1   2       bld Ski1 5g3  in                         CABJ3536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTCAACCAATTCACTCCTCATTTTTACACCACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAAACAT
  3   1   2       bld TpA       in                   TTpA076n15.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAACTAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Neu       in                    TNeu084p05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTACAACACTATCAATGCAAACAATACTCTCTATAACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAAACATAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA059e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTATAACAGAGAGGGCACAGAAGTATAACTAGGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAAT
  3   1   2       bld Gas7 5g3  in                         XZG61193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAGAGAGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCGTGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGACATAAACCTT
  3   1   2       bld TbA                             TTbA061l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCACAGAAGTATAACTAGGCTGTACCAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAGAGACATAAAACATAAAAAAAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Neu                            TNeu027m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACTGTGGGGTTTAACATGGGTTATTTTTTAATTAAAAAA
  3   1   2       bld TpA       in                    TTpA059e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTTTATAGTAGTCATGTCAAAGTCCTTGGCTTCGCAATAGCAAGCTTTTCACACTGCTCTACAGAGTTTTATTTACTCTCATATAGTAGGTACCTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCACCTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAAAAAAAAA
  3   1   2       bld Neu0 FL   in                    IMAGE:5382411.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGTGCCCTGTAAGGTTTAGTCAGTTGCTTTTACGGTGTTTCAAAGCTTTTCTAGCAAGGCAAATGGTGCTTAGTGATGCATGGACTAATAGCAAGGAGGGACCCTGTACTGAGTAGTCTTAAATGAAATATAAACTGTCTCACAGGGTACTCCTGCCAAGGGGTATTTCCAAAAAAACAGAAAAGCTACTCAGAATTTGTTTTACACTGACCTTTATACTGTAACTTTCTAACTGTATACAGTAGCGAAATACTGTAAAAAAAAAGAAAATTGTATTTTGTAAGGGATGTAAAAAAATGGTGAAAACATCATCTCTCTCTGATTTAAATAATGCTTTTCAAACCTTAGATATCAAGTTTAGCAGCTGAATGTAAATTTGTCTGCCAATGTGTATTTATAAATGTTTACCATTTGAAATGATGATGTATAATATGCAGGGGATGTATAATATGTGTTGGGTTACTTATATGTTTTATAAATGTTTAAATATTTTATATGTATTATATCTAAATTCCCTGTGGGGTTTAACATGGGTTATTTTTTAATAAAAAAAAGCCATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)