Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD7170.3                           53 END     10         52       19                PREDICTED: hypothetical protein [Gallus gallus]

 This cluster: approximate FL confidence score = 95%

 1012078403 Xt7.1-CAAN4443.5 - 19 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN4443.5                                                   GCTCCCTATTTCCTGTGGGTGTCCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGACCTCGTCAAAAAACTCAGCACCGATATGGATCTAATCGTCGATGTGTTACGATCTTTGCCTCTGGTGCAAGTGGA
                                                  Xt7.1-CHK-1008230879                                                         TATTTCCTGTGGGTGTCCCxxxxxCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGACCTCGTCAAAAAACTCAGCACCGATATGGATCTAATCGTCGATGTGTTACGATCTTTGCCTCTGGTGCAAGTGGACGAGAA
                                                      consensus depths                                                        2     4     2     5     3     8     5    10     6    11     7    12     9    13    10    14    11    15    11    15    11    15    11    15    11    15    11    15    11    15    11    15    11    15    11    16    11    17    12    17    12    17    12    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    15    18    16    18    16    17    16    17    16    17    15    16    15    16    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    12    13    10    13     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10     9     9     9     9     9     9     9     9     9     9     8     8     7     7     7     7     6     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     3     4     3     4     3     3     3     3     3     3     3     3     3     3
                                               BLH ATG     424     173                                                   
                                               BLH MIN     424      43                                                   
                                               BLH MPR      82      43                                                   
                                               BLH OVR     424     530                                                   
                                               CDS MIN     424      43                                                   
                                               EST CLI      21       3                                                   
                                               ORF LNG     424      29                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 9e-014     NP_871824.3 LARP (RNA binding La related protein) homolog family member (larp-2) [Caenorhabditis elegans] =====================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Dm ---- 3e-016     NP_728843.1 CG11505-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 1e-018     XP_001184765.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - ?? ---- 2e-030     NP_001091246.1 hypothetical protein LOC100037046 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 1e-030     AAI24888.1 Unknown (protein for MGC:154508) [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 2e-047     NP_001071030.1 hypothetical protein LOC563742 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Hs ==== 1e-064     NP_055970.1 hypothetical protein LOC23185 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 3e-065     NP_766173.1 expressed sequence AI256361 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 7e-093     XP_418559.2 PREDICTED: hypothetical protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN4443.5                                                                                                                                                                                                                                                                                                                                                                                                          TAG---------------------------------TAG---TGA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------ATG------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2   14  bld Te4  5g3  out                        CAAN2781.5p CAGGAAGTTAGATAGTGGCTAGTCTCCACCCCCTTCTCCCGGGATAGAGTGCTCCCTATTTCCTGTGGGTGTCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCT
  5   1   2   14  bld Te4  5g3  out                        CAAN9228.5p ......................................CGGGATAGAGTGCTCCCTATTTCCTGTGGGTGTCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACA
  5   1   2       bld Gas  5g                        TGas085n12.p1kSP6                                         TTCTTTTTGAGGATCCATCGATTCTTTCCCCCGGGCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAAGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACC
  5   1   2       bld Tbd0 5g3  out                    NISC_nl23f12.y1                                                 GTGCTCCCTATTTCCTGTGGGTGTCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCT
  5   1   2   14  bld Neu5 5g3  out                        ANHP2445.5p ..............................................................CGTGGGTGTCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGGCAGAAGGT
  5   1   2       bld Neu  5g                        TNeu141c06.p1cSP6                                                                        GTCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGAAGAGTTGCCCGATGAACC
  5   1   2       bld Neu  5g                        TNeu035n17.p1kSP6                                                                        GTCCCTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGNGAAGAGTTGCCCGATGAACC
  3  -1   2       bld Hrt1      out                        CAAQ5739.3p                                                                        TAGGGCGAGAGGCTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTA
  5   1   2       bld Gas  5g                        TGas035h23.p1kSP6                                                                            CTCTGCCTGACTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATC
  5   1   2       bld Neu       out                  TNeu055o16.p1cSP6                                                                                      CTTGTTCTGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGAAGAGTTGCCCGATGAACCT
  5   1   2       bld Egg       out                  TEgg047n06.p1kSP6                                                                                             TGCTCCCGGGCACCCGCGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGCGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGACTCAGAGCTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAACTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAAC
  5   1   2       bld Egg                            TEgg101h17.p1kSP6                                                                                                             CGGCGGCGGCTCCTGTTACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGCCCTCGCCAAGTGGAATATCACCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGAGAAACGATAGACGAGGCTGGGGAACCTAGACACACACACAGAGCGCTCAGACAATGGACTGTTGTCGTACAACGCGGACGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACTCGCTTTCTAGGAGTGACTCGTTCTCTC
  5   1   2   10  bld Lun1 PIPE out                        CABD7170.5p ..........................................................................................................................TACCCCCCCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGACCTCGTCAAAAACTCA
  5   1   2       bld Gas1 5g                          NISC_mq27e01.y1                                                                                                                                    CCAACCCCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACACAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACGGGTTTCTAGGAGTGACTCGTTTTCTCTGAGGAGCCGAGAAGCAGACGGCTCATGACTTCTGA
  5   1   2   14 seed Te4  5g3  out                        CAAN4443.5p .........................................................................................................................................CCCATCCCTGTGTGCGGGGTTCTGCTCATTTCAACATCCCGTCCTCGTCAAGTGGAATATCGCCCCTTGCCCCCTCCTCTCCCGCCCTCCCCACCCGACACCCGCCGGCAGCTCGCATCTCGGCCAGCGGAGACACGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGA
  5   1   2   30  bld Liv1 5x3  out                       CAAR12767.5p .....................................................................................................................................................................................................................................................CCATCGATTCGCCAAGCCCACCTTCTGCCACCACTGCACAGATTTTATATGGGGGCTCGCCGGCTTCCAGTGCGAAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGACCTCGTCAAAAAACTCAGCACCGATATGGATCTAATCGTCGATGTGTTACGATCTTTGCCTCTGGTGCAAGTGGACGAGAAAAGA
  5   1   2       bld Neu  5g                        TNeu013n08.p1kSP6                                                                                                                                                                                                                                                                          CCCGGGGGGGGGAAGTGAAACGAGAGAGGAGGCTGGGGAACCGAGACACACACACAGAGCGCTCAGTCACTGTACTGTTGTCGTACAACGCGGTCGAACTTGTGGACTTCATATTGTTTTGGGGATTTTAGGAGAAACTGAAAACAGCTGTAAAGACAGCTTTCTAGGAGTGACTCGTTCTCTCTGAGGAGCCAAGAAGCAGACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCAGCAAGTCCAAGAAGCCAAAGACAGTTCTCATCTCGAATCAACCAAGGTCTCAGAGTTAAACCCCAATGCTAAAGTATGGGGGAATCCCATGTTGAATGTGGAAGCTGGAGGTACTGCTGATGGAACTGTGGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGAAGGCCTGGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACT
  5   1   2       bld TpA  5x                        TTpA040l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGCTTACTAGGAGTGACTCGTTCTCTCTGAGGAGCCAGAACATACGGCTCATGACTTCTGATCAGGATACTAAAGTTGTGGCTGAACCGCAGGTGCACCAAGTCCTAGAAGCCAAAGACAGTTCTCATCTCTAATCAAGCCAAGGATCTCACAGTTAAACCCCAATGCTAAAGTATGGAGGAATCCCGTGTTGAATGTGGAAGCTGGATGTACTGCTGATGGAACTGTGTGCTCCATCCTGGGAAGAGTTGCCCGATGAACCTCCAGACTCCTCCAGAGATAGGCCTGTGACGCCAATGATGACAGTGACAACAGAAGTCAAAATGCAATGTTAGCAGTGTTACATAGAAGTACCCCCATCAGTTTCTGTATCGGACAGTAACAGACATGTAGACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGGCAAGAAGACCTCCGTGATTTGCTTAAGAAAACACTGGAATTTTGCTTATCTCTAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGACCTCTTCAAAAAACTCGACACCGATATGGATCTAATCGTCCATGTGTTACGATCTTTGCCTCAGGTGCAAGTGGACGAGAA
  5   1   2       bld Neu       out                  TNeu068d05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGGCTGACGCCAATGATGACAGTGACAAGAAAAGTCAAAATGCAGTGTTAACAGTGTTACAAGAAGTACCCCCATCAGTTTCTGTATCGGACAGAACAGACATGAACACTATATCTCTGGGAAACTCGGAATATGAATCTATGCACGAAACCACCCATTCAGGGGCAAATGATCTCCCACAGCCAGAAGGTCAAGAAGACCTCCGTGATTTGCTTAAGAAAACACTGGAATTTTGCTTATCTCGAGAGAATCTGGCCAGTGACATGTACCTAATATCACAAATGGACAGTGATCAATATGTGCCAATAATGACTGTAGCTAATCTTGACCTCGTCAAAAAACTCAGCACCGATATGGATCTAATCGTCGATGTGTTACGATCTTTGCCTCTGGTGCAAGTGGACGAGAAAGGAGAGAAAGTCAGACCAAATCAGAATCGGTGCATTGTGATTCTGCGGGAGGTTCCTGAATCTACTCCAGTTGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)