Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012078151 Xt7.1-CABH7180.5 - 20 ESTs
                                                                       .....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABH7180.5      AACAAAGCTCTCCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAA
                                                  Xt7.1-CHK-1008230419            GCTCTCCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTG
                                                      consensus depths           2     2     3     3     3     3     3     3     6     6     6     6     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    12    13    14    14    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    15    16    15    15    15    15    15    15    15    15    15    15    15    15    13    13    10    11    10    11    10    11    10    11    10    11    10    11    10    10     9    10     9    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     7    10     8    10     9    10     8     9     8     9     8     8     8     8     8     8     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6
                                               BLH ATG     180     193      
                                               BLH MIN     174      28      
                                               BLH MPR     174      28      
                                               BLH OVR     180     650      
                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 2e-024     NP_001002185.1 zgc:91881 [Danio rerio] ===============================================================================================================================================================================================
                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 3e-028     XP_001234019.1 PREDICTED: similar to small muscular protein [Gallus gallus] ================================================================================================================================================================
                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 7e-030     NP_079633.1 small muscle protein, X-linked [Mus musculus] ==================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 5e-032     NP_055147.1 small muscle protein, X-linked [Homo sapiens] ========================================================================================================================================================================================
                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 2e-040     AAK71068.1 Chisel [Xenopus laevis] =========================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 2e-040     NP_001079721.1 small muscle protein, X-linked [Xenopus laevis] =============================================================================================================================================================================
                                                                                                                                                                                                                                                                PREDICTED = Xt ==== 3e-047     NP_001072253.1 hypothetical protein LOC779706 [Xenopus tropicalis] ===============================================================================================================================================================================
                                                      Xt7.1-CABH7180.5                                                                                                                                                   TAA------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAG------ATG---------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------ATGTGA---------------------------------------------------------------ATG---------------------------ATG---TAAATG---------ATG------TAG---------------------------------------------TAG------TAG---------------TGATAA---------------------TAA------TAA
                                                                   ORF                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                            ]
  0   1   1           Mus1 FL                          CABH4381.FL-MGC      AACAAAGCTCTCCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAAAAAA
  5   1   1           HdA  FL                     THdA018d20.FL-Sanger                 CCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAAAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAAAATTTGCGGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAATTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGGGTATTTAACAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTACACACACTCTGATAAATATTTCCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTGCATTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Mus1 FL   in                         CABH4381.5p CGAGGAACAAAGCTCTCCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAAAAAA
  3   1   2       bld Mus1 FL   in                         CABH4381.3p      AACAAAGCTCTCCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAAAAAA
  5   1   2       bld HdA  FL   in                  THdA018d20.p1kaSP6                 CCAGAACTGTGTCTCAGCGCAGCTAAAAGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAATAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAAAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAAAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCANAATTTGCGGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCGATGTGAGAGGTCACTTGCATCATATTCACCAATAATGATCTAATCTGTCACATAT
  3   1   2       bld Mus1 5g3  in                         CABH2236.3p                                            AGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTG
  5   1   2   10  bld Mus1 5g3  in                         CABH2236.5p ...........................................AGGATCCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld AbdN 5g                            IMAGE:7023492                                                 CCCTGGCAAAGATCCCTACCGAACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAAGTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTTATCAAGTTCAATCTGAGAATTCTGCCAAATTTTGCAGACATTCCAACTTTGGAAAAATCCCTTTTTAATGGGATTCAACTGGGCCGAACAATGGGGAGAGGTCACTTTCAATTCACTTCCACCCAATAATGAATCAAATTTTGTCACCTTTTTCCCAGTGGAAAG
  5   1   2   10  bld Hrt1 5g3  in                        CAAQ10990.5p .....................................................................AACACTTAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAAAATCACTCACCAATAATGATCANATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCCTATAATGCAATANATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTG
  3  -1   2       bld Hrt1      in                        CAAQ10147.3p                                                                            TAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGT
  5  -1   2       bld Hrt1      in                        CAAQ10147.5p                                                                            TAAAAGGAAGAAGTGGGATACTAGAGGTCTTGATCTTTTATCAAGGGTTGTTTTTGGCTTGGCTGTTCTCCTAAGAAGAAAGGCAAAGAAAGAATACCCTGCAGATTAACATGTCTAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGT
  5   1   2   10 seed Mus1 5g3  in                         CABH7180.5p ......................................................................................................................................................................ATCCATCGATTCAATCGGCACGAGGAAACAGCCGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTANGTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTA
  3  -1   2       bld Hrt1      in                        CAAQ10187.3p                                                                                                                                                                                                       CGGCATCCAATATCAGATCTATCCAGGCTAATATCAATATTCCTATGGGAGCGTTTCGACCTGGTGCCGGCCAGCCACCCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGGTGCCTTTANGTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTA
  3   1   2       bld HdA  FL   in                   THdA018d20.q1kaT7                                                                                                                                                                                                                                                                                     CCAGAAGAAAAGAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAAAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAAAATTTGCGGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAATTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGGGTATTTAACAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTACACACACTCTGATAAATATTTCCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTGCATTAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Hrt1      in                         CAAQ5341.5p                                                                                                                                                                                                                                                                                          TCGATTCGGAATTTCACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ5341.3p                                                                                                                                                                                                                                                                                                GAAATTTCAACTGAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAAC
  3   1   2       bld Mus1 5g3  in                         CABH7180.3p                                                                                                                                                                                                                                                                                                            GAAGAAGAACCGCATGTCCCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTGCATT
  3   1   2       bld Hrt1 5g3  in                        CAAQ10990.3p                                                                                                                                                                                                                                                                                                                        CATGTCNCAATGCATGAATCTGAAGAAAAGAATGAAGAAAAGAAACCTATTCCAGGAGCAGTCAAACTTCCAGGGCCTGTATTCAACCTCTCAGAAATCCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTGCATT
  3  -1   2       bld Mus1      in                         CABH8399.3p                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTG
  5  -1   2       bld Mus1      in                         CABH8399.5p                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAATGTAAAAAGTGAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATAAAAGAAACAAACAGTTGTTTTTAAAAATCTGTTCTATTTTTGTTTTTAAAGTTAGTTTGTATTATTAAACACATGGGGAGGGATTTATCAAGTTATCAAGTTCAATCTGAGAATTCTGCAACATTTGCAGACATTCCAACTTTGATAGAATCTTTATTAATGGATTCAACTGGCCGATCAATGTGAGAGGTCACTTCAATCAACTCAACCAATAATGATCAAATCTGTCACATATTCCCATGGAAGGCTATGGGCAATGATCACATTTTCTACCTATTAATGCAATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTG
  3  -1   2       bld Hrt1                                CAAQ12549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACTCAAATTTGTACCAAAAGCAGAAGGAGAATAGTTTTATATGAAAGATCTAGCAAGAATAACCAGAGAGAAGCCTCTTTATGAAGAATAGAAACCAGCAAAATATTTTATACATTTGTATAAATACTGTATACTAAATAAATTATTGAATACTGTAGGCAGCAATTCATTTGTTTGTACATTTATATGCATTGTTCATAGACATGATTTCCTAATAAAACGATATTAAGAATACGGAGTGATaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGGGGGGGGATTGACCCCCCCCAAGAA
  5  -1   2       bld Hrt1      in                        CAAQ10187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAAATGTCGATATTGATGAGTATTTAGCAAACTCTAACTCAGCACAACAGCTGCATTGGTAAATGTTGCCTTTAGTTGCTGTAGCAGTTATACACACTCTGATAAATATTACCTTTACACAAACAATAATACTATTAAGAACCAATAAAGAAAGCTTTGCATTATTTGTGGCATCACTGATATATTTCATGCCAAATTCTACTTTATAATGGAAGTCTGCCCGCAGGCTGCCTTTATGTAGTATATTAAAAGGTTCATTGGTTATTTAGAGATGACCCTTTCATTTGCACCTACAGTATATAAGCACTGGCTGTAAGCACTGGATAAGCAAATCTTGTTATATACAGTACAGTGTTCCGTATATTGCAAAGACTAGGAATACTGCATTGCCCTTAGATACGGGATTGCCCATCGGTGCAACCAATAAGATCATCAGCTCCAGAAGGGGAATAATACCTGTAGTATTAGAATTAGAGTGAGAGAGAGAAAGAGATAGGATACGATTATACATGAAACCCTATTTGTAGTGAGTAGGATGTTACTAAGCACTGGAAATACCCACTCGATAACAGAATAAACTGAACATATTTTTTAATAAGCTCTACTTAGACTTATTCAGTGTAAGTGTAAATATCCCCTTTATCACTTTATATATTTCACAGATTTTAATTGCCTTATGCTTTATAGTCTGCGTGGTTAACTGAAATGACTCTGTAGATAGACGTATTTTAATATACATGAGCTAATCTATGAACTCACTATTCTACTGTAAATAACATTCTTATAATTTCTGAGGACTGAAGTCATTCCTTCTTCCTAACAAAGAGAGATTTGCCATTGGCGTTGTTCTCCTTAAACAATGAGAACATTAATTAATAAACTTAATCGGCACGAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)