Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA014b03.3                         12 END     3          18       25                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012078009 Xt7.1-CABH11788.5 - 16 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABH11788.5                                       GCTGGGTCAGGGGTTACTGTTGACGTCTGTGGCCCGGTAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGCCGCAGGATTTAAGCGGGAGGGAGTTCTGTCGCGACTCTCCACCCGGCAGGCCGAACATCTCACTGTGAACATTACGATGGACAAACGAAAGTCCCTTGTACCTCGTTACTAGGGAGTGAAATTAAAACAATGGG
                                                  Xt7.1-CHK-1008232172                                             TCAGGGGTTACTGTTGACGTCTGTGGCCCGGTAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGCCGCAGGATTTAAGCGGGAGGGAGTTCTGTCGCGACTCTCCACCCGGCAGGCCGAACATCTCACTGTGAACATTACGATGGACAAACGAAAGTCCCTTGTACCTCGTTACTAGGGAGTGAAATTAAAAC
                                                      consensus depths                                            2     4     2     5     2     5     3     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    12    13    12    13    12    13    12    13    13    14    13    14    13    14    12    14    12    14    12    14    12    14    12    13    11    12    11    12    11    12     8    10     8    10     8     9     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     6     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                               BLH ATG      67    1331                                       
                                               BLH MIN      67     167                                       
                                               BLH OVR      67     950                                       
                                               CDS MIN      67       3                                       
                                               EST CLI     -12       3                                       
                                               ORF LNG      67      83                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 7e-009     NP_497320.2 Y46E12BL.3 [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN --- Ci ---- 1e-010     BAB79622.1 Ci-META3 [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dm ==== 4e-040     NP_648819.2 CG10516-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PREDICTED - Sp ---- 1e-061     XP_001181890.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PREDICTED - Dr ---- 1e-103     XP_688343.1 PREDICTED: similar to SPRY domain-containing SOCS box protein SSB-3 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Mm ---- 7e-151     NP_081417.1 T-complex expressed gene 1 [Mus musculus] --------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN === Hs ==== 1e-155     NP_543137.2 SPRY domain-containing SOCS box protein SSB-3 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED = Gg ==== 3e-166     XP_414716.2 PREDICTED: similar to mKIAA4204 protein [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH87357.1 LOC496145 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED = ?? ==== 0          NP_001088836.1 hypothetical protein LOC496145 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN === Xt ==== 0          CAJ83905.1 SPRY domain-containing SOCS box protein ssb3 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABH11788.5                                                                            TAA---TAG------------TAA------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------ATG------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------ATG---ATG
                                                                   ORF                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Gas  FL                     TGas007f05.FL-Sanger                                                                            TAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGCCGCAGGATTTAAGCGGGAGGGAGTTCTGTCGCGACTCTCCACCCGGCAGGCCGAACATCTCACTGTGAACATTACGATGGACAAACGAAAGTCCCTTGTACCTCGTTACTAGGGAGTGAAATTAAAACAATGGGAATGCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te5       in                        CAAO12414.5p           TCTGACTTGCATTGGAGGGCAGGCCGGGGCTGGGTCAGGGGTTACTGTTGACGTCTGTGGCCCGGTAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACACTGAGGAACAAAAAGCTCTTCCCTATGGTCT
  5   1   2   20  bld Te1  5g                              CBWN5373.b1 ..........................GCTGGACATCACTATAAAGGCATACAGCCTATGACATACTACTTACGCTTGGCTACATGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTAT
  5   1   2   12  bld Gas7 PIPE in                         XZG53968.5p ...........................GGAGTCTGTGAGGGCTCCGGGGGGAGAGCTAAGTTTGCCAGGAGGCTACAGTAAATGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAGGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTG
  5   1   2   24 seed Te3  5g3  out                       CAAM15395.5p ................................GCCGGGGCTGGGTCAGGGGTTACTGTTGACGTCTGTGGCCCGGTAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCAT
  5   1   2       bld Te5       in                         CAAO3929.5p                                           CAGGCATCGTTTGCAGACTGACATTGCCCGATAGCCAACTGGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTTGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGANATGCATCGGTGTCGCGGCCACACAACTGAGGA
  5   1   2   24  bld Te5  5g                              CAAO2232.5p ...................................................................CTTACGCTTGGCTACATGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTATTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTG
  5   1   2   20  bld Mus1 5g                             CABH11788.5p ..........................................................................GTAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCCAGTGCTTCCAGACTC
  5   1   2       bld Gas  FL                        TGas007f05.p1kSP6                                                                            TAACTATAGGTGCTCCCCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGC
  5   1   2   20  bld Ski1 5g3  out                       CABJ10551.5p ...........................................................................................CCAGATAACACAGGATGGCACGTCGTCCACGTAACAGCCGTGCCTGGCGTTTCGTTCTTAGTGGTGTGCGCAGGGATCAGGATGCCCGCTCTCCAACCTTACCAGCAGAGGAGGAAGCATGGGGTTATGACTCTGATGGTCAGCACAGTAACAGTGACTCTGACACAGACCTGCTTCACTTGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTACTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGC
  5   1   2       bld Te5       ?                         CAAO10338.5p                                                                                                                                                                                                                                                                                TGCCCCCCTCCATCCCTAGCGCTGTGCCTGTGACGGGAGAGTCGTATTGCGATTGCGACAGTCAGAATGATCCCTATTGCTCCAGCCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTC
  5   1   2       bld Gas                            TGas037g21.p1kSP6                                                                                                                                                                                                                                                                                                                                 CGATTGCGACAGTCAGNATGATCCCTATTGCTCCAACCTGCACACTTTCCATCAGATCAAGAGCTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTT
  5   1   2       bld Tad0                               IMAGE:6986110                                                                                                                                                                                                                                                                                                                                                                                                CTGCCAGTGTGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTATCAACCGCTCCAACCACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGAT
  5   1   2       bld Te3       out                        CAAM8872.5p                                                                                                                                                                                                                                                                                                                                                                                                         TGGAGAGGAAGACAACTACTTCGACTGGGTGTGGGATGATTGCAGTAAATCCACGGCGACCGTACTGAGTTGTGACAACCGGAAGGTCAGTTTCCACATGGAGTACAGCTGCGGCACCGCGGCCATACGCGGCAACAGAATGCTCACCGAAGGGCAGCACTTCTGGGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGC
  3   1   2       bld Te5       in                        CAAO12414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGATCAAGATGACATCCCCAGTCTATGGCACAGATATGATGGTTGGCATTGGGACTTCCGATGTGAACCTAGATAAATATCGTCACACGTTTTGCAGCCTTTTGGGCAAGGATGCAGAGAGCTGGGGACTCTCTTACACAGGCCTTCTCCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACCTCTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGCCGCAGGATTTAAGCGGGAGGGAGTTCTGTCGCGACTCTCCACCCGGCAGGCCGAACATCTCACTGTGAACATTACGATGGACAAACGAAAGTCCCTTGTACCTCGTTACTAGGGAGTGAAATTAAAACAATGGGAATGC
  3   1   2       bld Te5       in                         CAAO3929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGCACAAGGGAGACAAAAGCAACTTCTCCTCACGCTTTGGCCAAGGCTCCATTATTGGAGTGCACCTGGACACATGGCATGGAGTGTTAACTTTCTATAAAAACAGGAAATGCATCGGTGTCGCGGCCACACAACTGAGGAACAAAAAGCTCTTCCCTATGGTCTGTTCCACAGCAGCTAAGAGCAGCATGAAGGTGATTCGCTCCTGCTGCTGCCGCACCTCGCTCCAGTACTTTTGCTGCGCCCGCCTGCGCCAGTTGCTTCCAGACTCTGTGGACTCTCTGGAGGTCCTTCCCCTCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGCCGCAGGATTTAAGCGGGAGGGAGTTCTGTCGCGACTCTCCACCCGGCAGGCCGAACATCTCACTGTGAACATTACGATGGACAAACGAAAGTCCCTTGTACCTCGTTACTAGGGAGTGAAATTAAAACAATGGGAATGC
  3   1   2       bld Gas7 PIPE in                         XZG53968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCCTCCTGGTCTCAAACAAGTGCTGGGTAATAAGCTGGGATGGGTTCTGCAAATGGGTTCAAACCGCTCCAACCAACACAAAGGCGACACCTCAGCGACCACCTCCTGTGGGAGCGACTCAGACAGCAGCTGCACACCCGGACAGGACGACTGTCAGCGCAAGCGATGCCGCAGGATTTAAGCGGGAGGGAGTTCTGTCGCGACTCTCCACCCGGCAGGCCGAACATCTCACTGTGAACATTACGATGGACAAACGAAAGTCCCTTGTACCTCGTTACTAGGGAGTGAAATTAAAACAATGGGAATGCAGGAAATGGGTTTCCATTTCGCTTATTTGTTATTCTTTGAATGACTGAGAATAATGGTGCTTAAGTATTTCTGCTCACCCAAAGTTTGGTCTCAGCTGATGTTTTAAGAGGCGACAGTCCTAACGATTGTGATGCACAGAACTATCCTCATTCTGAACTCTAGGGCAACAACAGGAAGTGCCCTTTTGTGTTTCCCATGCAAACCATTAAACTGACAGCTCACAAGGGTGGAATTGTTCTTAAGGAGTGAACTGGGCCAGCCCGGAAAGATCCACACATGTGATTATTACCTTTTATAGATGGTATCACTGAAACAGAATAAGTACCCGCCACGGTTTTTATTTTATTTTTGTTCAACGGGTTACCCTTTTAACGAGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)