Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR583.3                             8 END     3          10       37                (no blast hit)
     2   2.0    0Xt7.1-CAAN5803.5                            6 END     1           3       16                myeloid/lymphoid or mixed-lineage leukemia 2; ALL1-related gene [Homo sapiens]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 221.0    0Xt7.1-TTbA020o04.5                         18 PI      78       1756     2079                (no blast hit)
     4 831.0    0Xt7.1-CAAR583.3                             8 PI      96       1742     2234                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012077942 Xt7.1-CAAL6437.5 - 30 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL6437.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGATTGGTCGGCAGTTCTGACAGGAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATTAACACCAAAAAATGAAAGTGTATCAAAGTAATTAAGATATGGTGTGCTGTTGCCTTGTACTGGTGGAGGTTGTGTGTTTGCTTCAAAACACTACGATAGTTTATATGTGCAAAGCTGCTCTGTGGCCGTGGAGGTAGCTATTCAAACTGAAATATGGCTAAATGGCACGTTACGCAGCAGATAAACTCTTTAAAACACCATTGTATTCTACAGGGCTTATTTATCATCTGCTATGTAACCTGTGCCTTTTCCCAGCTTGAATTCCTGCTCCCATGGCTACACAGCAGCCTATTTATATAAACTATGGTAGTGTTTCTGAGGCACAGGACTTTTGCCAGTGCAGGGCAGCAGTACATTATATTTTACTTACTAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTACTCCTGCTACTGCGACTGGGAGATTATGTACCTGCTATGGGAATAAAATCTTCTTTTC
                                                  Xt7.1-CHK-1008228188                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTCGGCAGCTCTGACAGGAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATTAACACCAAAAAATGAAAGTGTATCAAAGTAATTAAGATATGGTGTGCTGTTGCCTTGTACTGGTGGAGGTTGTGTGTTTGCTTCAAAACACTACGATAGTTTATATGTGCAAAGCTGCTCTGTGGCCGTGGAGGTAGCTATTCAAACTGAAATATGGCTAAATGGCACGTTACGCAGCAGATAAACTCTTTAAAACACCATTGTATTCTACAGGGCTTATTTATCATCTGCTATGTAACCTGTGCCTTTTCCCAGCTTGAATTCCTGCTCCCATGGCTACACAGCAGCCTATTTATATAAACTATAGTAGTGTTTCTGAGGCACAGGACTTTTGCCAGTGCAGGGCAACAGTACATTATATTTTACTTACTAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTACTCCTGCTACTGCGACTGGGAGATTATGTACCTGCTATGGGAATAAAATCTTCTTTTCCTGCGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     4     4     4     5     5     6     6     7     7     7     7     7     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    13    14    13    15    13    16    14    16    14    16    14    16    15    16    15    16    15    16    16    17    18    19    17    18    17    18    17    18    17    17    17    17    17    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    14    14    14    14    14    14    12    12    12    12    13    13    13    13    13    13    12    13    12    12    11    11     9    10     8     8     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     5     5     5     5     5     5     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     8     6     6     6     6     6     6     4     6     6     6     4     6     6     6     5     6     5     6     4     6     5     6     6     6     6     6     6     6     6     6     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     3     6     5     6     5     6     5     6     4     6     5     6     4     6     3     6     3     6     3     6     3     6     3     6     2     6     2     6     2     6     2     6     2     6     2     6     2     5     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                               BLH ATG      58     645                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      58    1190                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      58      30                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 1e-032     BAE93287.1 zinc finger protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Br ---- 2e-039     AAQ21038.1 ADP ribosylation factor [Branchiostoma belcheri tsingtaunese] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---= 3e-042     NP_009723.1 Hydrolyzes GTP; myristylated; in soluble fraction. Part of the carboxypeptidaseY pathway.; Arl1p [Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 1e-052     XP_421730.1 PREDICTED: similar to ADP-ribosylation factor-like protein 3 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ce ==== 1e-063     NP_495779.1 ADP-Ribosylation Factor related, ARF(ADP-Ribosylation Factor related)-Like,abnormal Eversion of VuLva EVL-20 (evl-20) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dm ==== 2e-079     NP_476886.1 ADP ribosylation factor 84F CG7435-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 1e-087     XP_787365.1 PREDICTED: similar to ADP-ribosylation factor-like protein 2 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 2e-091     NP_062696.2 ADP-ribosylation-like 2; arf-like protein 2 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Dr ==== 7e-092     XP_690630.1 PREDICTED: similar to ADP-ribosylation factor-like protein 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 3e-094     NP_001658.1 ADP-ribosylation factor-like 2; ADP=ribosylation factor-like 2 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 4e-102     AAH88969.1 LOC496366 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = ?? ==== 4e-102     NP_001088984.1 hypothetical protein LOC496366 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 1e-102     NP_989148.1 ADP-ribosylation factor-like 2 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL6437.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA------------------------------------ATG------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------ATG------------------------------------------------------------------------TGA------ATG------------------------------------ATG------------ATG---------TAA------------------------------------------------------------------------------------TAA------------------------------------TAA------------------------------------------TAGATG---------TAA------------------------------------------TAG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------TAA---------------------TAA------------------------------ATG------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------TAA---------------------TAG---------------------------------------------------TAA---------------------------------TAA------------------------------------------------------------------------------------------------TAGTAA---------------------------------------------------------ATG---------ATG------------------------------TAG---TAA---------------------TGA---------------------------------------------------------------------------------TAG------------------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------------------------------------------TAA---ATG------------------------------------------------------------------------TAA---------------------------------------------------------TAA---TAA---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           HeRe FL                   EC2CAA16CC05.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ggtatcTGATTGGTCGGCAGTTCTGACAGGAGACCTGAGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACaataaaatcaa
  5   1   1           Tad0 FL                     IMAGE:5380094.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGTTCTGACAGGAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Spl1 5g3  in                         CABK9271.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGGTTAGATGGCGTTCATTGGCCTACGCAGACCTACGCAAATACCAATAGCAGGGGCGGAAGTTGAAGAACGTCGTATCTGATTGGTCGGCAGCTCTGACAGGAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATTCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAA
  5   1   2   14  bld Brn3 5g3  out                        CAAK8742.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCTAGATCGCGATCTAGAACTAGGCAGTTCTGACAGGAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCT
  5   1   2       bld HeRe FL   in                     EC2CAA16CC05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTATCTGATTGGTCGGCAGTTCTGACAGGAGACCTGAGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATAT
  5   1   2       bld Tad0 FL   in                    IMAGE:5380094.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGTTCTGACAGGAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGA
  5   1   2       bld Abd0 5x3                           IMAGE:7002965                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGATCCTGGGCAAGGAGAAAGCGTCTGAGCATCATGNGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATAC
  5   1   2   14  bld Brn4 5g3  in                        CAAL11610.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGACCTGGGCAAGGAGAAAGCGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGNGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATA
  5   1   2   14  bld Brn4 5g3  in                         CAAL6437.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTCTGAGCATCATGGGCTTACTAACTATTCTTAAGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATTTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAANAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATT
  5   1   2       bld Lun1                                 CABD5583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAAATGAAGCAGAAGGAGCGGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTAAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGCCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGGTGTTA
  5   1   2       bld Neu       in                   TNeu077f11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAGGTTCGGCTACTCATGCTAGGTTTAGATAATGCCGGTGAAACGACCATCCTAAAGAAGTTTAATGGCGAGGATATCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTGCTGTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTACTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAG
  3  -1   2      seed Ova1      in                         CABE9888.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATCAACACCATTTCTCCACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCCTATCCT
  3   1   2       bld HeRe FL   in                     EC2CAA16CC05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAACACCATTTCTCCAACACTTGGATTCAACATCAAAACGCTGGAGCACAGAGGGTTTAAGCTGAATATGTGGGATGTGGGCGGTCAAAAGTCCTTACGGTCATACTGGAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTCTGTCGCAGAGA
  3   1   2       bld Tad0 FL   in                    IMAGE:5380094.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Te4                                  CAAN1154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAACTACTTTGAGAGCACAGATGGGCTGATCTGGGTGGTTGACAGTGCTGACCGTGCACGGTTGCAGGATTGTGCTCAAGAACTAGCTGGGCTGCTGTTGGAGGAGCGACTGGCTGGAGCAACATTGCTTGTATTCGCCAACAAACAAGACTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTAAN
  5   1   2       bld Ova1      in                        CABE10356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGCCTGGAGCCTTATCTAAAGATGCAATCAAAGAGGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCANAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGA
  5   1   2       bld Gas                            TGas032a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTATCTAAATATGCAATCAACGAGCCCTGGAGTTGGATAACATAAAGACACATCACTGGTGTATCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG20903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAAAGAGGCCTTGGAGTTGGATAACATAAAGACACATCACTGGTGTGTGCCAAGGCTGCAGTGCAGTGACTGGGGAAAATCTCCTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAG
  3   1   2       bld Ova1      in                        CABE10356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATCTCCTGACTGGCATTGATTGGTTGTGGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTT
  3   1   2       bld Spl1 5g3  in                         CABK9271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGACTGGCATTGATTGGTTGTTGGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCT
  5  -1   2       bld Ova1      in                         CABE9888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACTGGCATTGATTGGTTGTTTGATGATATATCCAGTCGCATTTTTACAGCTGACTGAAGCAGAATGGGAAGCAAAGAAGAGAAGGACCTTAAGGAGCATCTTATTTATTTTAACAATGGCTTGACTAATGCAGAGTCTTGACTGGCTATGACTGATCTAGGGAATAACAGAGAGGTGTGCCCTCCCATGGCTGATACGCAAATGGGAGATTTGTAAGGATACAGAGTTGGAACCTTGTGGTTAAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTT
  5   1   2       bld Tad5      in                         XZT16904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTAAAGAACCGTCACTGGTACAAAGAGCGGCAGAATATGCTGTTCTGTCGCAGAGACAATAAATTCTCATCATTTATGTAGTGCCAGCAAGTTGTTATTAATCTGAAATCATTTTAATTCAGAGCTATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTTTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGGAATATATACTACACATCATAAGGAGT
  3   1   2       bld Brn4 5g3  in                         CAAL6437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGCATTATTTTGTTCTAGATGGAAGCATCATAATCTGCATTAATCCCAGATGCCCTGTATGGAATTTTCTTATCCTAGGAACACTGTTGCTNTGATCCACTTATGAGTTCTGTCAATGTCAGACAGCAAAGGCAAAAGTCAACCTTTTTACACAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATTAACACC
  5   1   2       bld Te1       out                       CBWN10775.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAACCTTTTTACCAAATTCATAAAGAAGGCCAGCAATTCTGCTATTGGTTCCCTGCCCATCTTACATCCTGCTGGGAACTGTAGCTGGACGGCAGCTGAACTGCAGTTACTTTTATCCTTGTAGATCAAAGTAACTGCAGTACCATAAACTCAGCACATCATTGCTGGCTAAAGTAAAGCACAGTGCTGGGGTACCACCTTTATGAGCCGAGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGTACATTATATTTTACTTACTAAAA
  5   1   2       bld Ovi1      in                         CABI5134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCGATTCGGGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATTTACACC
  5   1   2       bld Tad0      out                    NISC_no24b05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAAGGCAGCCATAAGGATATGTAGAGGAGCTGCATCTCCTGGTCACTTTTTTGTTCCCATTGTTTGTTCTTTGTGCATGAGTGGTTGGAACAATAAAAAGATGGATGTGCCATTCGGCCCCTTATACACTATCTGTTCATAATGCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATtaacaccaaaaaatgaaagtgtatcaaagtaattaaaatatggtgtgctgttgccttgtactggtgaaggttgtgtgtttgcttcaaaacactacgatagtttatatgtgcaaagctgctctgtggccatggaggtagctattcaaactgaaatatggctaaatggcacGTTACGCAGCAG
  3   1   2       bld Neu       in                    TNeu077f11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTGTGGGCTGATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATtaacaccaaaaaatgaaagtgtatcaaagtaattaagatatggtgtgctgttgccttgtactggtggaggttgtgtgtttgcttcaaaacactacgatagtttatatgtgcaaagctgctctgtggccgtggaggtagctattcaaactgaaatatggctaaatggcacgttacgcagcagataaactctttaaaacaccattgtattctacagggcttatttatcatctgctatgtaacctgtgccttttcccagcttgagttcctgctcccatggctacacagcagcctatttatataaactgtagtagtgtttctgaggcacaggacttttgccagtgcagggcagcagtacattatattttacttaCTAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTACTCCTGCTACTGCGACTGGGAGATTATGTACCTGCTATGGGAATAAAATCTTCTTTTCCTGCGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       out                   TNeu077g11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGGTTATAGAATGTGCTAGACTGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATNTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGCTTAAAGAACTATtaacaccaaaaaatgaaagtgtatcaaagtaattaagatatggtgtgctgttgccttgtactggtggaggttgtgtgtttgcttcaaaacactacgatagtttatatgtgcaaagctgctctgtggccgtggaggtagctattcaaactgaaatatggctaaatggcacgttacgcagcagataaactctttaaaacaccattgtattctacagggcttatttatcatctgctatgtaacctgtgccttttcCCAGCTTGAGTTCCTGCTCCCATGGCTACACAGCAGCCTATTCCCCCATACCCTGGTGGGAGAAGCACCCCGACCCTTACCTCCCACCTCTGCGCCCACCATGGCCCAGCAGCAGATGAAAGTGACCTGTATAACTGGGAAGTGGCAATATTTGGGCCTCCTAATACCCTGTATGAGGGCGGCTATTTTAAGGTGAGTGCCTGACCTAAACATTTTTGGGGTGTGAATTCCAAGCTGTGTCCAGATTTATTTTTGTATATACAAAGAGTAAATTGTGTATCTGCGCCCTCTGACAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Ova1 5g3  out                       CABE11815.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTATAGAATGTGCTAGACCGGCCCGTGTATGGTTCTTCTTCTTCACCTCTCTCTGTCTAACTTAGCCTCCCTCCCTATTTGAGTCATAAAACTTAATCCAACTGGTGGATATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGcttaaagaactattaacaccaaaaaatgaaagtgtatcaaagtaattaggatgtaatgtgctgttgccttgtactggtaagggttgtgtgtttgcttcagaacactacggtagtttatgtgtgcagggctgctctgtagccgtggaggtagctattcaaactgaaatatggctaaatggcacgttacgcagcagataaactctttaaaacaccattgtattctacagggcttatttatcatctgctatgtaacctgtgccttttcccagcttggattcctgctcccgtggctgcacggcagcctatttatataaactatggtagtgtttctgaggcacaggacttttgccagtgcagggcaacagtgcattatattttacttactAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTAATCAATATGCCTTACTTATTCTTATGCTGCCTTCTGT
  3   1   2       bld Brn4 5g3  in                        CAAL11610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTAAAGCTCATACACTGGCTGCACAGTGGATATTTCCATCCACAGTGAAATATATACTACACATCATAAGGAGTAAACTGTAGTAATTTTTTCACCACTACAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGcttaaagaactattaacaccaaaaaatgaaagtgtatcaaagtaattaagatgtggtgtgctgttgccttgtactggtgggggttgtgtgtttgcttcgaaacactacgatagtttgtatgtgcagggctgctctgtggccgtggaggtagctattcaaactgaaatatggctaaatggcacgttacgcagcagataaactctttaaaacaccattgtattctacagggcttatttatcatctgctatgtaacctgtgccttttcccagcttgaattcctgctcccatggctacacagcggcctgtttatgtgaactatagtagtgtttctgaggcacagaacttttgccagtgcagggcagcagtacattatattttaCTTAAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTACTCCTGCTACTGCGACTGGGAGATTATGTACCTGCTATGGGAATAAAATCTTCTTTTCCTGCTGT
  3   1   2       bld Tad5      in                         XZT16904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGATATATTTATGCTTTATTTAGATGCATCTGTCTTTATCATATGAACTTCTGTATGCATTCAACAGATTCATTTGGCTTTTCATCTTAGGcttaaagaactattaacaccaaaaaatgaaagtgtatcaaagtaattaaaatatggtgtactgttgccttgtactggtgggggttgtgtgtttgcttcaaaacactacgatagtttatatatgcaaggctgctctgtggccatggaggtagctattcaaactgaaatatggctaaatggcacgttacgcagcagataaactctttaaaacaccattgtattctacagggcttatttatcatctgctatgtaacctgtgccttttcccagcttgaattcctgctcccatggctgcacagcagcctatttatatgaactatagtagtgtttctgaggcacagaacttttaccagtgcagggcaacagtacattatattttacttactAAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTACTCCTGCTACTGCGACTGGGAGATTATGTCCCTGCTATGGGAATAAAATCTTCTTTTCCTGCTGTACCGGC
  3   1   1       add Ovi1      in                         CABI5134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTATttctacagggcttatttatcatctgctatgtaacctgtgccttttcccagcttgaattcctgctcccatggctacacagcagcctatttatataaactatggtagtgtttctgaggcacaggacttttgccagtgcagggcaacagtgcattatattttacttactAAAAAATTAAAGTGTTCTAAAGTATTACTGTTCCTTTAACGAGTGGCACTATTCATCTTCTTGTTCTTAACACTAACATTGTTGTAATGTAATGGCTCTCCTAACTACTCCTGCTACTGCGACTGGGAGATTATGTACCTGCTATGGGAATAAAATCTTCTTTTCCTGCGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)