Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas076d08.3                          9 END     1           2       11                integral membrane nucleoporin gp210 [Xenopus laevis]
     2  1.75    0Xt7.1-CAAN6557.5                            7 END     4          11       66                hypothetical protein LOC779738 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012078401 Xt7.1-CABJ1435.3 - 34 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ1435.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAATGGCAAAGCAAGCATTGGTACAAGGTGCAAAAACGATGTCTGCAATATCCGCACAGGCTGCGGCGGCACAGAAAAATAAATTAAAAGAGCCGGGGGGAGGATCGTTCAGAGATGACGACGACATTAACGACGTAGCTTCCATGGCCGGGGTGAACCTCTCTGAAGAAAGCGCAAGGATATTGGCGACGAATTCGGAGTTAGTGGGCACGTTAACGCGGTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCGCTGCTACAGAGGAGGATATTGGAAATAGGCAAGAAGCACGGCATCACAGAAATCCATCAGGACGTCGTCAGTTATGTCTCCCACGCAACGCAGCAGCGGCTACAAAACATTGTCGAGAAAATCTCCGAAACGGCGCAGCAGAAGAATATTTCGCACAAGGATGACGATCGGTATGAACAAACAAGTGACGTACGGACACAACTCAAATTCTTCGAGCAGCTCGATCAGATAGAGAAGCAGAGGAAAGACGAGCAGGAGCGGGAGATTCTAATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCAGAACAGTTGCGGTTAAAACAGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTTAACAGCGCTAGCAGCTATTGGCCCTCGAGAAAGAGGAGAGTTGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACCGCCACGGCCAGCAGTTCGGCGGGAGGGGGCAGCCGACAGTTTACACGACAAAGGATAACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAGAAAAAAAAAAAAGTGTTTTTAACCTGTACAGGAAGTGAGCGATTGTGTCCCCGCCCCCCCGGGGCAAAGAGAGGTTTTTATTAAAGTGTATATGGCATAAATATATATATTTTTTGCACTGTTTTAGGTTTTAAATATTTTGGGGTTTTTTTTTTTTTTCTAC
                                                  Xt7.1-CHK-1008227581                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAAAGCAAGCATTGGTACAAGGTGCAAAAACGATGTCTGCAATATCCGCACAGGCTGCGGCGGCACAGAAAAATAAATTAAAAGAGCCGGGGGGAGGATCGTTCAGAGATGACGACGACATTAACGACGTAGCTTCCATGGCCGGGGTGAACCTCTCTGAAGAAAGCGCAAGGATATTGGCGACGAATTCGGAGTTAGTGGGCACGTTAACGCGGTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCGCTGCTACAGAGGAGGATATTGGAAATAGGCAAGAAGCACGGCATCACAGAAATCCATCAGGACGTCGTCAGTTATGTCTCCCACGCAACGCAGCAGCGGCTACAAAACATTGTCGAGAAAATCTCCGAAACGGCGCAGCAGAAGAATATTTCGCACAAGGATGACGATCGGTATGAACAAACAAGTGACGTACGGACACAACTCAAATTCTTCGAGCAGCTCGATCAGATAGAGAAGCAGAGGAAAGACGAGCAGGAGCGGGAGATTCTAATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCAGAACAGTTGCGGTTAAAACAGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTTAACAGCGCTAGCAGCTATTGGCCCTCGAxAAAxAGGAGAGTTGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACCGCCACGGCCAGCAGTTCGGCGGGAGGGGGCAGCCGACAGTTTACACGACAAAGGATAACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTxxxCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAGAAAAAAAAAAAAGTGTTTTTAACCTGTACAGGAAGTGAGCGATTGTGTCCCCGCCCCCCCGGGGCAAAGAGAGGTTTTTATTAAAGTGTATATGGCATAAATATATATATTTTTTGCACTGTTTTAGGTTTTAAATATTTTGGGGTTTTTTTTTTTTTTCTACCCAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     2     3     2     3     2     3     2     3     3     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     3     5     3     5     2     5     2     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     2     5     2     5     3     6     5     6     5     6     6     7     8     8     8     8     8     8     8     8     9     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     8     9     8     9     8     9     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     5     7     5     7     5     7     7     8     8    10     8    11     8    13     8    12    10    13    12    15    13    15    13    15    13    15    14    16    14    16    15    17    15    17    15    16    14    15    15    16    15    16    15    16    15    17    15    17    16    17    15    17    15    16    15    16    15    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    16    16    16    16    15    16    16    16    15    16    16    16    16    16    15    15    15    15    14    15    14    16    16    16    16    16    15    16    17    17    16    17     8    17     7    17     8    17     8    17     8    17     8    16     8    16    13    16     7    15    12    15     7    12     7    12     6    12     6     9     3     3     1     2     1     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A-T--------
                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 1e-011     NP_490728.2 TAF (TBP-associated transcription factor) family member (taf-4) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-054     NP_788511.1 TBP-associated factor 4 CG5444-PC [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-065     XP_782176.1 PREDICTED: similar to TBP-associated factor 4 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 1e-082     XP_692554.1 PREDICTED: similar to TBP-associated factor 4, partial [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-107     XP_417400.2 PREDICTED: hypothetical protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                    PREDICTED - Mm ---- 2e-110     XP_997743.1 PREDICTED: similar to TBP-associated factor 4 isoform 2 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-111     NP_003176.2 TBP-associated factor 4 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 8e-119     AAI30110.1 Unknown (protein for MGC:160631) [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 8e-119     NP_001091268.1 hypothetical protein LOC100037075 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 2e-120     NP_001072285.1 hypothetical protein LOC779738 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ1435.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------ATG------------------------------------------------------TGA------------TAA---------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TGA------------------------------------------------------------------------TAA------------------------------ATG------------------------------------------------------------------------------------------------------TGA---TGA------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------TAG---------TAA---------------------------TAA------------------TAA---------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           Egg  FLt5                   TEgg075m16.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTCGCACAAGGATGACGATCGGTATGAACAAACAAGTGACGTACGGACACAACTCAAATTCTTTGAGCAGCTCGATCAGATAGAGAAGCAGAGGAAAGACGAGCAGGAGCGGGAGATTCTAATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCAGAACAGTTGCGGTTAAAACAGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAAAAGAGGAAAGTTGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACCGCCACGGCCAGCAGTTCGGCGGGAGGGGGCAGCCGACAGTTTACACGACAAAGGATAACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTT
  3   1   1       add Egg       ?                     TEgg078d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATTCAGCAGGCGCACAAGGCGGGAGCAGTGGTACGTCCCCCGCACGTGACATTAACCCAGACGCCCATGGTAGCACTTAGGCAGCCTCCGAATCGGATCATGCTCACCACGCAGCAGTTGCAGCTAAACCCACTACAAACAGGTGCGATGCAAACAGTTCCAATGGCAAAGCAAGCATTGGTACAAGGTGCAAAAACGATGTCTGCAATATCCGCACAGGCTGCGGCGGCACAGAAAAATAAATTAAAAGAGCCGGGGGGAGGATCGTTCAGAGATGACGACGACATTAACGACGTAGCTTCCATGGCCGGGGTGAACCTCTCTGAAGAAAGCGCAAGGATATTGGCGACGAATTCGGAGTTAGTGGGCACGTTAACGCGGTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCGCTGCTACAGAGGAGGATATTGGAAATAGGCAAGAAGCACGGCATCACAGAAATCCATCAGGACGTCGTCAGTTATGTCTCCCACGCAACGCAGCAGCGGCTACAAAACATTGTCGAGAAAATCTCCGAAACGGCGCAGCAGAAGAATATTTCGCACAAGGATGACGATCGGTATGAACAAACAAGTGACGTACGGACACAACTCAAATTCTTTGAGCAGCTCGATCAGATAGAGAAGCAGAGGAAAGACGAGCAGGAGCGGGAGATTCTAATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCAGAACAGTTGCGGTTAAAACAGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTTAACAGCGCTAGCAGGTATTGGCCCTCGAAAAAAAAAAAAAAAAAAGCGGAGAA
  5   1   2      shim Ski1      in                         CABJ1435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGTGGTACGTCCCCCGCACGTGACATTAACCCAGACGCCCATGGTAGCACTTAGGCAGCCTCCGAATCGGATCATGCTCACCACGCAGCAGTTGCAGCTAAACCCACTACAAACAGTTCCAATGGCAAAGCAAGCATTGGTACAAGGTGCAAAAACGATGTCTGCAATATCCGCACAGGCTGCGGCGGCACAGAAAAATAAATTAAAAGAGCCGGGGGGAGGATCGTTCAGAGATGACGACGACATTAACGACGTAGCTTCCATGGCCGGGGTGAACCTCTCTGAAGAAAGCGCAAGGATATTGGCGACGAATTCGGAGTTAGTGGGCACATTAACGCGGTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCGCTGCTACAGAGGAGGATATTGGAAATAGGCAAGAAGCACGGCATCACAGAAATCCATCAGGACGTCGTCAGTTATGTCTCCCACGCAACGCAGCAGCGGCTACAAAACATTGTCGAGAAAATCTCCGAAACGGCGCAGCAGAAGAATATTTCGCACAAGGATGACGATCGGTATGAACAAACAAGTGACGTACGGACACAACTCAAATTCTTCGAGCAGCTCGATCAGATAGAGAAGCAGAGGAAAGACGAGCAGGAGCGGGAGATTCTAATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCAGAACAGTTGCGGTTAAAACAGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAAAAGAGGAAAGTTGAATCACCGGGCCCTGGTTCTGGTTC
  5   1   2       bld Egg  FLt5 ?                    TEgg075m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTCACATGATGACGATCGGTATGAACAACTATTGACTTACGGACACTACTCAAATTCTTTGAGACATCTCTATCATATAGAGAACATAGGAAAGACTAATATGAGCGGGAGATTCTAATGCGGGCATCTAAATCTCGGTCAAGGCAGGAGGATCCACAACAGTTGCGGGTAAAACAGAAGGCGAAAGATATGCAACATCAGGAACTGGCACAAATGATGCAGATAGACGCCAACTTAACAGCGCTAGCAGCTATTGGCCCTCGAAGAAAGAGGAGAGTTGAATCACCGGGCCCTGGTTCTGGTTCGGAGTCGTCCTGCACAAGTACCGCCACGGCCAGCAGTTCTGAGGGAGGGGGCAGGCGACAGTTTACACTACAAAGGATAACGCGGGTCAATCTCATGGACCTCATTTTATGCTTGGAGAGCGAGCGACAGACAAGCCATTCACTATTGCTATACTAAGCATTCCTTTAGTGAGACTCACCGAACTCCACCAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTC
  5   1   1       add Egg0                                 dad72b09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCAGAACAGTTGCGGTTAAAACAGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTGGAGCAGCGCTAGCAGCTATTGGCCCTCGAAAAAAGAGGAAA
  5   1   2       bld Gas8      in                          st10h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAGGCGAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGACGCCAACTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAAAAAGAGGAAAGTTGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACCGCCACGGCCAGCAGTTCGGCGGGAGGGGGCAGCCGACAGTTTACACGACAAAGGATAACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTGAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTT
  5   1   2       bld Gas7      in                         XZG45453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAGAGGAAAGTTGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACCGCCACGGCCAGCAGTTCGGCGGGAGGGGGCAGCCGACAGTTTACACGACAAAGGATAACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCTCAAAGAGGCGACCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTA
  5   1   2       bld Gas8      in                           st2h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTGAATCACCGGGCCCTGGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACCGCCACGGCCAGCAGTTCGGCGGGAGGGGGCAGCCGACAGTTTACACGACAAAGGATAACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCTCAAAGAGGCGACCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCAC
  5   1   2       bld Gas8      in                          st29j15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGCGGGTCAATCTCAGGGACCTCATTTTATGCTTGGAGAGCGAGCGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAGACTCACAGAACTCCACAAAATGGGAAAGATCAAGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGC
  5   1   2       bld Gas8      in                         st100f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCCACAAAATGGGAAAGATCAAGGGTATTTTTGTTCATTATCTGTCGGTTTTTATTTTTGCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAG
  5   1   2       bld Gas8      ?                           st46h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTGCCCCTCAAAGAGGCGCCCCCCCCTCCCTTCTCGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTCAAGATGGNGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCC
  3   1   2       bld Te3       out                        CAAM5958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCGGACACGTCTGCAGAACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTGAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTT
  5   1   2       bld Tbd1      in                         CBXT4014.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTTTTTATTTTTTCCTGTTCCTTCATCGTCTGTTGGAGACAATAATGGTTTGAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCA
  5   1   2       bld Egg                            TEgg136l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATAATGGTTTCAAGATGGCGCCGCCGATGCCAACCAACCCCATTAGACCACGTTAACCCTTCGCCGACGGGGCAGGATCACAGCCGCCAACGAGGAGCGAAAAAGACTCGTTTTTGTTCTGCATCGTCTTTGTATTTTTTATTATTATTATTATTATGTGGAAAAATCCAAATCAAGGTTGAAAACTGCCTTCTGCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGGTGGGTGGGGCACGGGACACTGTCCACTGATGTGAGTGATGGGGGGAGCCCA
  5   1   2       chi Egg                            TEgg136n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGTTTTTTTTTGTAAAAAAAAAATGTAATTGTTAATTGGCTGTCAGTATCACTTTAACTTACTAACACATGGAAACAGAAGAATAAAATGCTAAAATAAAAAGCAGAGATTAAAAGATAAAACCAGAAACTCTTAGCAAGCAAAAAAAAGCGGCCGCGTCGACACTAGTTCTCTCAAAAATCCAAGCCATAGAGAGATTGCTCGTTGCCACCGTCCGAGCCCCCCCGGCCCCCCGTGCTGCACTTGTTTTCACTGATCTGTACCGAGTTATCAGGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGGGTGGGTGGGGCA
  5   1   2      seed Spl2      in                        CBSS3095.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTTTTCTTTTTATTATGTACGGTTTTATCAATCTTGTTAAAGGGCAAGTAAACCTAAACTCACTGGGGCTGTGACGCGCTGTTAGGTAAAACTCCGCCCCCTTAGGGGGTTCTTATTGCTCACCTCCTACCCCAGGCCAATGCAAATGCACCGGCCCGGGGTACTTTATACTGAATATTAATCATGTCCTCCCTTCTCATCCTGGGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTT
  3   1   2       bld Brn2 5g3  out                       CAAJ17099.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCTTCTCATCCTGGGCCCGAGCCGAGCTTAAAAGGGATTGAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCGGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACGCAAGGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAG
  3   1   2       bld Egg       out                   TEgg050i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCCGAGCCGAGCTTGAAAAGGGATTGAAAGACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCCACCTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCGTCCCGTATTTATTGATTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTAAACAAAAATCATTATTTTCCACCGTAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                           st2h07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCGAACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAAT
  3   1   2       bld Te4  FL   out                        CAAN6557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGT
  3   1   2       bld Gas8      in                          st29j15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCGACCCCGCCCTATTTGGTGACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCCTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATA
  3   1   2       bld Gas8      in                          st10h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGACATCAGAGGGGGGTGGGTGGGGCACGGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAA
  3   1   2       bld Ski1      in                         CABJ1435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACATCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS3095.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGAGGGGGGTGGGTGGGGCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTTTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTT
  3   1   2       bld Tbd1      in                         CBXT4014.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGGGGACACTGTCCCACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTTTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTTTTTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTTTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAGAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT13512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTGATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas8                                 st103i14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGNGG
  5   1   2       bld Gas8      ?                           st73e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGAGTGATGGGGGGAGCCCAGCTGCATAAGGAAAGTTCTATTCACTGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTTGTTT
  3   1   2       bld Gas8      in                         st100f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTGGGGGGTAGAATGGCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATNCCCCGGCCGCCCNTGNTGAGNGNGAGTTTGTCCTTCCAGGTCAGAAAACANGGNGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTNCCCTNCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAANTACCCCNGACTGTTGNGTNTTTTTGAAGANTATTTGCCCCAGTCCAGGGCAGGAGGNGACCAGNTACTATCACTGGGGGNGCCAATCCGGNGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAANCCCTTTTTTGNTTACAGCAAGGGGGGGGTTAACAANTCCCTGCATCAGATTNTTTTTGCAGATGGCAGAGANTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCANTATAANGTCACTCCCTTTGCCTTTATTTTAGC
  3   1   2       bld Gas7      in                         XZG45453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAACCAATGTCAGTTTTGGGTCAGCCTGTTCGGTACCAAACCACATACTGTCAACCATTTTGGTACCTGGCAGCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTTTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGGGGTGACCAGCTACTATCACTGGGGGGGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTTTTTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTTTTTTTGCAGATGGCAGAGATTCCGCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCCCCGTTT
  3   1   2       bld Tad5      in                         XZT13512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACCTTTTTGGTACCTGGCACCCATTTTGGATCCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTAAACAAAAATCATTATTTTCCACCGTTAAAATAAAAAAAAAAG
  3  -1   2       bld Hrt1      in                          CAAQ672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCGGCCGCCCTTGCTGAGTGTGAGTCTGTCCTTCCAGGTCAGAAAACATGGCGGCAGGGTCAGCTGGACCCTGGGGGAAACCCAGTGGGCCCCACCACTCCCCTCCCCTGAGAAGGGGGAGGTGCTGGTTTTGGGGGCCCCCAGGGGTAGCAGCCCCAGTCCAAGGATAAAGTACCCCAGACTGTTGTGTCTTTTTGAAGACTATTTGCCCCAGTCCAGGGCAGGAGGTGACCAGCTACTATCACTGGGGGTGCCAATCCGGTGCCCCAACCCTGCCAGTGATTTTTTTTAATTCCCCCTTTCCTTTAACCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAGAAAAAAAAAAAAGTGTTTTTAACCTGTACAGGAAGTGAGCGATTGTGTCCCCGCCCCCCCGGGGCAAAGAGAGGTTTTTATTAAAGTGTATATGGCATAAATATATATATTTTTTGCACTGTTTTAGGTTTTAAATATTTTGGGGTTTTTTTTTTTTTTCTACCCAAGACGA
  5  -1   2       bld Egg                            TEgg119p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCTTCTCTGCTTACAGCAAGGGGGGGGTTAACAACTCCCTGCATCAGATTCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCGTCCCGTATTTATTGATTTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCAAAGATAACCTCTGTTTAAACAAAAATCATTATTTTC
  5   1   2       bld Te1       out                        CBWN6525.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCGCTTTTTGCAGATGGCAGAGACTCCGCCCCCCCCCCGTCCCGTATTTATTGATTTTATCGCTTTCACTATAACGTCACTCCCTTTGCCTTTATTTTAGCAGCATTTCTAATATTTGTTTTTTTTTGTTTCCTATATATAAATATATATATATCCCAAATAACCTCTGTTTAAACAAAAATCATTATTTTCCACCGTTAAAGAAAAAAAAAAAGTGTTTTTAACCTGTACAGGAAGTGAGCGATTGTGTCCCCGCCCCCCCCGGGGCAAAGAGAGGTTTTTATTAAAGTGTATATGGCATAAATATATATATTTTTTGCACTGGTTTAGGTTTTAAATATTTTGGGTTTTTTTTTTTTTTTCTACCCAAAACA
  5  -1   2       bld Hrt1      in                          CAAQ672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGGAAGTGAGCGATTGTGTCCCCGCCCCCCCGGGGCAAAGAGAGGTTTTTATTAAAGTGTATATGGCATAAATATATATATTTTTTGCACTGTTTTAGGTTTTAAATATTTTGGGGTTTTTTTTTTTTTTCTACCCAAGACGAGTGCTCCGCCCCCTTTTTTTCTTTCTCTCTATTCGACGGCAGAACCAATAGAAGCCCCGGTGTTTCCATAGTCACTGTAGATAATTTGTAGCACCTCATTACCCACAATCCTACCATAAATTATTCTGTAAATCCATCATTTTTTGGTTTATTAACAGTATGCAAGCTCTGGGGGCAAGCCCCTCCCCCACCCTCCGTCGCCACAGCAGAAAAAAATCGCCCTTCTTTGTATCTATTTTTTTATTATAAAAAAAAAAAAATAAAAACTAAAAATAAAATATATACTAATTGGTTCTTTCTATTTTCGGAGGTTCCTGTATCCAAACTGCCCATTGGTATAAGACTTTTCTGAGTGTAAATAGTTTAGCTTCCCCTTTAACATCCGTTTCTCTCTGCCTCGTACACTGAGTTCTGATCAGTATTTTTACCCGACAGCTGTTACATCGCTCCCGGCGTCCGTACGACGATCTTGTCTTTCCATTTGGGGTTTATTTTTATTTTTTTGTTTTATTTTTTTTTTGTTTTCATGTAAATTTTGCACAGTGACTTGTTCATATGTAAATATTTTACTTTCAAAAATGAAGTTTTTAATTGCTATTGTTTTATATAGGATTGAAAGAAAATTAACGCCTTTATAAAAACGAATTTATCCTCGTGCCGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)