Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG4151.5.5                          86 END     1           2        1                Unknown (protein for MGC:122030) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZT38551.5.5                         28 END     1           2        3                Hypothetical LOC496641 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 94%

 1012078042 Xt7.1-CAAQ6682.3.5 - 44 ESTs
                                                                       ....-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ6682.3.5                                                                           CCCAGGGCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAACAAAAAACAAATTAAACAA
                                                  Xt7.1-CHK-1008226367                                                                                 GCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAAAAAAAAAxAAAxxAAxxAxCATTTT
                                                      consensus depths                                                                                2     2     2     2     2     2     4     5     6     7     8     9     9     9     9     9     9    10    11    11    11    11    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    10    13    10    13    10    13    11    14    12    15    11    16    11    15    12    17    12    17    12    18    12    18    12    18    12    18    12    18    12    18    11    16    11    16    11    16    13    17    12    17    11    17    10    16    10    16    10    16    10    15    10    15    10    16    10    16    10    16    10    16    11    17    11    17    11    17     8    13     8    13     8    11     8    11     8    11     8    11     8    12     9    12     9    13     8    12     8    12     8    12     9    13    12    16    12    17    14    18    15    19    15    19    16    20    19    21    18    22    20    24    20    24    21    27    22    28    22    28    23    27    21    25    18    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    14    24    12    22    14    24    14    24    14    23    11    22    13    22    13    22    14    22    15    23    17    23    17    23    15    23    17    23    16    23    16    23    16    23    16    23    14    22    14    22    14    22    14    22    14    22    14    21    14    21    14    21    14    21    14    21    14    21    14    21    14    21    13    21    12    18    12    18    12    18    12    18    11    18    10    16     8    13     7    10     4     8     2     7
  5   1   2  SIG                                      Xt7.1-CAAQ6682.3                                                                           CCCAGGGCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAA
  5   1   2  SIG                                      Xt7.1-CABG4137.3                                                                                                                                     CTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAAAAGCAAATAAACAACATTAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------G--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----G-------
                                               BLH ATG      29     230                                                                           
                                               BLH MIN      29     191                                                                           
                                               BLH MPR       8     191                                                                           
                                               BLH OVR      29     120                                                                           
                                               EST CLI      33       2                                                                           
                                               ORF LNG      29      20                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-009     NP_001071820.1 SET and MYND domain containing protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 5e-107     NP_650955.1 CG3353-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                             PREDICTED - Sp ---- 1e-113     XP_001184412.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 2e-139     NP_001004614.1 zgc:103480 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 4e-140     NP_659167.1 SET and MYND domain containing 5; retinoic acid responsive gene 1; retinoic acidinduced 15 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 5e-150     NP_006053.1 SMYD family member 5; retinoic acid responsive; retinoic acid induced 15 [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN --- Gg ---- 0          NP_001012912.1 SMYD family member 5 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PROTEIN === Xl ==== 0          AAH73058.1 MGC82689 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                              PROTEIN === ?? ==== 0          NP_001085635.1 MGC82689 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                    PROTEIN === Xt ==== 0          AAH88504.1 LOC496812 protein [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ6682.3.5                                                                                                        ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---ATG------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------TGA---------------------TGA---------------------------------------------------------------TAG---------------------------------------TAG------------------ATG---------TGA------------------------------------------------------------TAG---------------------------------------------ATG------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2  SIG                                      Xt7.1-CAAQ6682.3                                                                           CCCAGGGCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAA
                                                  Xt7.1-CHK-1008290004                                                                                 GCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAAA
  0   1   1           Tbd0 FL                     IMAGE:6977211.FL-MGC                                                                                                            CCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAAAAGCAAATTAAACAACATTTTGGAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       ext Te5       out                         CAAO623.3p TCGCGATCTAGAACTAGGCCCCCGGTGCCGGTCGGTAGCCCCTGGAAGGGATAGGCAGTCCCCGGATCAGCTGGCCCAGGGCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGCACTATTAAGCAGGTACNAGCCCCAG
  5   1   2       ext Te5       out                        CAAO7936.5p                                                                           CCCAGGGCGGGGGTCACGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCC
  5   1   3   22   nb Tad5 PIPE                            XZT65459.5p ......................................................................................................CATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGGATCTCTCATAGACCAACTC
  5   1   2       add Tbd0 FL   in                       IMAGE:6977211                                                                                                            CCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCCTCGCTCTTTGCACTGGTTTGGCACCCACGGGCAAGGGGATTGGGCACGAAGCTCGTTGGAACCCAGTGGGGTTCCTTGCCTGGTGGACGCCCCTAAAAAACTCCCCCCCTCCAAGAACGGGGAAAAAGCTGGGAA
  5   1   2       add In66                            IMAGE:8963215.5p                                                                                                               CCCCTTGTTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAAGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGTTTCCGCTCGCTCTTTGCACTGGATGCACAACGGCAGGATGCACGAGCTCGTGAGCAGTGGGTCATGCTGTGACGCCCTAGACTCCAACCTCGAGAGCGGGACAGCTGGATTCTCTCATGATTACTCTACAGTACTTAAGAGGTGACCGCAGATTTCTGAACCTGCAGGAATCCGGCT
  5   1   4      seed Hrt1      in                         CAAQ6682.5p                                                                                                                ATCGATTCAATCGGCACGAGGCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGGACAGCTGGATTCTCTCATAGACCAACTC
  5   1   2       add In66                            IMAGE:8963239.5p                                                                                                                 CCTCGTTGCGACGTGTTCGCCTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAAGGCCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCAGAGTTTCCGCTCGCTCTTTGCACTGATTGGCACCACGGCAAGGGATTGCACGAGCTCGTGAGCAGTGGGTCATGCCTGTGACGCCTAGACTCCACCTCGAGAGGCGGGACAGCTGGATCTCTCATAGATCAACTCTACATTACTAAAAAAGGTGACGGGAAAACTT
  5   1   3        nb Neu       ?                    TNeu056o21.p1cSP6                                                                                                                                  TCGCCTTTTGTGCCCCACAGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTA
  5   1   2       add Neu       ?                    TNeu070c21.p1cSP6                                                                                                                                                                          CCCCGGCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCATGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCATATACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCATAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCATGGATAATCCGGCACATCCCCTCAATAAACTGGATGATGCCTGGATGTATGTACCCCCCCCCTATCAGCATGGGCATTATATTTCATTTTTCTTCTTTTCAAGCTATCAATCTAATTATAAGATTTCTAAATTCTCTAAGAGTTTTCTGTGGTGCAGCCGCCTGTGACCCCCCCCCCCCATAGCGCCGGTCAGTTGGTTGCACCATAAATGGCAGAAGTGTATGAATCTGAATTGATTAAAATGGCAGTGGCGCTACAGACACACAAGCGCT
  5   1   2       add Neu                            TNeu015g04.p1kSP6                                                                                                                                                                                  CTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGTAGGTACCCCCCCCCTATCAGCATGGGCATTATATTTCATTTTTCTTCTTTTCAAGCTATCAATCTAATTATAAGATTTCTAAATTCTCTAAGAGTTTTCTGTGGTGCAGCCGCCTGTGACCCCCCCCCCCCATAGCGCCGGTCAGTTGGTTGCACCATAAAGGGCAGAAGTGTATGAATTTGAATTGATTAAAATGGCAGTGGCGCTACAGACACACAAGCGCTGTTTTATCTTTTTCCATTCAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGG
  5   1   3        nb Tad5                                 XZT11224.5p                                                                                                                                                                                                       GAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACNAGGACATAGAGNAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGC
  3  -1   2       add Fat1      ?                          CABC1653.3p                                                                                                                                                                                                                    GCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGTAGGTACCCCCCCCCATCAGCATGGGCATTATATTTCATTTTTCTTCTTTTCAAGCTATCAATCTAATTATAAGATTTCTAAATTCTCTAAGAGTTTTCTGTGGTGCAGCCGCCTGTGACCCCCCCCCCCATAGCGCCGGTCAGTTGGTTGCACCATAAAGGGCAGAAGTGTATGAATTTGAATTGATTAAAATGGCAGTGGCGCTACAGACACACAAGCGCTGTTTTATCTTTTTCCATTCAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAAGAGATTGTCCATAAGCTTCTGGGAGACAAGTT
  5   1   3        nb Te5       in                        CAAO12353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAG
  5   1   3        nb HdA       in                   THdA007f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTC
  5   1   2       add Te5       in                        CAAO12502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTCATTCAGTCCCGAACCTGAAGCTCCCAATGCAGATATGTTGCCCCCTCTGCCGCCTGCTTGCCCGTCGTGCCCAGGTCCCCTCCCAGCTGGTTCGCTATCTTTCCGACTCTCAGCCTCCCTTCTGCATCCAACGCCTGGACCCCCTGGTGCTGACTGTGCGCAACCTGGACAAAACCATCAACTTCTACACTAAGGTGCTGGGCAGGGCCACAACCTTCAAGGGAGGCAGGAAGGCTCTGAGCTTTGGGATGCAAAAGATTAATCTGCATGAGGCTGGGAAAGAATTTGAACCGAAAGCGGCTGTCCCCTCCCCGGGATCAGCTGACCCGTGTCTCATCACCGAGACGCCACTCAGCACTGTGGTGCAACACCTAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCATCTTTTCCAGACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAAAGGGACTGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGGGAACTACCTATTCGTGTGTTTCTGCCCCAAGTGCCTAGCGCAAGCTGACATCACGTCTGAGGAAGAAGAGGAGGAGGAGGATGATGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGANATGAGAGCTTAGTCCCCACCCCTTTCCATCATGTCCAATCACAGACCAAACTGGTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTG
  5   1   2       ext Tad5      in                         XZT54182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGATAAGGACTGGTGGATGCACNCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCCAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGA
  5   1   0       chi Tad0      in                       IMAGE:6981984                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATAAGGACTGGTGGNATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCNTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCNGAGCATTGTGATTGGTTGAGCCAGTACCGCGACATCTATCGCATGTGGTGCCTGATGTCATGCCACTGGGGGACTCATCTAGACCAATGAGCTGCCTGGTGTCGCACTTTCACATCGGCTGCAGCTTTCATGTACTCGTAATTACCGCTAGTGGCACGACAATACGATGCGGN
  5   1   3        nb Egg                            TEgg086h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGGTGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGA
  5   1   0       add Gas7      in                         XZG37606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            agccccctaagtttgctcatagcctgtacagagagataccataaaactatggcagcatagggattcccctgtactaagcacaattcagcaggaacagccccctaagtttgctcatagcctatacagagagataccataaaactatggcagcatagggattcccctgtactaagcacaattcagcaggaacagccccctaagtttgctcatagcctgtacagagagataccataaaactatggcagcatagggattcccctgtactaagcacaattcagcaggaacagccccctaagtttgctcatagcctgtacagagagataccataaaactatggcagcatagggattcccctgtactaagcaattcagcaggaacagcccccttagttGCTCATTTGCTTCACGGTGAAGATGTTTCATACTCCCTTGCAGGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCCAGTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCG
  5   1   2       add TpA                            TTpA026m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATAACCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATT
  3   1   2       add Tad0      in                       IMAGE:6981984                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTGAACTGCGAGGGGATCCCGGGCTGTTACCTGCCTGCAGAGTTGCTGTAACCCATAGCTGTGTGCCAAAACGCAGAGGGCTTCTTTTCAGGACAACAACTTTATCCTCCATCTCACTGCTTGGGAAGATATCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAA
  3   1   2       add Te5       in                        CAAO12502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGATCCGGGCTGTACNTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCATCTTTTCCAGACAACTTTATCCTCCATCTCACTGCTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAAAGGGACTGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGGGAACTACCTATTCGTGTGTTTCTGCCCCAAGTGCCTAGCGCAAGCTGACATCACGTCTGAGGAAGAAGAGGAGGAGGAGGATGATGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAGCTTAGTCCCCACCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCTGTCATTAGTCGTGTTGCAATTGGAATGCTTCATTTGCCCCAGCTTGCGGGGGGGACCTCCTACTTCTTTATGAGCCCTATACTGTATGCCACGTGACCCCACTCAGCTGGTTTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGTACAGTAACTAGATTCCTTATTTATATCATACCCGCCTCTCGCCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAATACCCCAAGTCCGGCCAAACACAACAACTACACCCTAACAAAACAAACTAAC
  5   1   2       add Ovi1      in                         CABI7480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATTGCAGGATCCCCTCATTGGGGTATTTATCTCTATATCTGCCATATTCTGTTGTGCCCATATATCCCCCTGTATGGCTTCTCTCCCTAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATG
  5   1   3        nb Tad5                                 XZT21676.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCGCTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATAACCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACTCAGTACACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAAC
  5   1   3        nb Tad5                                 XZT37322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCCAGTCCGGCCAA
  5   1   2       ext Ski1      in                        CABJ10696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACT
  3   1   2       add Tbd0 FL   in                       IMAGE:6977211                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGAGAGGAAATCTGGCATTAGTTACCTTGGACTGTTGCCAGAGGGATCGGCAGCCGGGAACAGCCGCCAAAAGATTTTCAGGGAGAATACCCTGTTCGTGTGTTCTTGCCCCAAGTGCTTAGCGCAAGCTGATGACCCCGACATCACTTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTCACCCAAAACAAACAAA
  3   1   4      seed Hrt1      in                         CAAQ6682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGAAATCTGCATTAGTTACCTTGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAAAA
  5  -1   2       ext TbA       out                  TTbA003l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAAAAAGTGCAAATTAAACAACCATTTTGGAGGAACAAT
  3   1   2       add Ovi1      in                         CABI7480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAAAAATGCAAATTAAACAACATTTTGGAGG
  3   1   2       add Gas7      in                         XZG37606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCGCTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATAACCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAACAAAAAAGCAAATTAAACAACATTTTGGAGG
  3   1   2       ext Tad5      in                         XZT54182.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCGCTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATAACCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAACAAAAAAGCAAATTAAACAACATTTGG
  3   1   3        nb HdA       in                   THdA007f21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATAACCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTTTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATTTTTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAAAAGCAAATTAACAACATTT
  3   1   3        nb Te5       in                        CAAO12353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATAACCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAAC
  3   1   3        nb Gas8                                  st84l07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGCGCAAGCTGATGACCCNGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGTGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAACAAAAAAATGCAAATAACAC
  5   1   0       chi Te3                                  CAAM5358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTTACCGGCGGAACACTCATTATCTGTCATTAGTCGTGTTGCAATTGGAATGTTTCATTTGCCCCAGCTTGCGGGGGGGACCTCCTACTTCTTTATGAGCCCTATACTGTATGCCACGTGACCCCACTCAGCTGGTTTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGTACAGTAACTAGATTCCTTATTTATATCATACCCGCCTCTCGCCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAATACCCCAAGTCCGGCCAAACACAACAACTACACCCTAACAAAACAAACTAACAAAAAAAAAATGCAAATTAAACAACATTTAGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext Ski1      in                        CABJ10696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCCCACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTACTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACGGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCGCNGGCCAAACACAACAACTG
  5   1   2  SIG                                      Xt7.1-CABG4137.3                                                                                                                                     CTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAAAAGCAAATAAACAACATTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008290006                                                                                                                                           TGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAAAAGCAAATAAACAACATTAAAAAAAA
  5   1   4      seed Ovi1      in                         CABI3860.5p                                                                                                                                     CTTTTGTGCCCCACAGGAGCCGCCGCGCCGGGCAGTGGAGATTCGCTTTGTCAGCAGCGGCAAGGGGAAGGGCCTGTTTGCCACTCGGGCCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTCGTATCCTCCCAGTTCCAGTGGAATGCGCTGTACCGGTACCGGGCTTGCGATCACTGCCTGCGCTCTCTCGAGACTGCCGAGGAGAATGCCCAGAGACTGTCCGGAAATGCCCACGTGGTCCTGCCGTACCCAGAGCTCTGCACAGTCCGAAATGGGCTGCACCAGCAGTGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGCCTCAAAGCCGCCGCGGATCAGTACCACCGGGCCCTCTGCCTGGGGGCCTCCAGGGATAATCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGGAATATGCATTACCCGCCGGAGACTGCCAGCATCATGCTAATGGCGCGGATGGTGGGCACTATTAAGCAGGTACAGGCCCAGGATAAGGACTGGTGGATGCACCTTTTCTCCCAGTTCTGTAACAAGACAGCCAATGAGGAGGAGGAGATTGTCCATAAGCTTCTGGGAGACAAGTTTAAGGGCCAACTGGACCAGCTGCGGCGACTTTTCACGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGA
  3  -1   2       ext Sto1      in                         CABG4137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCCGGACGCATTGTATGAGGAGCGCGTGAGTCGATGGTTCACCCCAGAAGGTTTCCGCTCGCTCTTTGCACTGGTTGGCACCAACGGGCAGGGGATTGGCACGAGCTCGTTGAGCCAGTGGGTTCATGCCTGTGACGCCCTAGAACTCCCACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCCACCATATTCCCTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCG
  5   1   3        nb Gas       out                  TGas141f01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCTCGAGAGCGGGAACAGCTGGATTCTCTCATAGACCAACTCTACAAGGACATAGAGAAGGTGACGGGAGAATTTCTGAACTGCGAGGGATCCGGGCTGTACCTGCTGCAGAGCTGCTGTAACCATAGCTGTGTGCCAAACGCAGAGGCCTCTTTTCCAGACAACAACTTTATCCTCCATCTCACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTTGCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTT
  3   1   2       ext Gas       ?                     TGas141f03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTGCTTTGGAAGATATCCAGCCTGGAGAGGAAATCTGCATTAGTTACCTAGACTGTGNCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCaaaaacaaaacaaaacaaaaaaaaaagcaaataaacaacattaaaaaaaaaaaaaaaaaa
  5  -1   2       ext Sto1      in                         CABG4137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCATTAGTTACCTAGACTGTGNCCAGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAAC
  3   1   4      seed Ovi1      in                         CABI3860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGGGACCGCAGCCGGCACAGCCGCCAAAAGATTCTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACAACTACACCCAAAAACAAAACAAAACAAAAAAAAAAGCAAATTAAACAACATTTGGAGG
  5  -1   3        nb Gas8                                  st13c16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCAGGGAGAACTACCTGTTCGTGTGTTCCTGCCCCAAGTGCCTAGCGCAAGCTGATGACCCCGACATCACGTCCGAGGAAGAAGAGGAGGAGGAGGAGGATGACGCTGAGCTGGAAGGGGAAGCAGAGGATGCAGAGCTGGAGGATGAGATGACGGACGTGTGAAATGAGAACTTTGTCTCCGCCCCTTTCCATCATGTCCAATCACAGACCAAACTGTTCAACTCTCTTCCACTGCCATTTCTAGTCACTCACTTGAGCTGTTCCCAGTCGGAGCATTGTGATTGGTTGAGCCAGTTACCGGCGGAACACTCATTATCCGTCATTTGTTGTGTTGCACTTGGAATGTTTCATTTGCCCCAGCTTGTGGGGGGGACCTCCTACTTCTTTATGAGCCCCCATACTGTATGCCACGTGACCACACTATGCTGGTCTGCATGTCACTGCCCAACCATATTCCTTATGTGCCGCATACCCACTGTAGCCGGGGGGCGCCGGTGGGGGTGCAGCAATAGGCAGCGCTTAGGATTTCTGTTTGCCCAGAATGATTTTTGCTTGATTTGTAGATCCCCCCAGCTTCCAGGTGTGTAATAGGCAACTAGATTCCTTATTTATATCATAGCCGCCTCTCTCAGCCCGGTGCCACCAACCTCAGTACCACACAGGCATGTTTCATCTCTGCACTGCCTGCTCCTCTCAGGAACAACACCCCAAGTCCGGCCAAACACAACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)