Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012077989 Xt7.1-TTbA015g09.5 - 34 ESTs
                                                                       .....-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA015g09.5                                                                                                                                                                                                                                                                                                                  GTGGATTCGCTGTCCGGCAGGAGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAACTGAGGCTTGTTATTTCTTCTAGAATATTCCAGAGACTCTGGATATCCACATTACACAGTTCTCAAAGAGAAAGTTAAGATATAAGATGTTGCTTTAAGTCTTAACCTTCAGACTGTTCTAACATTTGGTGCATTATATCGGGGATATCAAACTGCTCCGTCTGTTGTCAAAGGGAATTCTAAATTATGCTAGAAGTTGTGTTGTTCATCTGTAGAGTTTGATATCCCTGCTTAATGTTGCTTCTGTAACCCAACCATATGTAGTATGGATTGTATCCATTTATTTTTCTTCTTCAGATACTGTCAGCTGTGCCAAATGTAAGACATAATGTTCTATAGACATAAGTACTGCGCACCCCCTCATATTGTATCGTTCCCATCAGAGGAGCATCTTCATTCAGTCACATACAAGGGTTTATTTGGACTTTAATATCTTTCTAAAGAACAGAGCTCTACCATATTTTCTGTACTGTTAATTGATTACCCTGGAAGAATGGCAGAGCTTTAAATAAAAGCCATGCATTATTCCCTGTGCTGAGA
                                                  Xt7.1-CHK-1008227478                                                                                                                                                                                                                                                                                                                        TCGCTGTCCGGCAGGAGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAACTGAGGCTTGTTATTTCTTCTAGAATATTCCAGAGACTCTGGATATCCACATTACACAGTTCTCAAAGAGAAAGTTAAGATATAAGATGTTGCTTTAAGTCTTAACCTTCAGACTGTTCTAACATTTGGTGCATTATATCGGGGATATCAAACTGCTCCGTCTGTTGTCAAAGGGAATTCTAAATTATGCTAGAAGTTGTGTTGTTCATCTGTAGAGTTTGATATCCCTGCTTAATGTTGCTTCTGTAACCCAACCATATGTAGTATGGATTGTATCCATTTATTTTTCTTCTTCAGATACTGTCAGCTGTGCCAAATGTAAGACATAATGTTCTATAGACATAAGTACTGCGCACCCCCTCATATTGTATCGTTCCCATCAGAGGAGCATCTTCATTCAGTCACATACAAGGGTTTATTTGGACTTTAATATCTTTCTAAAGAACAGAGCTCTACCATATTTTCTGTACTGTTAATTGATTACCCTGGAAGAATGGCAGAGCTTTAAATAAAAGCCATGCATTATTCCCTGTGCTGAGAATGATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                       3     5     4     6     4     9     8    12     7    12    12    14    12    14    12    14    12    14    12    14    12    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    14    14    13    14    14    14    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    17    15    17    15    17    15    17    15    17    15    17    14    17    14    17    15    17    15    17    14    16    14    15    12    15    12    15    12    16    13    17    13    17    13    17    12    16    12    16    12    16    11    16    12    17    12    17    12    17    12    16    12    16    12    16    12    16    12    16    11    15    11    15    10    14    10    14     9    14    11    16    10    14     8    14     9    13     9    13     9    13    11    14    10    13    10    13    10    13    10    13    11    13    10    11    10    11    10    11    10    11    10    12    11    12    11    12     9    12     9    12     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10     9    10     9    10     8    10     9    10     8    10     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     9    10    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12     9    10     9    10     8    10     8    10     8     9     7     9     7     8     7     8     6     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3
                                               BLH ATG     148     610                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     145      88                                                                                                                                                                                                                                                                                                                  
                                               BLH MPR     142      88                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     148      45                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN     148      88                                                                                                                                                                                                                                                                                                                  
                                               EST CLI      22      23                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     148       1                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sc ---= 8e-020     NP_010344.1 ubiquitin-conjugating enzyme; Ubc5p [Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dm ==== 4e-027     NP_648187.1 CG7375-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 4e-041     NP_493024.1 ubiquitin conjugating enzyme (ubc-12) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 1e-054     XP_790472.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 3e-088     NP_998479.1 zgc:77005 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Mm ==== 3e-098     NP_080730.1 RIKEN cDNA 2510010F15 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 1e-098     NP_542409.1 NEDD8-conjugating enzyme [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 6e-100     NP_001006512.1 similar to NEDD8-conjugating enzyme [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 6e-105     AAH70971.1 MGC78786 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = ?? ==== 6e-105     NP_001085021.1 hypothetical protein LOC432085 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Xt ==== 8e-107     AAH87785.1 Hypothetical LOC496657 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA015g09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---------------------------ATG------------------------------------------TAG------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------TAG------------------------TAA------------------------------------------TAA---ATG---------------------------------------------TGA---------------------------------------------------------------------------------------------TAA------TGA------TAG---------------------TAA------------------------------------------------------------------ATG---------------------TAG------------TGA---------------------------------------TAA---------------------TAA---------------------------------------------------------------------------------------------------------ATG---TAA---TAA---------ATG------------------------------ATG------ATG---------------TGA---TGA------------------TGA---TGA------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TAG---------------------------------------TAA------------------------------ATG------------------------------------------------ATGTAA------ATG------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------ATG---------TAA---------ATG---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           TpA  FL                     TTpA011n20.FL-Sanger                                                                                                                                                                                                                                                                                                                                       AGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCTTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Abd0 FL                     IMAGE:7002708.FL-MGC                                                                                                                                                                                                                                                                                                                                                 CTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGAAAAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       chi Ski1 5g3  in                         CABJ6270.5p TCAATTCGGCACGAGGTTTAAAGTGGGGCGCACAGCTGATTTTAAACCCATGTTTGAATCAGATTCTTTGTAAGTGCCACCCGTAAAGAAATAATATGAACAGGTGATTAAAGTTCAATAAAATGTAATACTATTATTTTTTAAAGGAAACATGTCAATCTAAGATATAATTCCAAATCCCATTTTTAGTCATGTTAGTCAAAGTTTACTTTTACTACATAAGTGTTGTCCAAATGCTTACATGGTGAGGCCAACATTTATTTATACAGCATGTTTAAGTCGCAGATTATATTGAAAAGATGATGTCATACAGTGAAGTCAGTGAAGCCCCCCCCCCCACCCCCCGAGAAGACTGGGGTCCTGTGGAAGGCCACATCAGACCCAAGACCTCCAGTTGGACTATATATTCAGTCTTGGAAGTTACAATCACAGCAAAAGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAGAACTT
  5   1   2       bld BrSp 5g                          EC2BBA15AH12.g1                                                                                                                                                                                                                                                                                          GGGGCGAGATGAGCGGTGTGACGTGTGGATTCGCTGTCCGGCAGGAGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCGGAGCATCAC
  5   1   2       bld In66 5x3                        IMAGE:8963923.5p                                                                                                                                                                                                                                                                                                         CTTTTTTCTTATTTTTCTAATTAAAATAAGTTGCCCGAGCTAGACCCTAACGGGGCTGAGGGACTCCCTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTTGAGGATTACATCAAGCGTTATGCCAGATGATGTTCACTGACCTTGCATTGAGCTCGGATCCCTTATTATGGAGAGACAGCCCACAGCCTCTGTAAGTCCTCTAGCTGATAGGGGAGAACTGGAACCCCCTGAACCGTTCTGCGTCTTTTCCTCTCCCCAAGACGTGAAATAATCTTA
  5   1   2       bld HeRe 5g3  in                     EC2CAA42AB03.g1                                                                                                                                                                                                                                                                                                          GGTGACGTGTGGATTCGCTGTCCGGCAGGAGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCACAGTGTCTGTTCGTGACAGATTAC
  5   1   2       bld TpA  5g                        TTpA041j05.p1kSP6                                                                                                                                                                                                                                                                                                              ACGTGCGGATTCGCTGTCCGGCAGGAGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCAAAGACTGAAATAACACTTTATACCTCCAGCTCCTGCACTCCTT
  5   1   2       bld HeRe 5g3  in                     EC2CAA28DF12.g1                                                                                                                                                                                                                                                                                                                      ATTCGCTGTCCGGCAGGAGTTAAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTTGACTCCTTGTTT
  5   1   2       bld TpA  FL   in                   TTpA011n20.p1kSP6                                                                                                                                                                                                                                                                                                                                        TTAAGGAGCTAGACCCTAACNGGGCCTGTGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCTTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCAC
  5   1   2       bld Abd0 FL                            IMAGE:7002708                                                                                                                                                                                                                                                                                                                                         CCCGGGATCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAA
  5   1   2       bld HdA  5x3  out                 THdA031d17.p1kaSP6                                                                                                                                                                                                                                                                                                                                          AAGGAGCTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGATAAAAAGGGGCTGTTGGGCCGTGGTGGGTGGCGTGATGCTTACTCTGGCCAGCAAGTTGAAACGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTTCTGATTCAACACGCAAAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAACATAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACCAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCCAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATTACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCTACTTCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCCATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACANATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACA
  5   1   2       bld HdA  5x3  ?                   THdA031d13.p1kaSP6                                                                                                                                                                                                                                                                                                                                           AAGGAGCTAGACCCTAACGGGGCTGAGGGCCTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGATACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCNAAGACTGAAATAAACAC
  5   1   2       bld TbA  5g                        TTbA036n24.p1kSP6                                                                                                                                                                                                                                                                                                                                               AGCTAGACCCTAACGGGGCTGAAGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCCAGATGATGTCACTGACCTTGC
  5   1   2       bld TbA  5g3  in                   TTbA036i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                 CTAGACCCTAACGGGGCTGAGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGNTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGANATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGGACCTGAAAATACAACT
  5   1   2      seed TbA  5g3  in                   TTbA015g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                    AGGGACTTTTTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTAC
  5   1   2       chi AbdN 5x3  in                     IMAGE:6997840.b                                                                                                                                                                                                                                                                                                                                                                             TTAACAGCGATCCGGGACTGCGGGCTGTGATAAGAAAATCGGCACTGTCCCGGAAAAAGAGGGGCTGTTGGGCGGTGGTGGGTGGCGTGATGCTTACACTGGCAAGCAAGTTGAAGCGGGACGATGGTGTTAAAGGAAGTAGAACATCTAGCACAACCTCTGATTCAACACGCAGAGTGTCTGTTCGTGACAGATTACTTGTAAAAGAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCNCCAAAGACTGAAATAACACTTTATACCTCAGCTCTGCACTCCTTCCAGCTCATGC
  5   1   2       bld Eye                                  CCAX3759.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTTGTTTAAGTTTGCTGAGGGGAGCATTCAATTGATGGAAACGGGGTTGG
  3   1   2       chi HeRe 5g3  in                     EC2CAA28DF12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGTAGCAGAGTTGGAGGCAAATTTGCCATGTACCTGTAAAGTAAATTTTCCCGATCCCAACAAGCTGCATTACTTCCATCTGACTGTGAGCCCAGATGAAAGCTATTACCAAGGAGGGAGATTCCAGTTTGAAATTGAAGTTCCAGATGCCTATAACATGGTGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTACCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTA
  5   1   2       bld Mus1      in                         CABH9121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAACACTGGTGCCTCCAAAGGTGAAATGTTTGACAAGGATCTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTANATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGT
  5  -1   2       bld Gas                            TGas024o15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACATGGTGCCTCCAAAGGTAAAATGTTTGACAAGGATGTGGCATCCCAACATCACCGAGACAGGAGAAATTTGTTTAAGTTTGCTGAGGGAGCATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGTTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTG
  5  -1   2       bld Egg       out                  TEgg041c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCAATTGATGGAACGGGTTGGGCTCCAACAAGAACTTTAAAGGATGTTGTGTGGGGATTGAACTCCTTGTTTACAGATCTATTAAATTTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTTTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTTTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAAAAAAAAAAAAAAAAAAGCGGCCGCGTC
  5  -1   2       bld AbdN                               IMAGE:7006642                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            NGCGGTGGATATATGAGCGAGAGAAACAAACATTGTGAGGAGTGTCCCCTCTCTCTTGGTGACACCAGTTATTTTTTGGGTTGTGTTATCTCTTATCACGCCCGCACAAAGGAGGGGAGTGTGTAAAAATGAGAAAACCACTTGTTATATTATATTATTACAAGAGTCTCCAGTTGACTACTCGCTTGTTTAACCCGAGGGTATGACGGTTCCCACCCCCGGAGTAATCCCGGGGAGAGGGAGACAGTATTTTTGTTTCCCGTTGGGCCCACTGCTGAATTAATTTTGTGGGCTTTAAAGAAATGGATTTGTTTTTTTTTTCACAAAATAGGGGGCCTCCCCAAATTATGTGGTTATTGTTTATTTAAAATCCGCGCAAATAAAGTTTCGCAAAAAAGAAAAAATTCTTGGAGATAATGGAGTTTTTTGTTTGAAAAATAAAAATATCTAGAATTAATTAAAATTTTTCCAGCCACTTGCTATAAATCTTCAAGGCCCTTGTCGATTAAGCCTACCATAGCCAGGGTTGAATGGGGCGTTAAGCCAGTTCCACTTTAACAATTTTAAGGGAGCCTTAATTTTTGCCTGTACGGGCAAACAAACAAAAAGATGTTATATAAGGAATTTGATCATTTTAGATATTTTTGGGTCAAGTTGTCAACAATTTGCAGTACAAGACTTCTTTGGGCCTTCTCAAACCAAGTCATACGATTAAGTTTAAGCCCTGCCATGCCCCTTTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTGACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTATATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAAGAAAAAAAAAAAAAAAAATCCCGGGAATTCAAGACCGAAACCTTTGT
  3   1   2       bld HeRe 5g3  in                     EC2CAA42AB03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATGTATTAAATGTTGATGACCCGTTAAACATTGAGGCAGCAGAGCATCACTTGAGAGATAAGGATGAATATCGGAATAAAGTTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACCTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGAC
  3   1   2       bld Mus1      in                         CABH9121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAGGATTACATCAAGCGTTATGCCAGATGATGTCACTGACTTTGCATTGAAGCTCGGATCCCTATTATGGAGAGACAGCCCACCAGCCTCTGTAGAGTCTCCAGAGCTGGATAGGGGAGGAAACTGGAGACCCCCTGGACACGTTCTGCGTCTTCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTGGAAATTGTATTCGCACCCTGAA
  3   1   2       bld AbdN 5x3  in                       IMAGE:6997840                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNTGCGTCTTCTCCCCCCAAAGACTGAAATAAACACTTTATACNTCCAGCTCNTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTATATAAATATTGAATTATCTCTCCAGCCTTTTAAAA
  3   1   2       bld BrSp                             EC2BBA25DE09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCCCCCCAAGAGACTGAAATAAACGCTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCAAAAAA
  3   1   2       bld Ski1 5g3  in                         CABJ6270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTCCCCCCAAAGACTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCT
  5   1   2       bld Brn4                                CAAL10114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAAATAAACACTTTATACCTCCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAAAAAAAANAAAANAAAAAAAAAA
  3   1   2       bld TpA  FL   in                    TTpA011n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGCTCCTGCACTCCTTTCCCAGCTCACTGCCACCGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAAAAAAAAAAAAAAAAAAAAAANAAGC
  3   1   2       bld Ski1      in                        CABJ12015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTT
  5   1   2       bld Ski1      in                        CABJ12015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGACCTGAAAATACAACTTTTCCCGTACCCCTCTATTGGTTTGGCTTCTGATGTGTGTGCTTTCTCAAGAGGGGCATCATAGTTTTGTATTGTCTTTAATCTGCAATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA015g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGTTACAAAAAGAAAAATCTTAAAAAATGAGTTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATTGGGGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTTTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTTTTTGGACCTACTCAAACCAAGTCATACGACTAAGTTTAAGCCCTACCATGCCCCTTTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCCCCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGGGGGGGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTTTTTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCCTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Tad5                                 XZT60390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGTTTGCTTGAAATAAAATATGAGAATAAGAAAGTTTCCAGCACTGCATAAACTGCAGGCCCTGCATTGAGCCTCCATACCAGGTTCATCGGCGTCAGCCAGTCACTTTAACATTGGATGGAGCCTAACTCTGCCCGTCCTGCTAACAAACAAAGCTGTTATATAAGGAATTTGATCATTTTAGATATTTTGGGTCAAGTTGTCCTAAATTTGCAGTACAAGACTTCTTTGGACCTTCTCAAACCAAGTCATACGACTAAGTCTAAGCCCTACCATGCCCCTCTCCTGTGAAACCAATTAGGGCGTTAGAGACTGAGCGCACAGAGGGAGATGGGAGCTAGACACCAAATTAACATAACAAACCTCACCAAACAGCAGATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAACTGAGGCTTGTTATTTCTTCTAGAATATTCCAGAGACTCTGGATATCCACATTACACAGTTCTCAAAGAGAAAGTTAAGATATAAGATATTGCTTTAAGTCTTAACCTTCAGACTGTTCTAACATTTGGTGCATTATATCGGGGATATCAAACTGCTCCGTCTGTTGTCAAAGGGAATTCTAAATTATGCTAGAAGTTGTGTTGTTCATCTGTAGAGTTTGATATCCCTGCTTAAATGTTGCTCTGTAACCCCACCATATGTAGTATGGATT
  3   1   2       bld TbA  5g3  in                    TTbA036i09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAACAGCAGATAACCTCCGCGNTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAACTGAGGCTTGTTATTTCTTCTAGAATATTCCAGAGACTCTGGATATCCACATTACACAGTTCTCAAAGAGAAAGTTAAGATATAAGATGTTGCTTTAAGTCTTAACCTTCAGACTGTTCTAACATTTGGTGCATTATATCGGGGATATCAAACTGCTCCGTCTGTTGTCAAAGGGAATTCTAAATTATGCTAGAAGTTGTGTTGTTCATCTGTAGAGTTTGATATCCCTGCTTAATGTTGCTTCTGTAACCCAACCATATGTAGTATGGATTGTATCCATTTATTTTTCTTCTTCAGATACTGTCAGCTGTGCCAAATGTAAGACATAATGTTCTATAGACATAAGTACTGCGCACCCCCTCATATTGTATCGTTCCCATCAGAGGAGCATCTTCATTCAGTCACATACAAGGGTTTATTTGGACTTTAATATCTTTCTAAAGAACAGAGCTCTACCATATTTTCTGTACTGTTAATTGATTACCCTGGAAGAATGGCAGAGCTTTAAATAAAAGCCCATGCATTATTCCCTGTGCTGAGAATGATGTTGGCCTTGACATTTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Kid1      in                        CABA10607.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAACTGAGGCTTGTTATTTCTTCTAGAATATTCCAGAGACTCTGGATATCCACATTACACAGTTCTCAAAGAGAAAGTTAAGATATAAGATGTTGCTTTAAGTCTTAACCTTCAGACTGTTCTAACATTTGGTGCATTATATCGGGGATATCAAACTGCTCCGTCTGTTGTCAAAGGGAATTCTAAATTATGCTAGAAGTTGTGTTGTTCATCTGTAGAGTTTGATATCCCTGCTTAATGTTGCTTCTGTAACCCAACCATATGTAGTATGGATTGTATCCATTTATTTTTCTTCTTCAGATACTGTCAGCTGTGCCAAATGTAAGACATAATGTTCTATAGACATAAGTACTGCGCACCCCCTCATATTGTATCGTTCCCATCAGAGGAGCATCTTCATTCAGTCACATACAAGGGTTTATTTGGACTTTAATATCTTTCTAAAGAACAGAGCTCTACCATATTTTCTGTACTGTTAATTGATTACCCTGGAAGAATGGCAGAGCTTTAAATAAAAGCCATGCATTATTCCCTGTGCTGAGAATGATGTG
  5   1   2       bld Kid1      in                        CABA10607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAACCTCCGCGCTATTATACAGCCTTTATTGTGGGAGTGTGGCTCTATAACATATGGAATTGTGCATATTCCAGTATATGCCGGCTGCTTTCAAATAAACATGAAAATATGTTTTAACCTTAAGAAAGCCACATGTTCTCTTGGAAATTGTATTCGCACCCTGAAATGTACTATATGAGTAATATAAATATATGAATATGATCTATCTTTGCACTGGCATGAAACTGAGGCTTGTTATTTCTTCTAGAATATTCCAGAGACTCTGGATATCCACATTACACAGTTCTCAAAGAGAAAGTTAAGATATAAGATGTTGCTTTAAGTCTTAACCTTCAGACTGTTCTAACATTTGGTGCATTATATCGGGGATATCAAACTGCTCCGTCTGTTGTCAAAGGGAATTCTAAATTATGCTAGAAGTTGTGTTGTTCATCTGTAGAGTTTGATATCCCTGCTTAATGTTGCTTCTGTAACCCAACCATATGTAGTATGGATTGTATCCATTTATTTTTCTTCTTCAGATACTGTCAGCTGTGCCAAATGTAAGACATAATGTTCTATAGACATAAGTACTGCGCACCCCCTCATATTGTATCGTTCCCATCAGAGGAGCATCTTCATTCAGTCACATACAAGGGTTTATTTGGACTTTAATATCTTTCTAAAGAACAGAGCTCTACCATATTTTCTGTACTGTTAATTGATTACCCTGGAAGAATGGCAGAGCTTTAAATAAAAGCCATGCATTATTCCCTGTGCTGAGAATGATGTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)