Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA020i04.3                          6 END     1           4       16                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012078028 Xt7.1-CABD11171.3 - 23 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD11171.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCTCATTACAACAGAAACCTTTGCAGACGACCGTCAGCATGGGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGAAGAAGAGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCTAAAGTTTCTTCCCATAAGTGCTCAAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTCCCGTTCCCCATCCTTGTCCCCCAATCTGTCCTACCCAAGTGACCAAAGAAGTCTGTTCCTTGATTACTCCAGCCATAGTGCAGATTCCGTGGAACCTTTAAACCTCTCCGCAAGCTCCAAAACAAGACTATCATCATGCCATCCACCCAAAGCCAAGAAGCCCAAAGGCCTAGAAATCTGCTCCCCACCTATGCTCCTCTCTAGTAGTGATATTGGATCCATTGCTCTCAATAGCCCAGCTCTTCCTTCAGGATCCATGACCCCAGCTTTCTTCACTGCTCAGACACCAAATGGATTACTGTTAACCCCTAGTCCACTTTTGTCCAGCATTCACTTCTGGAGCAGTCTTAGTCCTGTAGCTCCATTAAGTCCTGCCAGGCTGCAAGGACCAAACACCTTGTTCCAGTTTCCCAGCCTGCTGAATGGTCATTTGCCAATGCAGCTGCCAGGAATGGACAGAGCATCATCTCCAGTGTTACTATCATCCAACACCCACAAATCCTGATGCACTATGGGATGGACTGTAATAACATTACCCATAATAATACCCTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAGTGTTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAATTGCTTTAAATTGTAGTTCAAAGGTGAGTAGGGGAACCACAGGTTGGCGCTATGTATTAAATATAACAGAATATGTGATATAGATGTGGTATATGCAAAGTATTGAGCACTGCTGAATTCCATTTCTCCAGAAGTTGACACAGTGGGCTAGTTATAACAACCCCTATAAAGTTAATAGTTTGGGAATGGAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACTAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008229674                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTACAACAGAAACCTTTGCAGACGACCGTCAGCATGGGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGAAGAAGAGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCTAAAGTTTCTTCCCATAAGTGCTCAAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTCCCGTTCCCCATCCTTGTCCCCCAATCTGTCCTACCCAAGTGACCAAAGAAGTCTGTTCCTTGATTACTCCAGCCATAGTGCAGATTCCGTGGAACCTTTAAACCTCTCCGCAAGCTCCAAAACAAGACTATCATCATGCCATCCACCCAAAGCCAAGAAGCCCAAAGGCCTAGAAATCTGCTCCCCACCTATGCTCCTCTCTAGTAGTGATATTGGATCCATTGCTCTCAATAGCCCAGCTCTTCCTTCAGGATCCATGACCCCAGCTTTCTTCACTGCTCAGACACCAAATGGATTACTGTTAACCCCTAGTCCACTTTTGTCCAGCATTCACTTCTGGAGCAGTCTTAGTCCTGTAGCTCCATTAAGTCCTGCCAGGCTGCAAGGACCAAACACCTTGTTCCAGTTTCCCAGCCTGCTGAATGGTCATTTGCCAATGCAGCTGCCAGGAATGGACAGAGCATCATCTCCAGTGTTACTATCATCCAACACCCACAAATCCTGATGCACTATGGGATGGACTGTAATAACATTACCCATAATAATACCCTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAGTGTTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAATTGCTTTAAATTGTAGTTCAAAGGTGAGTAGGGGAACCACAGGTTGGCGCTATGTATTAAATATAACAGAATATGTGATATAGATGTGGTATATGCAAAGTATTGAGCACTGCTGAATTCCATTTCTCCAGAAGTTGACACAGTGGGCTAGTTATAACAACCCCTATAAAGTTAATAGTTTGGGAATGGAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACTAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     2     3     3     4     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     7     8    10    11    10    11    10    11     9    10     9    10    10    10    10    10    11    11    11    11    11    11    12    12    13    13    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    12    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    12    11    12    12    12    11    12    11    12     9    11     2     4     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                               BLH ATG     127     494                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      91     177                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     127     588                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     127      60                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Bb ==== 2e-017     BAE46385.1 Ets1/2 [Branchiostoma belcheri] ========================================================================================
                                                                       ...PROTEIN --- Dm ---- 6e-024     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 8e-027     NP_001023051.1 abnormal cell LINeage family member (lin-1) [Caenorhabditis elegans] -----------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 4e-039     BAE06397.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sp ---- 2e-046     NP_999792.1 transcription factor Elk [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 4e-124     NP_001025279.1 hypothetical protein LOC557074 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 5e-171     NP_038536.1 ELK3, member of ETS oncogene family isoform a [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 2e-177     NP_001025920.1 ELK3 protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 2e-178     NP_005221.2 ELK3 protein [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 0          AAH56051.1 Elk3-prov protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 0          NP_001080877.1 ELK3, member of ETS oncogene family [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          NP_001072600.1 ELK3 protein [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD11171.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG------------------------------TAG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------TGA------ATG------------------------------------------------------TGA------TGA------------------------------------------------------------------------TAA---------------ATG------TAA---TGA---------------------------------------------------------------------------------TAGATG------ATG------------------TGA---------------------------------------------------------------------ATG---------------------------------------------------------TAG---------------------------------------------------------------------ATG---------TAG------------ATG---------------------------TGA------------------------------------------------------TGA---------------------------------------------------------ATG---------------------TAA---TGA---------------------------------TAG---------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAA---------------TAA------------------------------------------------TAA---------ATG------------------------------TGA---------------------------------------------------------------------------------ATG---------------------------------------------TAG------------------------------------------TAA---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Te4  FL                          CAAN3084.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGATGCTAAACATGAGCAGCGGCCAGAGAGAGGAGAGGGAGGAAAAGCCTGTTTACACAGACTGCAAACCGCCTGGGGAATAATGCAGGAAAGGAAGTGAGCCGGCTCTCTGTCTGACTGCTCCAACTTCCTGCTCTCTCACACACACACATACACACACACACACACATATATACCAAAGGGGAAAAAAGAAAAGAAAGAAAAAAAATCAGGATCTCATTACAACAGAAACCTTTGCAGACGACCGTCAGCATGGGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGAAGAAGAGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCTAAAGTTTCTTCCCATAAGTGCTCAAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTCCCGTTCCCCATCCTTGTCCCCCAATCTGTCCTACCCAAGTGACCAAAGAAGTCTGTTCCTTGATTACTCCAGCCATAGTGCAGATTCCGTGGAACCTTTAAACCTCTCCGCAAGCTCCAAAACAAGACTATCATCATGCCATCCACCCAAAGCCAAGAAGCCCAAAGGCCTAGAAATCTGCTCCCCACCAATGCTCCTCTCTAGTAGTGATATTGGATCCATTGCTCTCAATAGCCCAGCTCTTCCTTCAGGATCCATGACCCCAGCTTTCTTCACTGCTCAGACACCAAATGGATTACTGTTAACCCCTAGTCCACTTTTGTCCAGCATTCACTTCTGGAGCAGTCTTAGTCCTGTAGCTCCATTAAGTCCTGCCAGGCTGCAAGGACCAAACACCTTGTTCCAGTTTCCCAGCCTGCTGAATGGTCATTTGCCAATGCAGCTGCCAGGAATGGACAGAGCATCATCTCCAGTGTTACTATCATCCAACACCCACAAATCCTGATGCACTATGGGATGGACTGTAATAACATTACCCATAATAATACCCTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAGTGTTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAATTGCTTTAAATTGTAGTTCAAAGGTGAGTAGGGGAACCACAGGTTGGCGCTATGTATTAAATATAACAGAATATGTGATATAGATGTGGTATATGCAAAGTATTGAGCACTGCTGAATTCCATTTCTCCAGAAGTTGACACAGTGGGCTAGTTATAACAACCCCTATAAAGTTAATAGTTTGGGAATGGAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACTAAAAAAAAAAAAAAAA
  5   1   2       bld Te4  FL   in                         CAAN3084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGCTAAACATGAGCAGCGGCCAGAGAGAGGAGAGGGAGGAAAAGCCTGTTTACACAGACTGCAAACCGCCTGGGGAATAATGCAGGAAAGGAAGTGAGCCGGCTCTCTGTCTGACTGCTCCAACTTCCTGCTCTCTCACACACACACATACACACACACACACACATATATACCAAAGGGGAAAAAAGAAAAGAAAGAAAAAAAATCAGGATCTCATTACAACAGAAACCTTTGCAGACGACCGTCAGCATGGGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACNAGGTTATCAAAACAGAAAACTTACAGGAACATG
  5   1   2       bld TbA  5g3  in                   TTbA010f15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCTCATTACAACAGAAACCTTTGCAGACGACCGTCAGCATGGGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGGAAAAGAGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGAACAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGC
  5   1   2   10  bld Te1  5g3  in                         CBWN9946.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCAATAGCAAAACAGTGAGGATGCTCTGGTCGGAAACATTAGAGTTACGGGATATGGAAAGATCAGCATCGTTATGTTGCCATGAGAAACTGTTCCCCCAAGTACAGTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCGTGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGAAGAAGAG
  5   1   2       bld Lun1      in                        CABD11171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACCGTCAGCATGGGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGAAGAAGAGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCTAAAGTTTCTTCCCATAAGTGCTNCAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTTCCGTTCCCCATCCTTGTCCCCCCATCTGTCCTACCCAAGTGAC
  5   1   2   10  bld Liv1 PIPE in                         CAAR9889.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAAACGAAGGGATTTTACCAATATCACTTTAGAAAGTTATAAAGGGCAGAAGAAAGTTGCTAGAGGACAGCAGGAGTTTGGGTATGGAGAGTGCAATCACACTGTGGCAGTTCCTGTTGCAATTGCTACTGGATCAGAAACATGAGCACCTTATCTGCTGGACATCAAACGATGGGGAATTCAAGCTGCTCAAGGCTGAAGAGGTGGCCAAACTCTGGGGGCTTAGGAAGAATAAAACTAACATGAACTACGACAAACTGAGTCGGGCCCTTCGGTATTACTATGATAAGAATATTATCAAAAAGGTTATCGGACAGAAATTTGTGTACAAGTTTGTTTCCTTCCCGGAGATACTAAAGATGGATCCGCACTCGGTGGAAGTCAGCAGGGAGAGCATGTTGCTGCAGGACAGCGACTGCAAGATCCCCTCTGATCTCAGAGAACGTCATAAACAAACACTGGCAGCACTGAAGAGTGCCAGTCGCAATGAATATATCCACTCAGGCCTCTATTCCTCCTTCACTATTAACTCCCTGCAAAACCAGACAGAGAACTACAAGGTTATCAAAACAGAAAACTTACAGGAACATGAAGAGGAGGAGGAGGAGGAAAAGGAAGAAGAGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCAAAAGTTTCTTCCCATAAGTGCTCAAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTCCCG
  5   1   2       bld Spl1      out                        CABK3876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGAGGAGGAGGAAGTAAAACCATCCATCAGGAACTTGGTGGAGGAAACCAGAACTGTCATAAGATTTGTTACAAACAAAACAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCTAAAGTTTCTTCCCATAAGTGCTCAAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTCCCGTTCCCCATCCTTGTCCCCCAATCTGTCCTACCCAAGTGACCAAAGAAGTCTGTTCCTTGATTACTCCAGCCATAGTGCAGATTCCGTGGAACCTTTAAACCTCTCCGCAAGCTCCAAAACAAGACTATCATCATGCCATCCACCCAAAGCCAAGAAGCCCAAAGGCCTAGAAATCTGCTCCCCACCTATGCTCCTCTCTAGTAGTGATATTGGATCCATTGCTCTCAATAGCCCAGCTCTTCCTTCAGGATCCATGACCCCAGCTTTCTTCACTGCTCAGACACCAAATGGATTACTGTTAACCCCTAGTCCACTTTTGTCCAGCATTCACTTCTGGAGCAGTCTTAGTCCTGTAGCTCCATTAAGTCCTGCCAGGCTGCAAGGACCAAACACCTTGTTCCAGTTTCCCAGCCTGCTGAATGGTCATTTGCCAATGCAGCTGCCAGGAATGGACAGAGCATCATCTCCAGTGTTACTATCATCCAACACCCACAAATCCTGATGCACTATGGGATGGACTGTAATAACATTACCCATAATAATACCCTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAAGTGTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAATTGCTTTAATTTGTAGTTCAAAGGTGAGTAGG
  5   1   2       bld Fat1      in                         CABC7649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGATAAGCAATCTGTCCGACCAGTGGTTTCCTTGCCAACTACATCAGAATCATCGGCTTTCCTTTCCTCTTTGTCTGCTAAAGTTTCTTCCCATAAGTGCTCAAATGCAGCTAGTGTATCCTCAGTATCTCCTCGCTCTTCCCGTTCCCCATCCTTGTCCCCCAATCTGTCCTACCCAAGTGACCAAAGAAGTCTGTTCCTTGATTACTCCAGCCATAGTGCAGATTCCGTGGAACCTTTAAACCTCTCCGCAAGCTCCAAAACAAGACTATCATCATGCCATCCACCCAAAGCCAAGAAGCCCAAAGGCCTAGAAATCTGCTCCCCACCTATGCTCCTCTCTAGTAGTGATATTGGATCCATTGCTCTCAATAGCCCAGCTCTTCCTTCAGGATCCATGACCCCAGCTTTCTTCACTGCTCAGACACCAAATGGATTACTGTTAACCCCTAGTCCACTTTTGTCCAGCATTCACTTCTGGAGCAGTCTTAGTCCTGTAGCTCCATTAAGTCCTGCCAGGCTGCAAGGACCAAACACCTTGTTCCAGTTTCCCAGCCTGCTGAATGGTCATTTGCCAATGCAGCTGCCAGGAATGGACAGAGCATCATCTCCAGTGTTACTATCATCCAACACCCACAAATCCTGATGCACTATGGGATGGACTGTAATAACATTACCCATAATAATACCCTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAGTGTTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAAATGCTTTAAAATGTAGT
  5   1   2       bld Tad5      in                         XZT63757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCAGGATCCATGACCCCAGCTTTTCTTCACTGCTCAGACACCAAATGGATTACTGTTAACCCCTAGTCCACTTTTGTCCAGCATTCACTTCTGGAGCAGTCTTAGTCCTGTAGCTCCATTAAGTCCTGCCAGGCTGCAAGGACCAAACACCTTGTTCCAGTTTCCCAGCCTGCTGAATGGTCATTTGCCAATGCAGCTGCCAGGAATGGACAGAGCATCATCTCCAGTGTTACTATCATCCAACACCCACAAATCCTGATGCACTATGGGATGGACTGTAATAACATTACCCATAATAATACCCTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAGTGTTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAATTGCTTTAAATTGTAGTTCAAAGGTGAGTAGGGGAACCACAGGTTGGCGCTATGTATTAAATATAACAGAATATGTGATATAGATGTGGTATATGCAAAGTATTGAGCACTGCTGAATTCCATTTCTCCAGAAGTTGACACAGTGGGCTAGTTATAACAACCCCTATAAAGTTAATAGTTTGGGAATGGAAGTCCGTTTCANAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATNCAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATA
  5   1   2       bld Tad5                                  XZT1243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTTCCTGGAGTAATCTGTGAAGAGCATGACCTTTTTTACTTGGCACTTTTTCTTGTTGTCTACCTGAATTATGTTCCAAGTGTTGTACCGCAACACCAAATTAATCTGCAACTCCCAGCATGCTCCATTAACTATGAATTGCTTTAAATTGTAGTTCAAAGGTGAGTAGGGGAACCACAGGTTGGCGCTATGTATTAAATATAACAGAATATGTGATATAGATGTGGTATATGCAAAGTATTGAGCACTGCTGAATTCCATTTCTCCAGAAGTTGACACAGTGGGCTAGTTATAACAACCCCTATAAAGTTAATAGTTTGGGAATGGAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTTGTA
  5   1   2       bld Sto1      in                         CABG6322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCCAGCATGCTCCATTAACTATGAATTGCTTTAAATTGTAGTTCAAAGGTGAGTAGGGGAACCACAGGTTGGCGCTATGTATTAAATATAACAGAATATGTGATATAGATGTGGTATATGCAAAGTATTGAGCACTGCTGAATTCCATTTCTCCAGAAGTTGACACAGTGGGCTAGTTATAACAACCCCTATAAAGTTAATAGTTTGGGAATGGAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAAT
  5   1   2       bld Tad5      in                         XZT45727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGGGAATGGAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGATACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAA
  3   1   2       bld TpA                             TTpA017o14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGATACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAAAAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCGGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATANAAAAATGCCACACTAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Lun1      in                        CABD11171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGTCCGTTTCAAAACCGCTAAAAGCAAAGTTCTGAGTAGTGATCACTGCACAACATAGTTTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACTAAA
  3   1   2       bld TbA  5g3  in                    TTbA010f15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTGTTGTGGCCATAGTAGCCCAAAACATAAACACAGACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTTTTTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTTTTGCAATTGCAAAAGTTTCACTTATTTTTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTTTAGAATGTTTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACTAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Fat1      in                         CABC7649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTGGACTTCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACT
  3   1   2       bld Sto1      in                         CABG6322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTAATCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACT
  3   1   2       bld Te4  FL   in                         CAAN3084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACT
  3   1   2       bld Tad5      in                         XZT45727.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAGCCACATGTAATGGTAAACATCTAGCCCAATGCAGTAATGGATAAGGCCCCCATACCCTTATGGCAGTGATTGTCAACCTGTGGCTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGATACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTTTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTTTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACCCT
  3   1   2       bld Liv1 PIPE in                         CAAR9889.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTCCAACTGTTGCCATACTACAACTCTCAGCTTCTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTTTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACTAAAAAAAAAAAAAAAAAAC
  3   1   2       bld Te1  5g3  in                         CBWN9946.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGATACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCCGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAAAAATGCCACACCAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT63757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGATCGTCTGGATGTTGGGGTTTTAGTGCGGCACTGGCTACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTTTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACACT
  5   1   2       bld Tad5                                 XZT32701.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTTAGTGCGGCACTGGATACAGAAAGACTATTAGATCACATGAAGAATCAGGGGCACAGGAAATAACTATGAAATCAGTTTGCAGTCGGCGCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCATTTTTATTAAAATATGGCCTTAAACTTTTTTTTTAATTTGAGGTAAAAAAATAAATAAATAAAAAATGCCACAC
  5   1   2       bld HdA                            THdA022b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAAACTATGAAATCAGTTTGCAGTCGGCTCAACGTTCATTTATTAGAAGTGTCTCTGGCCTTTCAGATGATCTTGTTACTTTCAGCTAGACAGCGACCAGTTGCCAATCTTTGCCTTATGTTATGCACTTGAGCTTATAGAAACTATAACCGGCTGTGCCTTCTCTTGCATACTAAGTTGTACGTTTGTGTATTTTACATTATGGATAACACTTATGGGGAAGTAAACTGTATTAGGGCAATAAAAAGAAGAAAGTGAGATTCTTGCAATTGCAAAAGTTTCACTTATTTCTTAAACAATTTGGATGATAAAAGGTAAACAAAAAACTAAATTGCATTGACTTAAGCATCAGCTTTTCATTTTTTGCCCTATTACTATATCCCCCCCCCCCTTTAGACTGAGATACCTCTTTCTTTCTAGAATGTCTAAGCCCCAATTCCCAAACATATACTCCAGCCTTGTTTGTATTTAGTGCTTTTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)