Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012078313 Xt7.1-XZT46995.5 - 27 ESTs
                                                                       .....-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT46995.5                                                                                                                                                                                                                                                                TTACTAACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGAATAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228675                                                                                                                                                                                                                                                                      ACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGxxTxAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                     2     2     4     5     9     9    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    15    15    15    15    15    15    16    16    17    17    17    17    17    17    17    17    17    17    17    18    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    22    19    23    19    23    19    23    18    22    18    22    17    22    16    22    14    20    13    19    18    19    10    19    11    19    11    19    11    18    12    18    11    17    11    17    10    17    11    16    11    16    11    16    10    16    11    16    11    16     9    15    11    15    10    14     8    13     9    13     9    13     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12    10    13     8    11     8    11     7    11     6    11     7    11     7    11     6    10     6     8     6     8     2     5     3     5     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --T-------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------T----
                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 1e-006     NP_500281.1 abnormal cell LINeage LIN-22, Helix Loop Helix containing protein,antero-posterior patterning factor, hairy and enhancer of split homolog (19.5kD) (lin-22) [Caenorhabditis elegans] ======================
                                                                                                                      PROTEIN --- Dm ---- 5e-008     NP_523657.1 Hairy/E(spl)-related with YRPW motif CG11194-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 8e-012     BAE06388.1 transcription factor protein [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bf ==== 1e-012     AAQ93669.1 hairy C protein [Branchiostoma floridae] ========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 4e-011     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dr ---- 4e-023     NP_991182.1 bHLH transcription factor [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 9e-026     NP_034549.1 hairy and enhancer of split 5, (Drosophila) [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 4e-027     NP_001010926.1 hairy and enhancer of split 5 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xt ---- 4e-030     CAJ82420.1 Helix-loop-helix DNA-binding domain protein with Hairy Orange domain, similar to hes5 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 9e-036     XP_417552.2 PREDICTED: similar to hairy and enhancer of split 5 isoform 2 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 6e-076     AAK63840.1 enhancer of split related 2 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- ?? ---- 6e-076     NP_001082163.1 enhancer of split related 2 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT46995.5                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------TAG---------------------ATG---------------------------------------------------------------------------------TAATGA---------------------------------------ATG------------------------------------------------ATG------TAA---------------------------------------------------------------------------------------------------TAA---ATG------------------TAGATG------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------TAG---------------TGA---TAATAA------------TAA------------------------------------------------TAA------------------------------------------------------TAA---------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Tad5 FLq                         XZT50446.FL-MGC GGAACTTTCCCAGGTTCTGACAGTCAGACCATGTGTCCTTTGTACAGCACACACTCCTGACATCTGGGTGGGGGTCCATTCTTTTGGCAACAGAAGCTAATTTCACAGGCATGAATGAAAGTGACTGTTGTCCTGGAGCTCTTCTGATTGGTTCCATGCTGTGGGAAACTCAGAGTAGATGGGGACCCAGGCATTGTCATGCAGAAGTGAGGGTATAAAGGCAGGGCTACAGACAACTCTCTGAATGAATCTCTTTTACTAACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAATTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAAAAAAAAAA
  5   1   2       bld Tad5 FLq  in                         XZT50446.5p GGAACTTTCCCAGGTTCTGACAGTCAGACCATGTGTCCTTTGTACAGCACACACTCCTGACATCTGGGTGGGGGTCCATTCTTTTGGCAACAGAAGCTAATTTCACAGGCATGAATGAAAGTGACTGTTGTCCTGGAGCTCTTCTGATTGGTTCCATGCTGTGGGAAACTCAGAGTAGATGGGGACCCAGGCATTGTCATGCAGAAGTGAGGGTATAAAGGCAGGGCTACAGACAACTCTCTGAATGAATCTCTTTTACTAACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAATTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCANAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATG
  5   1   2       bld BrSp      in                      EC2BBA7AG08.g1                                                                                                                                                                                                                                                    GGGGAATCTCTTTTACTAACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCAGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACTCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTATTAAAAATGTT
  5   1   2       bld Tail      in                         CBSW5445.b1                                                                                                                                                                                                                                                                     AACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACTCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTA
  5   1   2       bld Tbd1      in                         CBXT2216.b1                                                                                                                                                                                                                                                                     AACAGAGCCTATAACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCATTGTATTTTATCTTTTTTTTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGC
  5   1   2       bld Neu       in                   TNeu102o19.p1cSP6                                                                                                                                                                                                                                                                       AGAGCCTATAACATGGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGC
  5   1   2       bld Tad5      in                         XZT46995.5p                                                                                                                                                                                                                                                                                 AACATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAATTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATNAAATGAATGAGTATATATCAGATAGTTCTATCA
  5   1   2       bld TbA       in                   TTbA036d14.p1kSP6                                                                                                                                                                                                                                                                                  AAATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAATTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCC
  5   1   2       bld Tad5      in                         XZT16498.5p                                                                                                                                                                                                                                                                                   CATGGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACCGAATTAGATGAAATTTTATAGTAAAGACCATCCTGATAAAATGAATGAGTATATAT
  5   1   2       bld Neu       in                   TNeu061a10.p1cSP6                                                                                                                                                                                                                                                                                      GGCTGTCAACAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACA
  5   1   2       bld Gas                            TGas025m11.p1kSP6                                                                                                                                                                                                                                                                                           TCAACAGTGCAACCTGCCTCATCTCCANAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACT
  5   1   2       bld TbA       in                   TTbA014g13.p1kSP6                                                                                                                                                                                                                                                                                               CAGTGCAACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTATTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGACATTTTATAGTAAAGAC
  5   1   2      seed Tad5      in                          XZT7640.5p                                                                                                                                                                                                                                                                                                   TGCACCTGCCTCATCTCCAGAGAGTATCCTGCAGATAAACTCACTACCAAACAGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTTAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTANAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATG
  5   1   2       bld Tad5      in                         XZT35616.5p                                                                                                                                                                                                                                                                                                                                                       AGAAAAACAAGATAAGGAAACCAATGGTGGAGAAAATGCGCAGAGACCGCATCAACAGCAGCATTAACCAGCTCCAGAATCTCTTGGAGAAGGAATTCCAGCTCCTCCAGCCTGATTCCAAGCCAGAGAAAGCCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAAGACTATCAAGATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAG
  5   1   2       bld Tbd1                                CBXT21816.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCCAGAGAAAGGCGATATCCTGGAATTAGCTGTAAAGTTCCTCAAGCAACAGATCTGCAGCCAATCAAAAAATAATAGAAAGGAGGATCAATATTTCAGTCAAGGCTATTCTAACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGG
  3   1   2       bld TbA       in                    TTbA014g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGCCTCCATGAGACATTTGCCTTCCTCTCTTTTCACCGTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTATTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGAATAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TbA       in                    TTbA036d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAACGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTGAATAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad5 FLq  in                         XZT50446.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTACAGAGGAGGAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAAGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAAAAAAAAAAGG
  3   1   2       bld BrSp      in                      EC2BBA7AG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGATGCAACTTAAACTGATGAATCATTTTCAGTGCTTGGACTCACAGCCCAGAGGCATTTCAGTCTCTTCTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACTCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGAGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCA
  3   1   2       bld Tbd1      in                         CBXT2216.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCATTGTATTTTATCTTTTTTTTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGAATAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT35616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGAAT
  3   1   2       bld Tad5      in                          XZT7640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGGCAATACTAAACAACAGAATGATAACACAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGGTT
  3   1   2       bld Tad5      in                         XZT46995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTG
  3   1   2       bld Tad5      in                         XZT16498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCATCAAAAGGGGCCTGGGCCAGTGGCCAGCACAAAGATACTTTGGAGGCCGTGGTAGAGGTCAATACTTAACAACAGAATGATAACTCAAGCAGAGGTTATTTGTGTTTTGATCTTTGCTGCCACCCTTGTGGATGATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACGAGTAAGCTGGAAATCAGCTATATAAAGATCGTTGTAATAATGGTTCCTATG
  3   1   2       bld Neu       in                    TNeu061a10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTACATTCATACATTTACTGCTTCATAATGAAGAATATATAGTCTGTACAAAGGATCCTACATTGTTTTGATGGGGCTAAATATATTATGCACTGTATTTTATCTTTTTTTTTTTTTTTTATTAAAAATGTTTATATAAAGAGATATAATAGTTACCCTGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTCTGGCAATATTGTCCTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGTGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTCTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACTGTTGGACCTGTGAAATCAATTATAATATATTGCACAAGTAAGCTGGAAATCAGCTATATAAAGATCATTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCTTTGAATAAAAAAAAAAAACCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu102o19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGGATCCTCCCTTGTTTTGAGGGGGCTAAATTTTTTTTGCCCGGGATTTTATCTTTTTTTTTTTTTTATTAAAAATGTTTTTATAAAGAGATATAATAGTTCCCCCGAGGTTGAATGCAGGCAGGCCGGACTTGCAGCCCTTTGGCAATATTTTCCTGGGGAAAACTTGCAAATTTTGCAATGGTTAATCCCTGGCCCTTTAGATACAGAATTAGATGAAATTTTTTTGTAAAGCCCATCCTGTTAAAATGAAGGGGTTTTTTTCAGATAGTTTTTTCAGGGGGTTAAAAAGTTTTTTGGATATGCTTAGGACTTTTCCAGTCATACGGGGTCAGCAAAGTACTTCCATTGTTTTCCAATATTTGTAGGATATCTTTAAGTTATGATTTTAATAACGGGGGATAAAATAAGGGGTTCCCTGTTGGCCCCGGGAAATCAATTTTAATTTTTTGCCCAAGTAAGCGGGAAATCAGCTTTATAAAGATCCTTGTAATAATGGTTCCTATGCAAAAAAATAAAGTGGCCCTTGGTTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Tad5                                 XZT16506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATGTTTATATAAAGAGATATAATAGTTCCCCTGAGGTTGAATGCAGGCAGGCCGGATTTGCAGCCCTCTGGCAATATTGTCTTGAGGAAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGATACAGAATTAGATGAAATTTTATAGTAAAGACAATCATGATAAAATGAATGAGTATATATCAGATAGTTCTATCAGAGTGTTAAAATGTCTCTTGGATATGCTTAGGACTTCTACAGTCATACTGAGTCAGCAAAGTACTTACATTGTTCTACAATATTTGTAGGATATCTTTAAGTTATGATTATAATAACTGTGTATAAAATAAGTGGTTCACT
  3   1   0       add Tail      in                         CBSW5445.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGTCCGCAAAGTACTTCCCTTGTTTTCCCATTTTTGTGGGGTTTTTTTAAGTTTTGGTTTTAATAACCGGGTTTAAAATAAGGGGTTCCCTGTTGGGCCCGGGAAATCCATTTTTATTTTTTGCCCAAGTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)